ID: 1118749075

View in Genome Browser
Species Human (GRCh38)
Location 14:68793649-68793671
Sequence GTCGAAGAGAAGTCGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118749075_1118749081 2 Left 1118749075 14:68793649-68793671 CCTTTTCCCGACTTCTCTTCGAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1118749081 14:68793674-68793696 TCGGCTCCCTTCGGCAAACCGGG 0: 1
1: 0
2: 1
3: 3
4: 34
1118749075_1118749080 1 Left 1118749075 14:68793649-68793671 CCTTTTCCCGACTTCTCTTCGAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1118749080 14:68793673-68793695 CTCGGCTCCCTTCGGCAAACCGG 0: 1
1: 0
2: 0
3: 3
4: 49
1118749075_1118749088 28 Left 1118749075 14:68793649-68793671 CCTTTTCCCGACTTCTCTTCGAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1118749088 14:68793700-68793722 GCCGAGGACATTAGAAATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1118749075_1118749082 6 Left 1118749075 14:68793649-68793671 CCTTTTCCCGACTTCTCTTCGAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1118749082 14:68793678-68793700 CTCCCTTCGGCAAACCGGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 41
1118749075_1118749085 12 Left 1118749075 14:68793649-68793671 CCTTTTCCCGACTTCTCTTCGAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1118749085 14:68793684-68793706 TCGGCAAACCGGGCAGGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
1118749075_1118749087 27 Left 1118749075 14:68793649-68793671 CCTTTTCCCGACTTCTCTTCGAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1118749087 14:68793699-68793721 GGCCGAGGACATTAGAAATTTGG 0: 1
1: 0
2: 1
3: 3
4: 72
1118749075_1118749079 -7 Left 1118749075 14:68793649-68793671 CCTTTTCCCGACTTCTCTTCGAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1118749079 14:68793665-68793687 CTTCGACACTCGGCTCCCTTCGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118749075 Original CRISPR GTCGAAGAGAAGTCGGGAAA AGG (reversed) Intronic
904525891 1:31133602-31133624 GTTGAAGAAAAGTGGGCAAAGGG - Intergenic
905227830 1:36491489-36491511 GAAGAAGAGGAGTTGGGAAAGGG - Intergenic
908876051 1:68677145-68677167 GTTGAATAGAAGTGGTGAAAGGG + Intergenic
909476556 1:76087355-76087377 GCTGAAGATAAGTGGGGAAAAGG - Intronic
910756643 1:90700405-90700427 GCCAAAGAAAAGTAGGGAAAGGG + Intergenic
916680958 1:167104671-167104693 GAAGAAGAGAAGTCAGTAAACGG - Intronic
916986217 1:170194089-170194111 ATTGAATAGAAGTGGGGAAAGGG + Intergenic
917960322 1:180138487-180138509 GTCCAAAAGAAGGCAGGAAAGGG + Intergenic
919475564 1:198029272-198029294 GTAGAAGAAAACTGGGGAAACGG - Intergenic
920702913 1:208231296-208231318 GTGAGAGAGAAGCCGGGAAAAGG + Intronic
920805041 1:209224985-209225007 GTCGAAGTTAAGTTGGTAAAGGG - Intergenic
923589073 1:235302313-235302335 GTGGAAGAGAAGGAGGGGAAAGG + Intronic
1063035818 10:2285711-2285733 GACGAAGGGAAATTGGGAAATGG + Intergenic
1066006266 10:31148842-31148864 GTTGAAGAGAAGTGGGCTAAAGG + Intergenic
1070445336 10:76494216-76494238 GTCTAACAGAAGTGGGGAAGTGG + Intronic
1071731060 10:88249021-88249043 GACGAAGGGAAGGCAGGAAATGG - Intergenic
1071923892 10:90383148-90383170 GTTGAATAGAAGTAGGAAAAAGG + Intergenic
1072729684 10:97837375-97837397 GTAGAAGAGAAGTGGTGAGAAGG + Intergenic
1073211719 10:101809097-101809119 GACGAAGAGATGTCTGGAAATGG - Intronic
1075581141 10:123619532-123619554 TTAGAAGAGAAGGAGGGAAAAGG + Intergenic
1083109145 11:60387886-60387908 GTAGAAGAGGAGTTGGGAAATGG - Intronic
1083711964 11:64555073-64555095 TTCAAAGAGAAGCCAGGAAATGG + Intergenic
1085666101 11:78417246-78417268 GTCGGGGAGAGGGCGGGAAAGGG - Intronic
1086895330 11:92305350-92305372 GTAGAAGAAAAGATGGGAAATGG + Intergenic
1087329805 11:96766532-96766554 GTTGAGGAGGAGTTGGGAAAAGG - Intergenic
1087752471 11:102021455-102021477 GTGGAAGAGAAAGGGGGAAAGGG - Intergenic
1088180826 11:107107909-107107931 GTCGAATAGAATTGGTGAAAGGG - Intergenic
1088675194 11:112186104-112186126 GTAGAAGAGAAGGAGGGCAAAGG + Intronic
1091953719 12:4618055-4618077 GTCCAAGAGAAGGCAGCAAAGGG + Intronic
1092291113 12:7159942-7159964 GTCACAGAGAAGTCGGGGAAAGG - Intergenic
1093293930 12:17364544-17364566 GTAGAAGAGAAGGCTGAAAAAGG + Intergenic
1093647009 12:21598070-21598092 GACGAAGAGAAGTTGGTTAATGG + Intronic
1093948781 12:25140149-25140171 GTTGAATAGAAGTTGTGAAAGGG - Intronic
1105883044 13:24620263-24620285 GATGAAGAGAGGTCGGTAAATGG - Intergenic
1108038819 13:46320576-46320598 GAGGAAGAGAAGGAGGGAAAAGG + Intergenic
1114897763 14:27012966-27012988 ATAGAAGAGAAGACGGGGAAAGG + Intergenic
1118749075 14:68793649-68793671 GTCGAAGAGAAGTCGGGAAAAGG - Intronic
1118852561 14:69595309-69595331 GTTGAAGGGAAGTCAGGAAAAGG + Intergenic
1119582348 14:75797451-75797473 GTTGAATAGAAGTGGTGAAATGG + Intronic
1119659083 14:76437855-76437877 GTGGAGGAGAAGGCGGGCAAGGG - Intronic
1120624020 14:86802492-86802514 GACGAAGAGAAGTGGGAAGATGG - Intergenic
1120691387 14:87597255-87597277 GTTGAAGATAAGTAGGGTAAAGG - Intergenic
1122233126 14:100317199-100317221 GCCGATGAGAGTTCGGGAAAAGG - Intergenic
1126677183 15:51170832-51170854 GTCTATGGGAAGTTGGGAAATGG + Intergenic
1127420445 15:58799844-58799866 GTGGAAGAGATGTAGGGAGAAGG + Intronic
1133323700 16:4930736-4930758 GTGGAAGAGAAGCAGTGAAAAGG + Intronic
1133626775 16:7577468-7577490 GTCTAAGAGAAGAGGTGAAAAGG - Intronic
1133666112 16:7969455-7969477 GACCAAGAGCAGTCAGGAAAAGG - Intergenic
1136486386 16:30574834-30574856 GATGAAGAGAAGTTGGGTAATGG - Intronic
1140559416 16:75960626-75960648 GTAGAAGAGAGGTAGGGACATGG - Intergenic
1143807791 17:9443655-9443677 GAAGAAGAGAACTCTGGAAAAGG - Intronic
1151079190 17:71308842-71308864 GTTGAATAGAAGTGGTGAAATGG - Intergenic
1156521226 18:37723858-37723880 GTATTAGAGAAGTAGGGAAATGG + Intergenic
1156853837 18:41758738-41758760 GTCAAAGAGAAAGCTGGAAAAGG - Intergenic
1158061238 18:53345940-53345962 ATCCAAAAGAAGTCAGGAAAGGG - Intronic
1160630546 18:80244241-80244263 GTCGAAGCTAAGTGGGAAAAGGG + Intronic
1161709860 19:5841785-5841807 GAGAAAGAGAAGTTGGGAAAGGG + Intergenic
1161713629 19:5863669-5863691 GAGAAAGAGAAGTTGGGAAAGGG + Intergenic
1161716065 19:5876937-5876959 GAGAAAGAGAAGTTGGGAAAGGG + Intronic
1162222894 19:9193761-9193783 GTTGAAGAGAAGTTGGTATATGG + Intergenic
1166588531 19:43973360-43973382 GTTGAACAGGAGTGGGGAAAGGG - Intronic
1167000941 19:46745756-46745778 GGCTAAGAGAACTCGGGAAAGGG - Intronic
926971959 2:18475408-18475430 GTGAAAGACAAGTGGGGAAAAGG - Intergenic
927299050 2:21489542-21489564 GTGGAAGAGAAACAGGGAAATGG + Intergenic
928122395 2:28592405-28592427 GAAGAAGAAAAGTGGGGAAAGGG - Intronic
928142413 2:28741293-28741315 GTTGAAGAGAAGTTGGTTAATGG + Intergenic
928268493 2:29832959-29832981 GGCAAAGAGAAGTAGGGAGAGGG + Intronic
928657232 2:33464893-33464915 GAGGAAGAGAGGTGGGGAAATGG - Intronic
929061450 2:37928911-37928933 GTCCAAAAGAAGGCAGGAAAAGG - Intronic
930665271 2:54095332-54095354 GTGGAATAGAAGTGGGGGAAAGG - Intronic
933439533 2:82294985-82295007 ATGGATGAGAAGTAGGGAAATGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935196228 2:100818743-100818765 GACGGAGAGACGTCCGGAAAAGG + Intergenic
935527231 2:104185095-104185117 GTCCAAAAGAAGTCAGAAAAAGG - Intergenic
936986810 2:118319311-118319333 GGAGAAGAGAAGGCAGGAAAGGG - Intergenic
939236075 2:139495231-139495253 GTCAAATAGAACTAGGGAAATGG + Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
940108391 2:150124103-150124125 GTGGGAAAGAAGTCAGGAAATGG + Intergenic
946488835 2:220127837-220127859 GACAAAGAGAAGTCGAGAATGGG - Intergenic
946732044 2:222719390-222719412 AAGGAAGAGAAGTGGGGAAAGGG + Intergenic
1169023331 20:2347247-2347269 GTGGAAGAGGAGTGGGGAAGGGG - Intergenic
1169555001 20:6740127-6740149 GTGGAAGAGAAGAGGAGAAAAGG - Intergenic
1169963573 20:11190288-11190310 GTCTAAGATAAATAGGGAAAAGG - Intergenic
1174583862 20:51592549-51592571 GTAGAAGAGAAGGAGTGAAAGGG + Intergenic
1176062310 20:63177805-63177827 GCCGAAGAGCAGGCGGGAACTGG + Intergenic
1176274660 20:64257113-64257135 GTGGAAGATGAGTGGGGAAAAGG - Intronic
1180599620 22:17007668-17007690 GTCGGAGAGTGGGCGGGAAAGGG - Intronic
1181875667 22:25938661-25938683 CTCGATGAGTAATCGGGAAAGGG + Intronic
1183935708 22:41260972-41260994 GTGGAAGAGGAGTGGGGATAAGG + Intronic
950574313 3:13822548-13822570 GTTGCAGAGAAGAAGGGAAATGG + Intronic
951991233 3:28678007-28678029 GTCGAAAGGGAGTCTGGAAAGGG + Intergenic
957618165 3:82559804-82559826 GAAGAAGAGAAGTAGGGGAAGGG + Intergenic
960026562 3:113017757-113017779 GTATAAGAGAAGTTGGAAAATGG + Intronic
962667564 3:137670453-137670475 GTAGAAAAGAATTCAGGAAAAGG + Intergenic
965316221 3:167193986-167194008 GTTGAAGAGAGGTTGGGAATGGG + Intergenic
969360684 4:6661630-6661652 GAAGAAGAGAAGTCTGAAAAGGG + Intergenic
970472057 4:16388817-16388839 CTCAAAGAGAAATGGGGAAAGGG - Intergenic
971226431 4:24757086-24757108 GAACAAGAGAAGTGGGGAAAAGG - Intergenic
971888439 4:32483648-32483670 TTCGAAGAAAGGTAGGGAAAAGG + Intergenic
974166514 4:58211896-58211918 GTTGAAGAGTAATAGGGAAAGGG - Intergenic
976920452 4:90434883-90434905 GACGAAAAGAAGTGGGGAAAAGG - Intronic
981879824 4:149596131-149596153 GCTGAAGAGAAGGAGGGAAATGG + Intergenic
982203316 4:152978580-152978602 GTCTCAGAGGAGTCGTGAAATGG - Exonic
984895495 4:184536031-184536053 GTAGGAGAGAAGTAGGAAAAGGG - Intergenic
986428021 5:7654134-7654156 GATAAAGAGAAGTCAGGAAAGGG + Intronic
986754130 5:10818771-10818793 GCAGAACAGAAGTCAGGAAATGG - Intergenic
986793387 5:11185453-11185475 ATCCCAGAGAAGTCAGGAAATGG - Intronic
987264654 5:16240378-16240400 GTTGAAGAGAAGTTGGTTAACGG + Intergenic
987472208 5:18346288-18346310 GTTGAATAGAAGTGGGGGAAGGG + Intergenic
992625818 5:78634981-78635003 GGGGAAGAAGAGTCGGGAAATGG + Intronic
994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG + Exonic
994201095 5:96977120-96977142 GTTGGAGAGGAGTCAGGAAAAGG + Intronic
994933942 5:106227272-106227294 GTCCTAGAGAAGTTAGGAAAGGG - Intergenic
995725694 5:115179097-115179119 GACGGAGAGAAGGCGGGAAAGGG - Intronic
1000026135 5:157360755-157360777 ATCTAAGATAAGTCAGGAAATGG + Intronic
1004525744 6:16405853-16405875 GTGAAAGAAAAGTCGGGAAATGG + Intronic
1004536400 6:16506797-16506819 GTAGAAGAGAATTAGGTAAAAGG - Intronic
1005105650 6:22221742-22221764 GTCAAAGAGAGGGCAGGAAAGGG - Intergenic
1007509503 6:42364406-42364428 GTCTAAGGGAAGTGGGGAAAGGG - Intronic
1012459534 6:99445020-99445042 GTCAGAGAGAAGTGGAGAAAGGG - Intronic
1022248959 7:28587902-28587924 GTAGAAAAGCAGTCAGGAAATGG - Intronic
1023878163 7:44302862-44302884 GTCGAATAGCAGTGGTGAAAGGG - Intronic
1025857526 7:65295995-65296017 GTTGAATAGAAGTGGTGAAAGGG + Intergenic
1029441628 7:100590016-100590038 GTTGAAGAGAAGAGGGGGAAAGG + Exonic
1041160855 8:55042399-55042421 GTTGAACAGAAGTGGTGAAAGGG - Intergenic
1041886186 8:62810669-62810691 GTTTAACAGAAGTCAGGAAAAGG - Intronic
1046428361 8:114086230-114086252 GTAGGAGAGAAGTGGGGAAGTGG - Intergenic
1049159395 8:141087600-141087622 GGTGAAAAGAAGTCAGGAAAGGG + Intergenic
1051948674 9:22603614-22603636 GTCTTAGAGAACTAGGGAAATGG + Intergenic
1053010157 9:34628304-34628326 GACCAAGAGACATCGGGAAATGG + Intergenic
1053219402 9:36299424-36299446 GTAGAAGAAGAGTCTGGAAAAGG - Intronic
1053786721 9:41657677-41657699 GGGGAAGAGAGGTCAGGAAAAGG - Intergenic
1054158340 9:61656518-61656540 GGGGAAGAGAGGTCAGGAAAAGG + Intergenic
1054478113 9:65587523-65587545 GGGGAAGAGAGGTCAGGAAAAGG + Intergenic
1056563963 9:87758003-87758025 GTGGAATAGAAGGCGGGGAAAGG - Intergenic
1062140406 9:134954490-134954512 GTTGAATAGAAGTGGGGAGAAGG + Intergenic
1186942806 X:14529314-14529336 GGAGAAGAGAGGTCGGGAGACGG - Intronic
1188416745 X:29944655-29944677 GTAAAAGAGAAGAAGGGAAATGG - Intronic
1188866401 X:35318316-35318338 GTCAAAGAGAAATGGAGAAATGG - Intergenic
1193569509 X:83125416-83125438 GAGGAAGAGAAGTGGGGAAAGGG + Intergenic
1194074194 X:89368307-89368329 GGTGAAGAGAATTTGGGAAAAGG + Intergenic
1195633196 X:107082053-107082075 GTCAAAAAGAAGTGGGGAAAGGG + Intronic
1196130040 X:112145690-112145712 GACGAAAAGAAGTGGGGCAATGG + Intergenic
1198724459 X:139662767-139662789 GGTGAAGAGAAGTGGGTAAAAGG - Intronic
1199370893 X:147046698-147046720 GTGGTAGAGAAGGGGGGAAATGG - Intergenic
1199704643 X:150413244-150413266 GTGGAAGAGAAGTCAAGTAAGGG - Intronic
1200729586 Y:6719834-6719856 GGTGAAGAGAATTTGGGAAAAGG + Intergenic