ID: 1118754260

View in Genome Browser
Species Human (GRCh38)
Location 14:68827225-68827247
Sequence CCTGGGAAGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118754249_1118754260 25 Left 1118754249 14:68827177-68827199 CCTGTAGTCCCAGCTACTCAGGA 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
Right 1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG No data
1118754251_1118754260 17 Left 1118754251 14:68827185-68827207 CCCAGCTACTCAGGAGGCTGAAA 0: 367
1: 13386
2: 123391
3: 222765
4: 239200
Right 1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG No data
1118754252_1118754260 16 Left 1118754252 14:68827186-68827208 CCAGCTACTCAGGAGGCTGAAAT 0: 116
1: 3298
2: 28872
3: 139391
4: 235549
Right 1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118754260 Original CRISPR CCTGGGAAGCAGAAGTTGCA GGG Intergenic
No off target data available for this crispr