ID: 1118768881

View in Genome Browser
Species Human (GRCh38)
Location 14:68928729-68928751
Sequence TAGCTCCCCCAAAATGATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118768874_1118768881 27 Left 1118768874 14:68928679-68928701 CCATTTAGTAAGTGCTCAGTGAA 0: 1
1: 0
2: 5
3: 56
4: 358
Right 1118768881 14:68928729-68928751 TAGCTCCCCCAAAATGATCCCGG 0: 1
1: 0
2: 2
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118768881 Original CRISPR TAGCTCCCCCAAAATGATCC CGG Intronic
903817912 1:26078606-26078628 AACCTCCCCCAAATTGCTCCTGG + Intergenic
904970120 1:34413057-34413079 TAGCTCTCCCCAAATCCTCCCGG + Intergenic
909899747 1:81118039-81118061 TAACTTTCCCAAAATGATCCTGG + Intergenic
913571313 1:120122966-120122988 TAGCTCCCTTAATATAATCCTGG + Intergenic
914292125 1:146283943-146283965 TAGCTCCCTTAATATAATCCTGG + Intergenic
914553169 1:148734726-148734748 TAGCTCCCTTAATATAATCCTGG + Intergenic
916158049 1:161877777-161877799 TAGCTCCGGCAAAATGATGATGG + Intronic
919887020 1:201942066-201942088 TAGCTCCGCCCTAATCATCCGGG - Intronic
924432112 1:244005995-244006017 AAGCTCCCCCAAAATTAGCTGGG + Intergenic
924674763 1:246164633-246164655 TGGCTCACCCAAAATGATCCTGG - Intronic
1063700449 10:8379291-8379313 TATCACCCCCAAAATGACACAGG + Intergenic
1065824550 10:29557884-29557906 TAGCGCCCCCATAGTGATCTGGG - Intronic
1066510826 10:36093970-36093992 TATATCCCCCAAAATTATCTTGG + Intergenic
1068668395 10:59699753-59699775 TAGCTCCCCCAAAATCTTTAAGG + Intronic
1072770704 10:98134969-98134991 GCGCTCGCCCCAAATGATCCTGG + Intronic
1074702793 10:116107168-116107190 TAAGTCCCTCAAAATGTTCCTGG + Intronic
1077077560 11:708382-708404 TAGTTTCCCCAAAATGCTCGGGG + Intronic
1085273194 11:75282392-75282414 TAGGCCCACCAAAATCATCCAGG - Intronic
1087620540 11:100536427-100536449 TTGCTCCCACAAACTAATCCTGG + Intergenic
1090858101 11:130629003-130629025 TAGCTCCCCCTAAATTACCAAGG - Intergenic
1091633286 12:2178270-2178292 TGGCTCCTCCAAAATCCTCCTGG - Intronic
1092074343 12:5660792-5660814 GAGCACCACCAAAATGAGCCCGG - Intronic
1095654530 12:44653400-44653422 TAAATGCCACAAAATGATCCTGG + Intronic
1097700825 12:62818697-62818719 AAGCTACCCAAAAATGATCCAGG + Intronic
1103036618 12:117662117-117662139 TCGTTCCCCCAAAATGAGCTGGG - Intronic
1107818239 13:44263449-44263471 TAGCACCCCCAAAATGATTCTGG - Intergenic
1108625070 13:52220280-52220302 TTGCTTCCCCAAAATGAACATGG + Intergenic
1111391522 13:87601857-87601879 TAGCTCCAGCCTAATGATCCAGG + Intergenic
1118768881 14:68928729-68928751 TAGCTCCCCCAAAATGATCCCGG + Intronic
1119895618 14:78217379-78217401 TAGCACCCCCAAAACTGTCCTGG - Intergenic
1126317221 15:47383070-47383092 TTTGTCCCTCAAAATGATCCAGG + Intronic
1126363769 15:47872547-47872569 TAACTTCCCCAGAATGATACAGG - Intergenic
1127373348 15:58360294-58360316 TATATCCCCCCAAAGGATCCAGG + Intronic
1131658659 15:94489677-94489699 TAGCTACCCCAAAAAAATCTGGG + Intergenic
1131698329 15:94904341-94904363 AACCTCCCCCAAAGTGCTCCTGG - Intergenic
1135596252 16:23745609-23745631 AAGCTCCCCCAAAACTGTCCTGG + Intergenic
1139231172 16:65283828-65283850 TAGGGCCCCCAAAAAGATCTTGG - Intergenic
1140420173 16:74813025-74813047 TAGTTCCCACCAAGTGATCCTGG + Intergenic
1152130484 17:78473170-78473192 TAGCTCCCCCAATACAATTCAGG + Intronic
1153328794 18:3850561-3850583 TAGGGCCCCCAAAATCAACCTGG + Intronic
1153650355 18:7234039-7234061 TAGCTGCCTCCAAATGATACCGG - Intergenic
1154007202 18:10541922-10541944 GACCTCCCCCGAAAAGATCCTGG - Intronic
1159586171 18:70285702-70285724 TACCTGCACCAAATTGATCCTGG - Intergenic
1161696430 19:5771166-5771188 TAGATCCCTCAAAATGATGATGG + Intronic
1161845816 19:6711343-6711365 TAGCTCCACCTACATAATCCAGG - Intronic
1163761648 19:19140168-19140190 GACCTCCCCGACAATGATCCTGG - Intergenic
1167977565 19:53242644-53242666 TGGCTCCCCCAAAATGTATCTGG - Intronic
926040706 2:9670565-9670587 TGGCCCCCCCAAAAAAATCCAGG - Intergenic
926628101 2:15110967-15110989 TATCTCCCCCAAAGTAATACTGG - Intergenic
931794202 2:65693685-65693707 TAGCTCCCCTGAAATACTCCGGG - Intergenic
940722733 2:157299359-157299381 TAGCTCTGCCACCATGATCCAGG + Intronic
942820553 2:180109090-180109112 TAGCTCCCCGCAATTGCTCCTGG - Intergenic
943606690 2:189984831-189984853 TAGATCCCCCAAAATGTTGCAGG - Intronic
1170950037 20:20928113-20928135 TAGGTCCCCCAAAATGCTTGTGG + Intergenic
1181562752 22:23715224-23715246 TAGGCCCCCCAAAGGGATCCAGG + Intergenic
1183158610 22:36094977-36094999 TAGTTCCCCAAAAAAGATCTGGG - Intergenic
950123701 3:10498590-10498612 TGGCTCCCACAAAATGGTCCCGG + Intronic
950516782 3:13471713-13471735 AACCTCCCCCAAAAAGTTCCAGG + Intergenic
952090627 3:29881017-29881039 TAGCTCCCCCAAGAGGAGCTGGG + Intronic
952554312 3:34514599-34514621 TTGCCCCCTCAACATGATCCTGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955604329 3:60684255-60684277 TAGGTCTCCCAAAATAATCCAGG + Intronic
956249470 3:67220605-67220627 TAGAGGCCACAAAATGATCCAGG + Intergenic
960763558 3:121099037-121099059 AAGCTTCCCCAAAATGATCTTGG + Intronic
963951752 3:151209609-151209631 TCACTCCCCCAAAATGACACGGG - Intronic
970729631 4:19087973-19087995 GAACTTCCCCAAAATGCTCCTGG - Intergenic
978452285 4:108847502-108847524 TAGATCCCTAAAAATAATCCAGG - Intronic
979646572 4:123076925-123076947 GAGTTTCCCCAAAATGATCTTGG - Intronic
988792011 5:34617521-34617543 TGGATACCCCTAAATGATCCAGG - Intergenic
988792651 5:34622888-34622910 TGGAAGCCCCAAAATGATCCAGG + Intergenic
994027417 5:95100924-95100946 TATTTCCCCCAAAAGGAACCAGG + Intronic
995984757 5:118156514-118156536 ATGCCCCCCCAAAATAATCCTGG - Intergenic
1001205777 5:169761673-169761695 AAGCTTCCCCAAAATGATGTGGG - Intronic
1009625132 6:66129264-66129286 TTGTTCCTCCAATATGATCCTGG - Intergenic
1009692112 6:67048567-67048589 TATCTCCCCATATATGATCCAGG + Intergenic
1014508739 6:122293835-122293857 TAGCACCCACCAAATAATCCAGG - Intergenic
1016831881 6:148442244-148442266 CAGCCCCCCCAAAATTAGCCAGG + Intronic
1018096920 6:160396023-160396045 TGGCTCCCTTAAAATTATCCAGG - Intronic
1022337164 7:29432725-29432747 TAGCTAGTCCAAAATAATCCAGG - Intronic
1023712150 7:43006381-43006403 TGGAGCCCCCAAAATCATCCTGG - Intergenic
1026647964 7:72189101-72189123 TAACCCCCGCAAAATTATCCAGG + Intronic
1029608914 7:101616185-101616207 TGACTCCCCCAAAATGCTCAGGG - Intronic
1031137434 7:117900420-117900442 TAGGTGCCCCAAAATGTTTCTGG - Intergenic
1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG + Intronic
1038149568 8:24930341-24930363 TAGCTCCCTCTGGATGATCCTGG - Intergenic
1043668199 8:82844882-82844904 TAAATCCCCCAAATTGCTCCTGG - Intergenic
1045566678 8:103323759-103323781 TAGATCCCCCAAAATAATACTGG + Intronic
1048172606 8:132122056-132122078 TAGCTCCTCCACAATGCTTCGGG - Exonic
1048556065 8:135477727-135477749 CAGGTCCACCCAAATGATCCAGG - Intronic
1050688123 9:8194874-8194896 AAAATCCACCAAAATGATCCTGG + Intergenic
1050749626 9:8921820-8921842 TGGCTCCCCCAAGATTATGCTGG - Intronic
1051738174 9:20224783-20224805 TAGCCCCACGAAAATGATCTGGG - Intergenic
1051912525 9:22170721-22170743 AAGTTCCCCCAAAGTGATCAGGG + Intergenic
1055035973 9:71818932-71818954 AAGCTCCTCCAAAAAGATCAAGG + Intergenic
1062619436 9:137412935-137412957 TACCCCTCCCAAAATTATCCAGG - Intronic
1189729638 X:44005454-44005476 TGGGTCCACCAAAATAATCCAGG + Intergenic
1192909949 X:75592771-75592793 TAGCACCCCCAAAACTGTCCTGG + Intergenic
1196009766 X:110874294-110874316 TGGCTCCCCCAAAATAATGCTGG + Intergenic
1199893346 X:152109835-152109857 TAGCTCACCCAGAATGATGCAGG + Intergenic
1199896361 X:152131108-152131130 TAGCTCACCCAGAATGATGCAGG + Intergenic
1199953327 X:152722967-152722989 TAGCTGGCCCAGAATGATGCAGG - Intergenic
1199956003 X:152742899-152742921 GAGCTCACCCAGAATGATGCAGG + Intergenic
1199956355 X:152745483-152745505 TAGCTGGCCCAGAATGATGCAGG + Intergenic