ID: 1118765034

View in Genome Browser
Species Human (GRCh38)
Location 14:68903963-68903985
Sequence GCATCCTGGCTAGCAGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118765028_1118765034 -8 Left 1118765028 14:68903948-68903970 CCTGTCCCCATCCAGGCATCCTG 0: 1
1: 0
2: 3
3: 28
4: 322
Right 1118765034 14:68903963-68903985 GCATCCTGGCTAGCAGCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 132
1118765027_1118765034 -2 Left 1118765027 14:68903942-68903964 CCTGAACCTGTCCCCATCCAGGC 0: 1
1: 0
2: 0
3: 32
4: 247
Right 1118765034 14:68903963-68903985 GCATCCTGGCTAGCAGCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 132
1118765025_1118765034 -1 Left 1118765025 14:68903941-68903963 CCCTGAACCTGTCCCCATCCAGG 0: 1
1: 0
2: 1
3: 22
4: 276
Right 1118765034 14:68903963-68903985 GCATCCTGGCTAGCAGCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118765034 Original CRISPR GCATCCTGGCTAGCAGCATC TGG Intronic
900398568 1:2463400-2463422 GCAGCCTGCCTACCAGCACCAGG - Intronic
901525956 1:9823673-9823695 GCAGCCCGGCCAGCAGCAGCCGG + Exonic
902342300 1:15792019-15792041 TCTTCCTGTCTCGCAGCATCTGG - Intergenic
903260844 1:22131190-22131212 GCACCCTGGCTAGCATCTTTGGG - Intronic
905020335 1:34806474-34806496 GCGTCCTGGGTGGAAGCATCTGG - Intronic
906052622 1:42887575-42887597 GGCTCCTGGCCAGCAGCCTCCGG + Intergenic
907310434 1:53535872-53535894 GCATTCTGGCCAGCATGATCTGG + Intronic
919823098 1:201485090-201485112 GCAACTTGGCCAGCATCATCTGG - Intronic
921852223 1:219943297-219943319 GCATCCTGACTAGAAGAAGCAGG - Intronic
922085586 1:222343966-222343988 GCATCCTTTCCAGCAGAATCTGG - Intergenic
923401483 1:233619343-233619365 GCATCCTGGCTAAAGGCACCAGG - Intronic
923517462 1:234709651-234709673 GCATCCTGACCAGCAGCCCCGGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063297870 10:4825489-4825511 GCGTCCTTGCTTGCAGCCTCGGG - Intronic
1072636823 10:97183769-97183791 GCAACCAGGGTAGCAGCTTCAGG + Intronic
1074403299 10:113160159-113160181 GCATTTTGGCTGGCAGCAGCAGG - Intronic
1074896233 10:117779978-117780000 CCATCCTGGCTGGCACCACCGGG + Intergenic
1076888121 10:133271805-133271827 GCATCATGGCGGGCAGCATTGGG - Exonic
1079177280 11:18153881-18153903 GGATCCTGACTAGCAGAACCAGG - Intronic
1085309382 11:75507160-75507182 ACATCCTGCCCAGCAGCGTCTGG - Intronic
1085824981 11:79836710-79836732 CCATCCTTTCTAGCAGCATAAGG - Intergenic
1090513705 11:127401981-127402003 CCAGCCTGGATAGCAGCATGAGG + Intergenic
1090941336 11:131390723-131390745 GGTCCCTGGCTGGCAGCATCAGG + Intronic
1091167588 11:133493165-133493187 CCATCCTGGCTGGGAGCCTCTGG + Intronic
1091360253 11:134973753-134973775 CCATCCTGGCTCCCAGCAGCTGG - Intergenic
1093574992 12:20716628-20716650 GCACCTTTGCTAGCTGCATCTGG + Intronic
1097181846 12:57176114-57176136 GCATCCTGCCTGGCAGCAATCGG - Intronic
1103009703 12:117448612-117448634 GCATTCTGGGAAGCAGCATTGGG - Intronic
1107583785 13:41821439-41821461 GGAACCTAGCTAGCATCATCAGG - Intronic
1107769771 13:43777188-43777210 GGATTCTGCATAGCAGCATCAGG - Intronic
1112864970 13:103883774-103883796 GTATCCTGTCTAACAGCCTCTGG - Intergenic
1114051390 14:18921643-18921665 CCATCCTGGCTTGGAGCAGCTGG - Intergenic
1114111171 14:19480282-19480304 CCATCCTGGCTTGGAGCAGCTGG + Intergenic
1118765034 14:68903963-68903985 GCATCCTGGCTAGCAGCATCTGG + Intronic
1121450577 14:94004597-94004619 GCTTCCTGGCTGGAGGCATCGGG - Intergenic
1122407714 14:101510053-101510075 ACACCCTGGCGAGCAGCATGGGG + Intergenic
1127966891 15:63929330-63929352 GCATCCAGGGGAGCAGCCTCAGG - Intronic
1129610776 15:77054197-77054219 ATAGCCCGGCTAGCAGCATCAGG + Exonic
1130384794 15:83401696-83401718 CCATTCTGGTTAGGAGCATCAGG + Intergenic
1135087541 16:19487302-19487324 GCACCCTGGCCATCACCATCTGG + Exonic
1136287282 16:29251969-29251991 GCAGCCTGGCAAGCAGCAAGAGG + Intergenic
1136289834 16:29264874-29264896 GCCTCCTTCCCAGCAGCATCAGG - Intergenic
1139557162 16:67719453-67719475 GCAGCCTGGCTAGGAGGCTCAGG + Intergenic
1139847715 16:69932535-69932557 ACAACCAGGCCAGCAGCATCTGG + Intronic
1140590297 16:76343954-76343976 GCACCCTGGCTAGTTCCATCTGG - Intronic
1140627255 16:76809043-76809065 GCAGCCTGGCTCGAAGGATCAGG + Intergenic
1141014328 16:80434165-80434187 GAAGCCTGACTAGGAGCATCAGG - Intergenic
1141180770 16:81752205-81752227 GCCTCCAGGCTTCCAGCATCAGG - Intronic
1141752221 16:85966250-85966272 GCTCCCTGTCTAGCAGCATGGGG + Intergenic
1142095718 16:88238350-88238372 GCCTCCTTCCCAGCAGCATCAGG - Intergenic
1143851622 17:9817194-9817216 GCAACCTGGCTACCTGCATATGG - Intronic
1145403711 17:22568695-22568717 GCAGCCTGGCTTGGAGCAGCTGG + Intergenic
1146909558 17:36639790-36639812 GTTCCCTGGCCAGCAGCATCAGG + Intergenic
1147506875 17:41026901-41026923 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147506878 17:41026931-41026953 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147506881 17:41026961-41026983 GCAGCTTGGCTGGCAGCAACTGG + Exonic
1147506895 17:41027069-41027091 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507165 17:41030022-41030044 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507556 17:41034597-41034619 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507559 17:41034627-41034649 GCAGCTTGGCTGGCAGCAACTGG + Exonic
1147507569 17:41034705-41034727 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507572 17:41034735-41034757 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147508203 17:41041251-41041273 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147508210 17:41041311-41041333 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147524679 17:41210473-41210495 GCAGCCAGGCTAGAAGCCTCAGG - Intronic
1147524904 17:41213200-41213222 GCAGCAGGGCTAGCAGCAGCTGG - Intronic
1151309957 17:73286896-73286918 GCATCCTGGCTTGCAGGGGCAGG - Intronic
1152067787 17:78121139-78121161 GCCTCCTGGCCAGCAGCCTCTGG + Exonic
1152245481 17:79182856-79182878 GCATCCTCCCTGGCAGCGTCGGG - Intronic
1152520110 17:80850816-80850838 GCACCCTGGCCTGCAGCACCTGG + Intronic
1152883422 17:82833591-82833613 GCCTCCTGGCCAGCAGGAACCGG - Intronic
1152911662 17:83008787-83008809 GGATCCTGGCTGGGATCATCTGG - Intronic
1154354137 18:13611934-13611956 GCAGCCTGGCTCGCAGCCTGAGG + Intronic
1156749788 18:40438040-40438062 GCATCCTGGCTAGTTGCTCCTGG + Intergenic
1160016329 18:75143542-75143564 GCTTTCTGGGTATCAGCATCAGG + Intergenic
1160031295 18:75262518-75262540 GCCTCTTGGCTAGGACCATCAGG + Intronic
1161216755 19:3098535-3098557 TCAGCCTCGCTAGCAGCCTCAGG - Intronic
1165146849 19:33736308-33736330 CCATCCTGATTAGCAGCATCCGG - Intronic
1167998567 19:53426350-53426372 GTCTCCTGGGTAGCAGGATCTGG + Intronic
1168008689 19:53512461-53512483 GTCTCCTGGGTAGCAGGATCTGG + Intergenic
931082870 2:58795104-58795126 TCATCCTGGCTAGAAGCCTGAGG + Intergenic
931528616 2:63186694-63186716 GCACCCTGAGTAGCAGCATCTGG - Intronic
932619759 2:73258584-73258606 GCCTCCTGGTCAGGAGCATCTGG - Exonic
932640533 2:73441183-73441205 GCATCCTACCTAGATGCATCAGG - Intronic
933382563 2:81568251-81568273 TCTTCCTGGCTGGCAGCACCAGG + Intergenic
938201033 2:129373272-129373294 GCCTCCTGGCTCTCTGCATCAGG + Intergenic
938766179 2:134461855-134461877 ACAGCCTGGCTGGCAGCCTCAGG + Intronic
1172332207 20:34082995-34083017 TCAACCTGGCTGGCAGCAACAGG - Intronic
1173927513 20:46791958-46791980 GCACACTGGCCAGCAGCCTCTGG + Intergenic
1179218964 21:39389713-39389735 GCACCCTGGCAAGAGGCATCAGG - Intronic
1179929442 21:44557675-44557697 GCATCCAGGCTGACAGCACCAGG - Intronic
1180469863 22:15644018-15644040 CCATCCTGGCTTGGAGCAGCTGG - Intergenic
949873249 3:8607204-8607226 TCTTCCTGGCTCGAAGCATCTGG - Intergenic
952629831 3:35453170-35453192 CCAGCCTGGCTATCAGCAGCAGG - Intergenic
955390801 3:58521001-58521023 TAACCCTGGCAAGCAGCATCTGG + Intronic
959484276 3:106908941-106908963 GCATCCTGGCCCCCAGCTTCAGG - Intergenic
964558509 3:157967172-157967194 CCATCTTGGCTTGGAGCATCAGG - Intergenic
975384707 4:73742931-73742953 GGATCCTGGCTAGCAGACTAGGG - Exonic
978703441 4:111675922-111675944 GCATACAGGCTAGCAGAATGAGG - Intergenic
980795250 4:137674364-137674386 TATTCATGGCTAGCAGCATCAGG + Intergenic
984521787 4:180810841-180810863 GGAAGCTGGGTAGCAGCATCTGG + Intergenic
988589570 5:32536985-32537007 GCATACTGGGTAGGAGCATGGGG - Intronic
989121054 5:38004960-38004982 GAAACCTGGCAGGCAGCATCCGG + Intergenic
994218051 5:97160635-97160657 GCAACCTGGAAGGCAGCATCAGG + Intronic
998138770 5:139688375-139688397 GCAGCCTGGCCGGCAGCCTCAGG - Intergenic
999764524 5:154729046-154729068 GCACCATGGCCAGCAGCATCTGG - Intronic
1001652222 5:173324087-173324109 GCACCCTGCCTGGCAGCATCTGG + Intronic
1001955859 5:175847770-175847792 GCTGCCTGACTAGCAGAATCGGG - Intronic
1002063566 5:176640988-176641010 GGTCCCTGGCCAGCAGCATCTGG + Intronic
1002104921 5:176875287-176875309 GCCTCCTGGCCAGCTCCATCTGG + Intronic
1006012464 6:31054285-31054307 GTGTCCTGGCTAGCACCATGTGG + Intergenic
1006823459 6:36916716-36916738 GTCTCCTGGCTAGCAGCAGGAGG - Intronic
1007078829 6:39084721-39084743 TCATCCTGGCAGGCAGCCTCTGG + Intronic
1009497915 6:64373947-64373969 GCTGCCTGGCTATCAGCAGCTGG + Intronic
1014803876 6:125807651-125807673 ACATCCTGGATAGCAGCATTAGG - Intronic
1015692775 6:135944098-135944120 GAATCCTGGTGAGCAGCACCAGG + Intronic
1022953083 7:35356683-35356705 GCCTCCTGGCCAGGAGCCTCTGG - Intergenic
1032490501 7:132320754-132320776 GGCTCCTGACCAGCAGCATCCGG + Intronic
1037000107 8:13707282-13707304 GCATACTGCCTAACAGCATTAGG + Intergenic
1039229217 8:35424731-35424753 GCAACCTGGGAAGGAGCATCAGG + Intronic
1046888898 8:119400233-119400255 GTATCTTGGCTATCAGCATGTGG - Intergenic
1047163995 8:122416189-122416211 GCAACTTGGGTAGCAGCATTTGG - Intergenic
1048335881 8:133501901-133501923 GCATCCTGGCTGGCAGAAGATGG + Intronic
1049698780 8:143997064-143997086 GCTGCCTGGGAAGCAGCATCTGG - Intronic
1050661602 9:7889179-7889201 GCATGCTGTCTAGCACTATCAGG + Intergenic
1057158803 9:92870151-92870173 GCACCCTGGCTAGGGGCCTCAGG + Intronic
1057804213 9:98209071-98209093 GGATCTTGGCCAGCAGCTTCAGG + Exonic
1057984890 9:99702984-99703006 GGAGCCTGGCTAGCAGCCCCTGG - Intergenic
1058120812 9:101136721-101136743 GTTACCTGGCTTGCAGCATCTGG + Intronic
1058669567 9:107349131-107349153 GCATGCTGGCTAGCAGCTCCTGG - Intergenic
1061329151 9:129881359-129881381 GGATCCTGGGAAGCAGCCTCTGG + Exonic
1061483195 9:130907231-130907253 GCGTCCTGCCTAGCAGCCCCCGG - Intronic
1187118977 X:16384783-16384805 GTATCCTGGCTAGCAGGAAAAGG + Intergenic
1187666774 X:21621146-21621168 TCATCCTGGCTACCCTCATCTGG + Intronic
1194981989 X:100450396-100450418 CCTGCCTGGCTAGCAGCAGCAGG - Intergenic
1195370301 X:104166621-104166643 GCACCCCGGCAAGCAGCAGCGGG + Exonic
1195876840 X:109550841-109550863 GCATTTTGGCTGGCAGTATCTGG + Intergenic
1200292412 X:154886089-154886111 GCAGCCGAGCTAGCAGCAGCTGG + Intronic
1200339255 X:155381829-155381851 GCAGCCGAGCTAGCAGCAGCTGG + Intergenic
1200347215 X:155458864-155458886 GCAGCCGAGCTAGCAGCAGCTGG - Intergenic
1201062332 Y:10058761-10058783 CCATCCTGACTACCAGCAGCAGG + Intergenic