ID: 1118749193

View in Genome Browser
Species Human (GRCh38)
Location 14:68794273-68794295
Sequence AGCCATATGTTCCACTCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118749193_1118749195 -2 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749195 14:68794294-68794316 CTTGTCACGCTGCGCCGTTTTGG 0: 1
1: 0
2: 0
3: 0
4: 16
1118749193_1118749199 8 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749199 14:68794304-68794326 TGCGCCGTTTTGGCGGGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 97
1118749193_1118749203 15 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749203 14:68794311-68794333 TTTTGGCGGGAGGTGGAGAGGGG 0: 1
1: 2
2: 6
3: 51
4: 519
1118749193_1118749201 13 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749201 14:68794309-68794331 CGTTTTGGCGGGAGGTGGAGAGG 0: 1
1: 0
2: 1
3: 17
4: 492
1118749193_1118749196 1 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749196 14:68794297-68794319 GTCACGCTGCGCCGTTTTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 21
1118749193_1118749204 16 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749204 14:68794312-68794334 TTTGGCGGGAGGTGGAGAGGGGG 0: 1
1: 0
2: 4
3: 61
4: 584
1118749193_1118749198 5 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749198 14:68794301-68794323 CGCTGCGCCGTTTTGGCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1118749193_1118749206 23 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749206 14:68794319-68794341 GGAGGTGGAGAGGGGGACATGGG 0: 1
1: 0
2: 8
3: 131
4: 1061
1118749193_1118749202 14 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749202 14:68794310-68794332 GTTTTGGCGGGAGGTGGAGAGGG 0: 1
1: 0
2: 2
3: 55
4: 450
1118749193_1118749197 2 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749197 14:68794298-68794320 TCACGCTGCGCCGTTTTGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 21
1118749193_1118749205 22 Left 1118749193 14:68794273-68794295 CCACCGGAGTGGAACATATGGCT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1118749205 14:68794318-68794340 GGGAGGTGGAGAGGGGGACATGG 0: 1
1: 0
2: 27
3: 352
4: 2607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118749193 Original CRISPR AGCCATATGTTCCACTCCGG TGG (reversed) Intronic
900816715 1:4852945-4852967 ATCCATTTGTGCCACTCCCGTGG + Intergenic
905491008 1:38343761-38343783 AGCCATATACTCTACTCCAGAGG + Intergenic
907270057 1:53285784-53285806 AGGCATATGGTCCCCTCCGGGGG - Intronic
913586771 1:120282648-120282670 AGGCATATGTCCCACTCTGTCGG - Intergenic
913621415 1:120615722-120615744 AGGCATATGTCCCACTCTGTCGG + Intergenic
914568787 1:148894533-148894555 AGGCATATGTCCCACTCTGTCGG - Intronic
914604041 1:149235723-149235745 AGGCATATGTCCCACTCTGTCGG + Intergenic
1065564685 10:26996786-26996808 AACCAAATGTTCCACTTCTGGGG + Intronic
1072960698 10:99926624-99926646 AGCCAAAGGTTCCAGTCTGGGGG + Intronic
1077162238 11:1119123-1119145 AGCCATTTATTCCAGTCCAGAGG + Intergenic
1080649413 11:34210213-34210235 AGCCATAGATTCCACCCCCGTGG - Intronic
1102317275 12:111899364-111899386 AGCCTTAAGTTCCACTTCTGTGG - Intergenic
1104366587 12:128183550-128183572 AGCCATCTCTTCCACTGCGTTGG - Intergenic
1107986238 13:45778687-45778709 ATCCACATGTTCCACACCTGTGG + Exonic
1118749193 14:68794273-68794295 AGCCATATGTTCCACTCCGGTGG - Intronic
1125061097 15:35425400-35425422 AGCCATATGTTTTACTACAGAGG + Intronic
1133227012 16:4345811-4345833 AGCCTCCTGTTCCACTCGGGAGG - Intronic
1134492282 16:14703867-14703889 AGCCTTACGTTCCAGTCAGGGGG - Intergenic
1134497663 16:14742989-14743011 AGCCTTACGTTCCAGTCAGGGGG - Intronic
1149921624 17:60665837-60665859 TGCCACATGTTCCCCTCCAGAGG + Exonic
1151174603 17:72276780-72276802 AGACATATGTTCCACCCAGCAGG - Intergenic
927933875 2:27063863-27063885 AGCCAGATGTTCCATTTTGGGGG - Intronic
934584156 2:95474966-95474988 GCCCATATGTTCCACTCCTCTGG - Intergenic
934595296 2:95601748-95601770 GCCCATATGTTCCACTCCTCTGG + Intergenic
934787476 2:97023786-97023808 GCCCATATGTTCCACTCCTCTGG - Intergenic
941184215 2:162301125-162301147 CCCCATATGTTCCACTCCTTAGG - Intronic
941316673 2:164001997-164002019 AGTCATTTGCTCCACTCTGGAGG + Intergenic
944215868 2:197255118-197255140 AGCCATATGTTCCACAACTATGG + Intronic
944443993 2:199771237-199771259 AGCCATAGGTAGCACTCCGTTGG - Intronic
1174549874 20:51354712-51354734 AGCCATGCGTTCCACCCCTGTGG - Intergenic
1175031555 20:55959920-55959942 TGGGATATGTTCCACTCCAGTGG + Intergenic
1178685123 21:34704629-34704651 GGCCAGATGTTCCATTCCAGTGG + Intronic
1183167947 22:36161635-36161657 TGCCCCATGTTCCACTCCTGTGG + Intronic
949911002 3:8907892-8907914 AGCCAGATGCTCCTCTCTGGTGG - Intronic
963960817 3:151306657-151306679 AGTCATTTGTACCACGCCGGGGG + Intronic
974270803 4:59649535-59649557 TGCCATCTGTTCCTCTCCTGAGG + Intergenic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
981023244 4:140050559-140050581 AGCCATGTGTTCCACTGCCGTGG + Intronic
982824602 4:159986418-159986440 GCCCATATGTTCCACTACAGGGG - Intergenic
990629369 5:57651210-57651232 AGGAATATGTTCCACCCCAGTGG - Intergenic
1008760914 6:54850025-54850047 AGCAATATGTTCCTCTCCAGGGG + Intronic
1017628373 6:156370991-156371013 ATCCATAGGTTCCACACCTGTGG + Intergenic
1021901327 7:25288607-25288629 AGCCATATGTTCTACTCTGTTGG - Intergenic
1022499246 7:30872273-30872295 AGCCATGTGCTCCAATCAGGTGG - Exonic
1042911199 8:73828250-73828272 AACCATCTATTCCACTCTGGAGG + Intronic
1044749685 8:95404119-95404141 AGCCAATTCTTCCACTCTGGAGG + Intergenic
1048285259 8:133136633-133136655 AGCAATATGTCCTACTCTGGAGG - Intergenic
1061909152 9:133713644-133713666 AGACCAATGTCCCACTCCGGCGG + Intronic
1188513108 X:30957969-30957991 AGCCTTATAATCCACTCCCGTGG + Intronic
1188939147 X:36215860-36215882 AGCCAGATGGCCCTCTCCGGGGG + Intergenic
1191059867 X:56283656-56283678 AGCCATATGGTCCGGTGCGGTGG - Intronic
1195714714 X:107807614-107807636 AGCCATAGGTTCCACATCAGTGG + Intergenic
1198975764 X:142333704-142333726 AGCCTAATCTTCCACTCCAGGGG - Intergenic