ID: 1118760598

View in Genome Browser
Species Human (GRCh38)
Location 14:68878457-68878479
Sequence GATCTCCATGGGTTACAACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118760598_1118760609 30 Left 1118760598 14:68878457-68878479 CCATGTTGTAACCCATGGAGATC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1118760609 14:68878510-68878532 ATGCCTGTCTTCTTCTGTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 235
1118760598_1118760608 29 Left 1118760598 14:68878457-68878479 CCATGTTGTAACCCATGGAGATC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1118760608 14:68878509-68878531 CATGCCTGTCTTCTTCTGTGGGG 0: 1
1: 0
2: 0
3: 30
4: 355
1118760598_1118760606 27 Left 1118760598 14:68878457-68878479 CCATGTTGTAACCCATGGAGATC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1118760606 14:68878507-68878529 ATCATGCCTGTCTTCTTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 331
1118760598_1118760607 28 Left 1118760598 14:68878457-68878479 CCATGTTGTAACCCATGGAGATC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1118760607 14:68878508-68878530 TCATGCCTGTCTTCTTCTGTGGG 0: 1
1: 0
2: 3
3: 24
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118760598 Original CRISPR GATCTCCATGGGTTACAACA TGG (reversed) Exonic
903125877 1:21247301-21247323 GATCTCCACGGGGTAGAAGATGG + Exonic
903303396 1:22394704-22394726 GATCTCACTGGGCTAAAACAAGG - Intergenic
908010332 1:59769674-59769696 GGTCTGCCTGGGTTAAAACAAGG - Intergenic
910401771 1:86844655-86844677 GATCACCATGGCTTATAAGAAGG - Intergenic
914722380 1:150299963-150299985 AATCTCCAGGGGTTGCAACCTGG + Intronic
916391611 1:164337134-164337156 TATCTCCAAGTGTGACAACAAGG + Intergenic
916787522 1:168097190-168097212 GATCTTCATGGGGTACACCATGG + Exonic
918543659 1:185658630-185658652 GAGGTTCATGGGTTAGAACATGG - Intergenic
918668908 1:187187966-187187988 GGTCTCCATGGCTAAAAACAAGG + Intergenic
920824467 1:209412593-209412615 GATATCCATGGTTTACACCAAGG + Intergenic
921326666 1:213991112-213991134 CTTGTCCATGGGTTAAAACATGG + Intronic
922632194 1:227126646-227126668 CATGACCATGGTTTACAACAGGG + Intronic
923752566 1:236759768-236759790 GATTTCCATGGGTTATGACCTGG + Exonic
1062992144 10:1830328-1830350 GATTTCCATGGCTTCAAACATGG + Intergenic
1063852726 10:10211345-10211367 TAACTTCATAGGTTACAACAGGG - Intergenic
1064566664 10:16646643-16646665 CAGCTCCAGGGGTTACTACATGG + Intronic
1065488139 10:26254516-26254538 CACATCCATGGTTTACAACAGGG - Intronic
1065987893 10:30974538-30974560 TATTTCCATGTGTTACAATAGGG + Intronic
1067833516 10:49623806-49623828 GAGCACCATGGGTTACATGAAGG - Intronic
1071682746 10:87723378-87723400 TATCTCCATGGGTTGCTGCAGGG - Intronic
1072816049 10:98510423-98510445 GATCTGCATGGGCTGCAACCTGG + Intronic
1072816641 10:98516021-98516043 GATCTCCATCCCTTACAGCACGG + Intronic
1074893522 10:117755298-117755320 GATTTCCATGACCTACAACACGG - Intergenic
1084744878 11:71163421-71163443 GATCTCAGTGGGTGAGAACACGG + Intronic
1085651170 11:78269933-78269955 AATCTCCAAGAGTTACAAAATGG + Intronic
1085691408 11:78667283-78667305 GCTCTCAATGTGTGACAACATGG + Intronic
1095864229 12:46954190-46954212 GATCTCCCTGGGTAATAAGAGGG - Intergenic
1096906597 12:54942234-54942256 GATCTGCATGGGAAACACCAGGG - Intergenic
1099765860 12:86982648-86982670 GATCTCATTGGGTTTAAACAGGG + Intergenic
1101496562 12:105260007-105260029 AACCTCCATAGGTTACATCATGG + Intronic
1102742361 12:115219282-115219304 GATCTCCAACGGATACACCACGG - Intergenic
1112796805 13:103066090-103066112 GTTCTCCATGGGATGCAACGTGG - Exonic
1118760598 14:68878457-68878479 GATCTCCATGGGTTACAACATGG - Exonic
1121713217 14:96054258-96054280 GGTCTCCCTGGGCTACAGCATGG + Intronic
1123175603 14:106415674-106415696 GAAATTCATGGGTTATAACATGG - Intergenic
1126224707 15:46257575-46257597 GAACTCCATATGCTACAACATGG + Intergenic
1126504811 15:49392470-49392492 GATTTGCATGGGTTCAAACATGG + Intronic
1130263218 15:82375859-82375881 GATCTCCACAGGGTATAACAAGG + Intergenic
1130278082 15:82493801-82493823 GATCTCCACAGGATATAACAAGG - Intergenic
1130470411 15:84220986-84221008 GATCTCCACAGGATATAACAAGG - Intergenic
1130592699 15:85225614-85225636 GATCTCCACAGGATATAACAAGG - Intergenic
1138591620 16:58002259-58002281 GGTCCCCATGGGAAACAACAGGG - Intronic
1140115503 16:72037913-72037935 GATCTCAGAGGGTTACTACACGG + Intergenic
1149671989 17:58422610-58422632 GGTCTCTTTGGGTTACAACTGGG - Intronic
1160048967 18:75413834-75413856 GATCTGCATTGCTTAGAACAGGG + Intronic
1160660222 19:294696-294718 GCTCTCCCTGGGTCACAGCAAGG + Intergenic
1162887638 19:13707879-13707901 GATCTTCAGGGGTTGCCACATGG - Intergenic
1162952892 19:14082301-14082323 GATCTCCATGGGTTGTTACTGGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1164543737 19:29141993-29142015 GATCTCAATGGCTTACATCAGGG + Intergenic
1166331648 19:42081233-42081255 GATCTCAATGGCTTCCACCAGGG - Exonic
926512041 2:13793316-13793338 GATCCCCATGGTTTACAAAGAGG - Intergenic
926901489 2:17755197-17755219 GTTTCCCATTGGTTACAACAAGG - Intronic
927770557 2:25857176-25857198 GAACTCCATGGCTCACCACATGG - Intronic
937274431 2:120674841-120674863 GAATTCCATGAATTACAACAGGG - Intergenic
939631118 2:144527826-144527848 GATCTGAAGGGGTTACAACTGGG + Intergenic
941354539 2:164473477-164473499 TATTTCCTTGGGTAACAACATGG + Intergenic
1171009180 20:21498781-21498803 GGTCACCATGGGCTACAACACGG - Intergenic
1173903842 20:46611417-46611439 GATCTCCAAGGGGCACATCATGG - Intronic
1174876759 20:54234432-54234454 CATCTTAATGGGATACAACAGGG + Intergenic
1176865595 21:14052369-14052391 GAACTCCATATGCTACAACATGG + Intergenic
1177548525 21:22591151-22591173 GATCTCCATGTGCCACAAGACGG - Intergenic
1180203484 21:46241930-46241952 GATCTCTATGGGGAACAAGAAGG + Intronic
950896334 3:16454996-16455018 GATCTTCATGGGAGACAGCATGG - Intronic
960966288 3:123107012-123107034 GATCACCGCTGGTTACAACATGG - Intronic
968111401 3:196050500-196050522 GATCTCCATATGTTACACTAAGG - Exonic
981888212 4:149704311-149704333 GATACCAATGGGTTAGAACAGGG + Intergenic
988729826 5:33961018-33961040 CAACTCCATGGGGTAGAACAAGG + Intronic
992252860 5:74893215-74893237 GATCTCTCTGTGTTTCAACAGGG - Intergenic
1003394056 6:5737818-5737840 GGTCTTCATGGGTTGCAAGATGG - Intronic
1008365164 6:50669787-50669809 AATTTCAATGGCTTACAACAGGG + Intergenic
1022359579 7:29645063-29645085 GAACTCCGTAGCTTACAACATGG + Intergenic
1024189313 7:46989372-46989394 GATGTCCATGGCTTGCAAGAAGG + Intergenic
1026628991 7:72021391-72021413 GACCTCCATGGGTCAAAAGATGG + Intronic
1028464166 7:91130982-91131004 GATTTCCATGAGTTACTTCATGG - Intronic
1037661459 8:20930730-20930752 TATCTGCATGGGTTACCATAAGG - Intergenic
1039091190 8:33831347-33831369 CATCTACATGGGTTTCTACATGG - Intergenic
1039108938 8:34020662-34020684 TTTCTCCATGGGTTACACCATGG + Intergenic
1048316316 8:133365136-133365158 CATCTCCATGGCTATCAACAAGG - Intergenic
1053265574 9:36710744-36710766 AATCTCAATGCCTTACAACAGGG + Intergenic
1055114392 9:72591335-72591357 GATCTCTGTGGGTGACACCAAGG - Intronic
1061119866 9:128635932-128635954 AAGCTCCCTGGGGTACAACAGGG - Intronic
1062425472 9:136504151-136504173 GCTCTCCAGGGGTTCCCACAGGG - Intronic
1190868670 X:54406526-54406548 GGTCTCAATGGATTTCAACATGG + Intergenic
1193601981 X:83518559-83518581 CATCTACCTGGGTTTCAACAAGG - Intergenic
1195882758 X:109609968-109609990 AGTCTCCATGGGTTTCAAGAGGG - Intergenic
1195934851 X:110115156-110115178 TATCTGCATTGGTGACAACAAGG - Intronic
1201354966 Y:13087349-13087371 GTTCTACTTGGGTTAGAACAAGG + Intergenic