ID: 1118753337

View in Genome Browser
Species Human (GRCh38)
Location 14:68821744-68821766
Sequence GCCCACCTTGGCCCACTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118753333_1118753337 -1 Left 1118753333 14:68821722-68821744 CCTAGAATGCCTGCCTGGGGATG No data
Right 1118753337 14:68821744-68821766 GCCCACCTTGGCCCACTTGATGG No data
1118753332_1118753337 0 Left 1118753332 14:68821721-68821743 CCCTAGAATGCCTGCCTGGGGAT No data
Right 1118753337 14:68821744-68821766 GCCCACCTTGGCCCACTTGATGG No data
1118753334_1118753337 -10 Left 1118753334 14:68821731-68821753 CCTGCCTGGGGATGCCCACCTTG No data
Right 1118753337 14:68821744-68821766 GCCCACCTTGGCCCACTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118753337 Original CRISPR GCCCACCTTGGCCCACTTGA TGG Intergenic
No off target data available for this crispr