ID: 1118770389

View in Genome Browser
Species Human (GRCh38)
Location 14:68938990-68939012
Sequence GGTCACCAGGGCCAAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118770380_1118770389 12 Left 1118770380 14:68938955-68938977 CCCATTTCAAAAGACATAGCACC 0: 1
1: 0
2: 4
3: 10
4: 146
Right 1118770389 14:68938990-68939012 GGTCACCAGGGCCAAGAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 235
1118770381_1118770389 11 Left 1118770381 14:68938956-68938978 CCATTTCAAAAGACATAGCACCA 0: 1
1: 0
2: 1
3: 15
4: 216
Right 1118770389 14:68938990-68939012 GGTCACCAGGGCCAAGAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 235
1118770378_1118770389 23 Left 1118770378 14:68938944-68938966 CCCATCTACAGCCCATTTCAAAA 0: 1
1: 0
2: 1
3: 17
4: 201
Right 1118770389 14:68938990-68939012 GGTCACCAGGGCCAAGAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 235
1118770384_1118770389 -9 Left 1118770384 14:68938976-68938998 CCAGACACCCAGAGGGTCACCAG 0: 1
1: 0
2: 0
3: 38
4: 219
Right 1118770389 14:68938990-68939012 GGTCACCAGGGCCAAGAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 235
1118770379_1118770389 22 Left 1118770379 14:68938945-68938967 CCATCTACAGCCCATTTCAAAAG 0: 1
1: 0
2: 2
3: 16
4: 167
Right 1118770389 14:68938990-68939012 GGTCACCAGGGCCAAGAAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118770389 Original CRISPR GGTCACCAGGGCCAAGAAGC AGG Intronic
900183151 1:1321210-1321232 AGACACATGGGCCAAGAAGCAGG + Intronic
900793015 1:4691943-4691965 GGTCTCCAGGGCTCAGAAGAGGG + Intronic
903788375 1:25875866-25875888 GGTCAGCCGGGCCCAGAAGCCGG - Intergenic
903832418 1:26183138-26183160 GGGCAACAGGGCCAATAGGCAGG - Intronic
905173587 1:36123294-36123316 GGCCAGCAGGGCAAGGAAGCTGG + Intronic
905175752 1:36134413-36134435 GGCATCCAAGGCCAAGAAGCGGG - Intergenic
906038491 1:42767536-42767558 GCTCACCAGGGCCAGGCCGCCGG - Exonic
906186481 1:43866004-43866026 GGCAACCAGAGCCAAGCAGCCGG + Intronic
906364020 1:45190236-45190258 GATCACCTGGGCCAGGAAGCTGG + Intronic
906475546 1:46167121-46167143 GGTCGCCAGGGCCCAGAATTGGG - Intronic
907294072 1:53438658-53438680 GTGCACCAAGGCCAAGCAGCTGG - Intergenic
909143367 1:71895460-71895482 GGTAACCAGGGGCAAGAGGAAGG - Intronic
910946812 1:92601683-92601705 GGTTACCAGGGGCTAGATGCGGG + Intronic
912498486 1:110106581-110106603 GGCCTGCAGGGCCAAGGAGCTGG - Intergenic
915763027 1:158334735-158334757 GATTACCAGGGGCAGGAAGCAGG + Intergenic
916604320 1:166326085-166326107 GGTGAGCAGGGCCCAGATGCTGG - Intergenic
916718818 1:167467471-167467493 AGTCACCGAGGCAAAGAAGCAGG - Intronic
917299956 1:173563015-173563037 GGACAGCAGGGACAAGAAGCAGG + Intronic
917396916 1:174603497-174603519 GGGAACCAGGGCCAGGAATCAGG + Intronic
920338702 1:205262057-205262079 GGTAAACAGAGCCAAGGAGCTGG - Intronic
920652811 1:207851417-207851439 GGTCTCCAGGGCTCTGAAGCAGG + Intergenic
922856671 1:228780926-228780948 GGACACCAAGGCCCAGAATCAGG - Intergenic
923271547 1:232359400-232359422 AGTGACCAGTGCCAAGAAGGAGG - Intergenic
923540711 1:234886199-234886221 GGTCCCCTGAGCCAGGAAGCTGG - Intergenic
1063074409 10:2700430-2700452 GGCCACATGGACCAAGAAGCAGG - Intergenic
1063252880 10:4293449-4293471 GGTAACCAGGGAAAAGAAGCAGG - Intergenic
1064637808 10:17386964-17386986 CATCCCCAGGGCCTAGAAGCTGG - Intronic
1065788551 10:29239003-29239025 GGTCACCAGGGCCAGAGAGACGG - Intergenic
1066296544 10:34058878-34058900 GGTTCCCAGGGCCAATTAGCTGG + Intergenic
1069598363 10:69687204-69687226 GGCCACCAGGACCACCAAGCTGG - Intronic
1075444814 10:122505889-122505911 GGTCACCCAGGCCAAGGAGCTGG - Intronic
1075796576 10:125124174-125124196 GGTCCCCAGGCTCGAGAAGCAGG - Intronic
1075922037 10:126221707-126221729 TGTCACAGGGGGCAAGAAGCAGG + Intronic
1077413708 11:2414901-2414923 GCTCACCATGGCCCAGAAGTAGG + Exonic
1079246706 11:18757529-18757551 GGCCACCAGGTCCAGGAATCAGG - Intronic
1080196177 11:29612086-29612108 GGTCAGCTGGGCAAAGTAGCAGG + Intergenic
1081464262 11:43301782-43301804 TGTCACCAGGGCCACACAGCTGG - Intergenic
1081873506 11:46393729-46393751 GGTCACCAGGGCAAAGATAGGGG - Intergenic
1083170564 11:60921942-60921964 CCTCATCAGGGCCACGAAGCCGG - Exonic
1085158450 11:74318687-74318709 TGTATCCAGGGCCAAGTAGCAGG + Intergenic
1085393301 11:76193501-76193523 GGTCAGCAGGGCCAGGAGGCAGG + Intronic
1085614220 11:77982870-77982892 GGTCACCAGGCACAATAAGGAGG + Intronic
1090390524 11:126384527-126384549 GGTCACCATGGACAGGAGGCTGG + Intronic
1090496614 11:127219001-127219023 GGAAAGGAGGGCCAAGAAGCTGG + Intergenic
1091850703 12:3694491-3694513 GGTGGCCAGGCCCAGGAAGCTGG + Intronic
1093416366 12:18925347-18925369 CATCACCAGGAGCAAGAAGCTGG + Intergenic
1093809539 12:23474765-23474787 TGTCATCAGGGCCAGGATGCTGG - Intergenic
1096215873 12:49797109-49797131 GGTTGCCAGGGCCTAGCAGCAGG + Exonic
1097174330 12:57134085-57134107 GGTCCCCAGGGCCACCAAGCTGG - Intronic
1097872325 12:64611215-64611237 GGTCGCCCGGGCCAGGAAGAGGG - Intronic
1102502127 12:113359850-113359872 TGTCAGCAGGGCCCAGACGCTGG + Intronic
1102507434 12:113392555-113392577 GGTCAACAGGGCCACCAACCAGG - Exonic
1103036955 12:117664452-117664474 TGCCACCAGGGCCCAAAAGCAGG + Intronic
1104058773 12:125250443-125250465 GGTCAGCAGGGCCAGGACGAGGG - Intronic
1104062795 12:125282281-125282303 GGGCACCAGGGCACAGAGGCAGG - Intronic
1106250919 13:27980785-27980807 GGGCACCAAGGGCAAGAAGGGGG - Intronic
1106709232 13:32313051-32313073 GGTTACCAGGGACAGGAAGTTGG + Intronic
1107234907 13:38156430-38156452 GGTCACCAAGGAAAAGCAGCAGG - Intergenic
1107875943 13:44790303-44790325 GGTCTCCAGCTCCAGGAAGCAGG - Intergenic
1109076254 13:57839773-57839795 AGTAACCAGGGCCAAGAAGAGGG - Intergenic
1111905619 13:94252366-94252388 CATCACCAGAGCCAAGAAGTTGG - Intronic
1113441911 13:110335651-110335673 GGACATCAGGGACAAGAAACTGG - Intronic
1113518696 13:110922576-110922598 GGGCACCAGGTCCAAGGAGCAGG - Intergenic
1113748572 13:112763237-112763259 GGTCCCCTTGGCCAAGATGCAGG - Intronic
1113912565 13:113850439-113850461 GGGCAACAGGGGGAAGAAGCTGG + Intronic
1114333790 14:21665708-21665730 GGTGACCACGGCCAAGAAACAGG - Exonic
1115054384 14:29104878-29104900 GGACATCAGTGCGAAGAAGCAGG - Intergenic
1116190775 14:41662628-41662650 GGTCAGCAGGGCCACCAATCAGG + Intronic
1117564464 14:56978968-56978990 AGACACCATGGCCAAGAAGCTGG + Intergenic
1118287923 14:64493938-64493960 GATCAGCGGGGACAAGAAGCAGG + Intronic
1118770389 14:68938990-68939012 GGTCACCAGGGCCAAGAAGCAGG + Intronic
1121221352 14:92288089-92288111 AGTTACCTGGGCCAAGTAGCTGG + Intergenic
1122297326 14:100712833-100712855 GGTCCCCAGGGCCACCCAGCAGG + Intergenic
1126463915 15:48943261-48943283 GGTTACAAGGGCCAGGGAGCGGG - Intronic
1126466005 15:48962505-48962527 GCTCCCCAGGGCCAGGAAGCGGG + Exonic
1128423923 15:67521021-67521043 GGTCACCTGCGTCAAGGAGCTGG - Intergenic
1128551504 15:68600789-68600811 GGGCTCAAGGGCCAGGAAGCTGG - Intronic
1128558085 15:68645293-68645315 GGTGACGATGGCCAGGAAGCGGG - Exonic
1128582579 15:68819688-68819710 GGGCACCAGGGCCCAAAGGCTGG + Intronic
1128728051 15:70002347-70002369 GATCTCCAGGGGGAAGAAGCAGG - Intergenic
1129667763 15:77588962-77588984 GTGCACCAAGGCCAAGAGGCTGG + Intergenic
1129692382 15:77721188-77721210 TCTCACGAGGGCCATGAAGCGGG - Intronic
1129954772 15:79625899-79625921 GTTAACCAGAGCCAAGGAGCAGG + Intergenic
1130554518 15:84913419-84913441 CATCACCTGGGCCAAGAAACAGG - Intronic
1130943685 15:88533945-88533967 GGTCACCAGGGACTAGCAGGAGG + Intronic
1132035571 15:98481029-98481051 GGTCCCCAGGGCCATGGACCAGG + Intronic
1132751203 16:1458529-1458551 GGTCCCCGTGGCCAAGGAGCGGG - Intronic
1132830294 16:1924702-1924724 GGTCACCAGGAACAAGATCCAGG - Intergenic
1132892768 16:2212453-2212475 GGTCAGCAGAGCCAAGGAGCAGG + Exonic
1135292243 16:21249959-21249981 GGTCACCAGGCTGAAGGAGCAGG + Exonic
1136003195 16:27311818-27311840 GGTCCTCAGGGCTAGGAAGCAGG + Intergenic
1137238610 16:46635877-46635899 GGTTACCAGGGTCTAGAAGTAGG - Intergenic
1141427020 16:83951266-83951288 GGCCACCAGGGCCAGGACGAGGG + Exonic
1141595362 16:85093876-85093898 GGCCACCAGGTTCAAGAAGGCGG - Exonic
1141615628 16:85207955-85207977 GGTCACCCGGGCCTGGATGCAGG - Intergenic
1142403136 16:89871498-89871520 GGTGGCCAGGACCACGAAGCTGG - Intergenic
1142592043 17:1010507-1010529 GGACATCAGGGGCAAGAGGCAGG + Intronic
1142625118 17:1186973-1186995 GGTCACGACGGCCCCGAAGCTGG + Intronic
1143203612 17:5128707-5128729 GGTCAGCAGGGCCCAGAGTCAGG - Intronic
1143778939 17:9219364-9219386 GGCCACCAGTGCCATGGAGCAGG + Intronic
1143854655 17:9839698-9839720 GGTCAGCAGGGCCAGGCAGCAGG - Intronic
1143906647 17:10214569-10214591 GGTCACCTGGGGGAAGAGGCTGG + Intergenic
1145241698 17:21243989-21244011 AGGACCCAGGGCCAAGAAGCAGG + Intronic
1145261585 17:21357831-21357853 GGTCACCAGAGCCCAGCTGCAGG + Intergenic
1145732298 17:27200070-27200092 GGCCACCAGCCCCAAGAAACAGG + Intergenic
1145817214 17:27804268-27804290 GGTGGGCAGGGCCAAGAAGAAGG - Exonic
1146799187 17:35805124-35805146 GGTTACTAGGGCCAAGGAGCCGG + Intronic
1147261603 17:39212327-39212349 CGTCAGCAGTGGCAAGAAGCGGG - Exonic
1147362990 17:39943226-39943248 GGTCTCCAGAGCCCAGCAGCAGG + Intronic
1147793152 17:43025539-43025561 GGTAACCAGGGACAAGAGACAGG + Intronic
1150074685 17:62182444-62182466 GGTCGCATGGCCCAAGAAGCAGG + Intergenic
1151495408 17:74455246-74455268 GGTCATCAGAGCCAGGAAGGTGG + Intergenic
1151911097 17:77083842-77083864 AGGAACCAGGGCCAGGAAGCAGG - Intergenic
1152009543 17:77703295-77703317 GGTCACCAGGGCCTGGGAGAGGG - Intergenic
1152605128 17:81285744-81285766 GGAAACCAGGGGCAGGAAGCTGG - Intronic
1156191808 18:34728932-34728954 GGTCACCATGGCCAAGTGGGTGG + Intronic
1156241525 18:35259276-35259298 GGTCACCTGAGCCCAGAAGGTGG - Intronic
1157428360 18:47602812-47602834 GGTCTCAAGGGCCCAGCAGCGGG + Intergenic
1158679524 18:59554568-59554590 AGTCACTAGTCCCAAGAAGCAGG + Intronic
1159963764 18:74576665-74576687 GGTCACCAGGATCACGCAGCTGG - Intronic
1160856822 19:1221520-1221542 GGTGAACAGGGCCCAGAAGCAGG - Intronic
1160865359 19:1253714-1253736 AGTCACCAGGGCCAGCAAGTGGG - Intronic
1160897214 19:1408364-1408386 GGTCCCCCTGGCCAGGAAGCCGG - Intronic
1161069782 19:2254250-2254272 GGACACCAGGCCCAAGAAGATGG - Exonic
1161414461 19:4137823-4137845 GATCACCAGAGCCAAGGAGTTGG - Intergenic
1161617193 19:5277967-5277989 GGTCCCCAGCGTCAAGGAGCTGG + Intronic
1161747994 19:6073363-6073385 GGTCCCCAGCGTCAAGGAGCTGG + Intronic
1161795106 19:6381821-6381843 AGTCCCCAAGGCCAAGAAGAAGG - Exonic
1161887253 19:7006313-7006335 AGTCAGCAGGGCCAAGAGGCCGG - Intergenic
1161887949 19:7011589-7011611 AGTCAGCAGAGCCAAGAGGCCGG + Intergenic
1162418502 19:10552562-10552584 GGACAGCAGGGCCAAGAGACAGG - Intronic
1162762628 19:12897509-12897531 GGTCCCCAGGGCCACCAGGCAGG - Intronic
1163356881 19:16818818-16818840 TGTCCCCAGGGCCAGGAAGAGGG - Intergenic
1163738231 19:18994912-18994934 AATGACCAGGGCCAACAAGCTGG + Intronic
1163775566 19:19215329-19215351 GGTCACCAGGGCTCAGGAGGTGG - Intronic
1164885372 19:31774064-31774086 GGTTACCAGGGGCAGGGAGCTGG + Intergenic
1165087285 19:33359617-33359639 GGTTACCAGGGCCTGGGAGCAGG - Intergenic
1166076420 19:40416167-40416189 GGTCAGCAGGGCCATGAGGAGGG + Intergenic
1166338861 19:42125439-42125461 TGTCCCCAGGGCCAGGAAACAGG - Intronic
925187562 2:1859772-1859794 GGGCACCAGGGCCAGGGGGCAGG - Intronic
928223501 2:29425421-29425443 GGTAAGCATGGCCAAGAAGTTGG + Intronic
929792391 2:45033144-45033166 TGGCAGCAGGGCCAAGAAGGAGG - Intergenic
932809990 2:74817048-74817070 GGTCAGCAGGGCCAGGCAGGTGG - Intergenic
933902745 2:86861491-86861513 GGTCACCAGGGGAAGGAAACAGG - Intronic
935777802 2:106487777-106487799 GGTCACCAGGGGAAGGAAACAGG + Intergenic
937359285 2:121217804-121217826 GGTCCCCAGGAACAGGAAGCAGG + Exonic
937522072 2:122723845-122723867 TGGCAGCAGGGCTAAGAAGCTGG + Intergenic
939984242 2:148814339-148814361 GATCACCTGGGCCAGGAAACTGG + Intergenic
940004950 2:149001854-149001876 GGTCACCAGGTCCTTGAAGATGG - Intronic
942911787 2:181252794-181252816 TGTTACCAGAGCCCAGAAGCTGG + Intergenic
943890286 2:193277396-193277418 GGTCAGGAAAGCCAAGAAGCAGG - Intergenic
946428327 2:219611737-219611759 GGTCACCATGGCCAGGAGGGTGG - Exonic
948079176 2:235191558-235191580 GGTCCCCAGGGCCGAGTGGCGGG - Intergenic
948238461 2:236408491-236408513 AGGCACCGTGGCCAAGAAGCTGG - Intronic
948253994 2:236552787-236552809 GGACCCCAGGGCCGAGAAGTAGG + Intergenic
948825850 2:240573207-240573229 GGCCACCAGGGCCACGAGGTAGG - Exonic
948931139 2:241133206-241133228 GGTGTCCTGGGCCAAGGAGCAGG - Intronic
1168819834 20:765418-765440 GTCCACCAGGGCCAGGAAGAAGG + Exonic
1173837934 20:46138092-46138114 GGGGAACAGGGGCAAGAAGCAGG - Intergenic
1173857360 20:46258867-46258889 GGTCCCAGGGGCCAAGAAGAGGG + Intronic
1176310385 21:5146036-5146058 GGTCCCCAGGGCCGAGGAGTGGG - Intronic
1179846670 21:44115999-44116021 GGTCCCCAGGGCCGAGGAGTGGG + Intronic
1179909209 21:44439020-44439042 GGTCAACAGGGCACCGAAGCGGG - Intronic
1180599953 22:17009085-17009107 TGTCACGGGGACCAAGAAGCCGG + Intergenic
1182103884 22:27675334-27675356 GATCACCAGGCCCAGGAAGGAGG - Intergenic
1182167510 22:28191131-28191153 GTTAACCATGGCCTAGAAGCAGG - Intronic
1183616710 22:38950223-38950245 GGTGACCAGGGCCGGGAGGCTGG - Intergenic
1183985775 22:41569436-41569458 GGTCACCAGGGCTGGGAAGGAGG - Intronic
1184346551 22:43917182-43917204 GGTCACCAGGGCCTGAAGGCAGG + Intergenic
1184564722 22:45285143-45285165 GGTCCCCAGCGCCAGGAATCAGG - Intronic
1184723554 22:46329887-46329909 GGCCACCACGTCTAAGAAGCTGG - Intronic
1184894768 22:47400479-47400501 GCTCACCAGGTCCCAGAATCAGG + Intergenic
951040922 3:17988140-17988162 GGTCTGCAGGGCCAAGAGGGTGG + Intronic
953387575 3:42515217-42515239 GGGCACCAGGGCCAAGAAGAGGG - Intronic
953705099 3:45225329-45225351 GATGACCAGGGTCATGAAGCAGG + Exonic
953902658 3:46851994-46852016 GGTCACCAGGTTCAAGATCCGGG + Intergenic
954811576 3:53251544-53251566 CCTCACCAGGCCCAGGAAGCAGG - Intronic
956502386 3:69900453-69900475 GTTAAACAGGGCCAAGAAGGAGG - Intronic
960767271 3:121147912-121147934 GGTCAGCAGGCTCAAGAACCAGG - Intronic
961556178 3:127697973-127697995 GGTCAGCGGGGCAAAGCAGCAGG - Intronic
962253496 3:133854136-133854158 GGTTCCTAGGGCAAAGAAGCTGG - Intronic
964073991 3:152671160-152671182 TGTCTCCAGGGCCAAGAATGTGG - Intergenic
964446313 3:156762665-156762687 TTTCACCAGGGATAAGAAGCCGG - Intergenic
965359999 3:167727093-167727115 GGAAACCATGGCCCAGAAGCAGG + Intronic
965512648 3:169585550-169585572 TAACACCAGGGCCAAGAACCAGG + Intronic
966807224 3:183817205-183817227 TGTCACCAGGGCCAAAGTGCTGG - Exonic
966865938 3:184259349-184259371 GGTTCCCAGGGGCAAGACGCAGG + Exonic
968641906 4:1719095-1719117 GGCCAGCAGGGCCCTGAAGCTGG - Intronic
969478416 4:7434171-7434193 GGTCAGCAGGGACAAAAAACTGG + Exonic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
969634259 4:8357249-8357271 GGACACCAGGGCCAGGAGACGGG + Intergenic
973181374 4:47272901-47272923 AATAAACAGGGCCAAGAAGCAGG + Intronic
973530737 4:51834735-51834757 GGGCACCCGGGACAGGAAGCTGG + Intergenic
973716484 4:53682023-53682045 GGTTGCCAGGGCCAGGAAGGAGG + Intronic
982744266 4:159090306-159090328 GGTCACCTGAGCCCAGAAGGTGG - Intergenic
983153918 4:164320712-164320734 GGTCACCAGTTCCAAGCACCTGG - Intronic
983884231 4:172962650-172962672 GGAGATCTGGGCCAAGAAGCAGG + Intronic
986729668 5:10625996-10626018 AGTGACCCAGGCCAAGAAGCTGG + Intronic
988658687 5:33240300-33240322 GGGCACCAGGGGTAAGAAGCAGG + Intergenic
989391033 5:40900973-40900995 GGTCACCAGGACCAAAAGGATGG - Intergenic
990960750 5:61391289-61391311 AGGCACCATGGCCAAGAAGCTGG - Intronic
990967472 5:61464696-61464718 GTTTACCAGGGCCAAGAGGAAGG - Intronic
992268845 5:75045293-75045315 GGTTGGCAGGGCCCAGAAGCAGG - Intergenic
997105121 5:131009257-131009279 GGTCACTAGGGCTAAAAGGCTGG - Intergenic
998731699 5:145084652-145084674 AGTATCCAGGGCCAAGAAGAAGG + Intergenic
999327049 5:150650053-150650075 GGGCACCAGGTCCAAGGAGCTGG - Exonic
1002345822 5:178546946-178546968 GGGCTCCAGGGCAGAGAAGCCGG + Intronic
1003159588 6:3623859-3623881 GTTCACAAGGGCCAAGAGGTGGG - Intergenic
1005642296 6:27807831-27807853 GGTGACCAAGGCCCAGAAGAAGG - Exonic
1007677502 6:43609009-43609031 AGTCTCCAGGGCAAAGAAACGGG - Intronic
1008739698 6:54591156-54591178 GGTCTTCAGGGCCAAGTAGGAGG - Intergenic
1011975812 6:93296676-93296698 GGTTACCAGGGATAAGAAGGGGG + Intronic
1016737062 6:147490545-147490567 GGTCACCAAGGCCAAGGGGAGGG + Intergenic
1018993837 6:168695267-168695289 GGTCACCTGGGGCAAGATGTGGG + Intergenic
1019523933 7:1472352-1472374 GCTGACCAGGGGCAAGGAGCCGG + Exonic
1019866214 7:3712843-3712865 GGGCACCTGGGCCAAGTCGCAGG - Intronic
1022171920 7:27839256-27839278 GCTCTCCAGGGCCAAGCACCAGG - Intronic
1027440721 7:78216615-78216637 GGTCAGCAGGGCAGAGAAGCAGG - Intronic
1028391314 7:90320916-90320938 GGTCACCTGGGCGCAGAAGAGGG + Intergenic
1029365886 7:100116015-100116037 GGTGACCTGGGCCAAGCAGTGGG - Intronic
1029458276 7:100681897-100681919 GGGCAGCAAGGCCAAGAGGCGGG - Exonic
1029603879 7:101586774-101586796 GGCCACCAGGACCCAGAAGGCGG - Intergenic
1037198700 8:16223657-16223679 GCTCTCCAAAGCCAAGAAGCTGG + Intronic
1037884264 8:22588163-22588185 GGTCAGAAGGGCAAAGTAGCTGG - Intronic
1037907516 8:22724232-22724254 TGCCACCAGGGCCAGGGAGCAGG - Intronic
1038840286 8:31178079-31178101 GATCACCAGGTGCAAGTAGCTGG + Intergenic
1039759459 8:40558764-40558786 GGTCCCCTCGGCCAAGAAGCGGG - Intronic
1041514622 8:58687136-58687158 TGTCACCATGGCCCTGAAGCTGG - Intergenic
1044605798 8:94046141-94046163 GGTGACAAAGGCCAAGAAGTAGG + Intergenic
1045815549 8:106272008-106272030 GGCCAGCGGGGCCGAGAAGCAGG + Intronic
1047110873 8:121787692-121787714 TATCTCCAGGGCCAAGCAGCAGG + Intergenic
1048203893 8:132400517-132400539 CATCACCAGGGCCTAGGAGCTGG - Intronic
1048956142 8:139537810-139537832 GGTCAGAAAGGCCAAAAAGCTGG - Intergenic
1049328017 8:142034145-142034167 GGTCATCAGGGTCAAGACTCTGG + Intergenic
1049498112 8:142946194-142946216 GGGCACCAGGCCCAGGCAGCCGG - Intergenic
1051010957 9:12413505-12413527 GGACTCCAGGCCCAAGTAGCTGG - Intergenic
1051774072 9:20615120-20615142 GGTCACCTGGGCCCAGGAGTTGG + Intronic
1056270027 9:84938374-84938396 AGTTACCTGGGCCAAGAGGCTGG - Intronic
1056805718 9:89727109-89727131 GGTCACCAGGGAGAAGAGGTGGG - Intergenic
1057625762 9:96675005-96675027 GATCACCAGGGTCAAGGAACAGG - Intergenic
1059402398 9:114078413-114078435 GGTCAGCAGTACCAAGAGGCCGG + Exonic
1061208317 9:129176946-129176968 GCTCACCAGCCCCGAGAAGCCGG + Exonic
1061412175 9:130427684-130427706 GGTCCCCAGGGCCAGGACCCTGG + Intronic
1062023235 9:134328979-134329001 GGGCAGCAGGGCCAGGAAGCTGG - Intronic
1062724279 9:138062592-138062614 TGCCACCAGGGCCAGGAAGTAGG + Intronic
1186826504 X:13345668-13345690 GGTTACCAGGGACTGGAAGCGGG + Intergenic
1190290529 X:48989296-48989318 GGTCACTAGGGCCTAGGACCAGG - Intronic
1190949722 X:55131610-55131632 TGACAGCAGGGCCACGAAGCAGG - Intronic
1192640336 X:72856503-72856525 AGTCACAAGGGCCAAAAATCAGG + Intergenic
1192641375 X:72864273-72864295 AGTCACAAGGGCCAAAAATCAGG - Intergenic
1192680925 X:73253355-73253377 GGTCCCCTTGGCCAAGAAGAGGG + Intergenic
1194044717 X:88987751-88987773 GGTCACCGAGGCCCAGATGCTGG - Intergenic
1195138967 X:101939588-101939610 GGTCATATGGCCCAAGAAGCAGG - Intergenic
1195177621 X:102326369-102326391 CGTCAGGAGGGCCAAGAAGATGG + Intronic
1195181243 X:102360724-102360746 CGTCAGGAGGGCCAAGAAGATGG - Intronic
1196847613 X:119909037-119909059 GGATACCAGGGCCTAGAAGTAGG - Intronic
1198449558 X:136753507-136753529 GGTCCCCAAGGCCCAGAATCAGG + Intronic
1199015000 X:142804657-142804679 AGTGACCAGGGCCAAGAACTTGG + Intergenic
1199846507 X:151695590-151695612 GGTATCCAGGGCCAACGAGCTGG + Intronic
1200150051 X:153946925-153946947 GAGCACCAGGCCCCAGAAGCAGG + Intergenic
1201337035 Y:12892568-12892590 GGTCGCCAGGACCCAGAGGCTGG + Intergenic