ID: 1118775075

View in Genome Browser
Species Human (GRCh38)
Location 14:68968852-68968874
Sequence GTACCAGGGCTGGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118775069_1118775075 -7 Left 1118775069 14:68968836-68968858 CCTGGCCCAAAGCACAGTACCAG 0: 1
1: 0
2: 0
3: 16
4: 269
Right 1118775075 14:68968852-68968874 GTACCAGGGCTGGCTGCTGCTGG 0: 1
1: 0
2: 1
3: 33
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118775075 Original CRISPR GTACCAGGGCTGGCTGCTGC TGG Intronic
900396072 1:2453769-2453791 GACCCAGGGCTGGCATCTGCTGG - Intronic
900400020 1:2469220-2469242 GGACAGGGGCTGGCTGCTGCCGG + Intronic
900428959 1:2593056-2593078 GTACTGGGGCTGGCTGCAGGAGG - Intronic
900458617 1:2789618-2789640 GAACCAGCGGGGGCTGCTGCTGG - Exonic
900744630 1:4352737-4352759 GCAGCAGGGCTGGCAGCAGCAGG - Intergenic
901069757 1:6511293-6511315 GTGCCAGCCCTGGGTGCTGCTGG + Intronic
901393932 1:8966809-8966831 GGAGCAGGTGTGGCTGCTGCAGG + Intronic
901622812 1:10602623-10602645 AAACCAGGGCTGTCTGCTGCTGG + Intronic
901833706 1:11909666-11909688 GGACCAGAGCTGGCTTCTGGAGG - Intergenic
903183035 1:21614686-21614708 GTATCAGGGGTGGCTGCGGCAGG + Intronic
903845234 1:26275981-26276003 GTTCCAGGGCTGGATCCTCCAGG + Intronic
903938638 1:26913673-26913695 GGACCAGCGGCGGCTGCTGCAGG - Exonic
904852356 1:33468548-33468570 AGACCAGGGCTGGATGGTGCAGG + Intergenic
905626002 1:39491191-39491213 GAACCCGGGCCGGCTGCTGCGGG + Intergenic
905629718 1:39511801-39511823 AGACGAGGGCTGGCTGGTGCTGG + Exonic
905668041 1:39774389-39774411 AGACGAGGGCTGGCTGGTGCTGG - Exonic
905923621 1:41734728-41734750 GCCCCGGGGCTGGCTGCTGTGGG - Intronic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
906779505 1:48559976-48559998 ATAGAAGGGCTGGATGCTGCAGG - Intronic
907275844 1:53316229-53316251 AAGCCAGGTCTGGCTGCTGCTGG + Intronic
907417570 1:54324986-54325008 TCCCCAGTGCTGGCTGCTGCAGG - Intronic
907425053 1:54374281-54374303 GAACCAGGGCTGCAGGCTGCAGG - Intronic
908794278 1:67815983-67816005 ATGCCAGGGCTGGGTGCGGCCGG + Intronic
910961659 1:92770121-92770143 GTAGCAGGGCTGGTTTCTTCTGG - Intronic
914899892 1:151706299-151706321 CGACCAGGGCTGGAGGCTGCGGG + Exonic
915592776 1:156880117-156880139 GTACCAGGGCTGCTTGCCGTAGG - Exonic
917930233 1:179817781-179817803 GTGCTAGGGAAGGCTGCTGCAGG - Intergenic
918078507 1:181188702-181188724 GTACCATGGGTAGCAGCTGCGGG - Intergenic
921839240 1:219810877-219810899 TTACCAGGGCTAGCTCTTGCAGG - Intronic
922531835 1:226350724-226350746 GCACCAGGGGTGGCTTCTGCTGG - Intergenic
923505207 1:234599916-234599938 GTAAAAGGTCTGGCTCCTGCTGG - Intergenic
924728252 1:246689819-246689841 GCACCAGGGCTGGCGGGCGCCGG - Intergenic
924798455 1:247309852-247309874 GGACCAGCCCTGGTTGCTGCAGG - Intronic
1065218384 10:23472379-23472401 TTCCCTGAGCTGGCTGCTGCCGG - Intergenic
1067686461 10:48468881-48468903 GTGCCAGGGCAGGTTGGTGCAGG + Intronic
1068498920 10:57818802-57818824 GTGCCAGGGCATGCAGCTGCAGG + Intergenic
1069486623 10:68827806-68827828 CTTCCAGGGCTGGCTGCGGCGGG + Exonic
1069486710 10:68828142-68828164 CTTCCAGGGCTGGCTGCGGCGGG + Intronic
1069688835 10:70336340-70336362 TTTCCTGGGCAGGCTGCTGCGGG - Intronic
1070706911 10:78646440-78646462 TTAGCAGGGCTGGCTCCTTCAGG + Intergenic
1074248886 10:111723945-111723967 TTTCCTGGGCTGGTTGCTGCAGG - Intergenic
1075856222 10:125632288-125632310 GAACCAGGGTTGGTTTCTGCTGG - Intronic
1075977178 10:126706170-126706192 GCATCAGGGCTGGCAGCTCCTGG - Intergenic
1076019118 10:127055965-127055987 GGACCATGCCTGGCTCCTGCTGG - Intronic
1076030332 10:127152445-127152467 GTGCCATGCCAGGCTGCTGCAGG + Intronic
1076431911 10:130410048-130410070 GTGCCATGGCTGGCTGTTGCTGG + Intergenic
1076863758 10:133157164-133157186 GGACCACGACTGGCTTCTGCGGG - Intergenic
1077109404 11:855470-855492 GTGCCAATGCTGGCTCCTGCAGG - Intronic
1077183919 11:1228185-1228207 GGCCCAGGGCTGCCGGCTGCGGG - Intronic
1077383978 11:2260401-2260423 CTGCCAGGGGTGGCTGCTGTGGG + Intergenic
1077497858 11:2895227-2895249 GCTCCAGGGCTGGCTGCCCCAGG + Intronic
1078444085 11:11391111-11391133 GTCCCAGGGCAGTTTGCTGCAGG - Intronic
1080843125 11:36003206-36003228 TTACCTGGCCTGGCTGGTGCAGG + Intronic
1081716348 11:45253011-45253033 GTGCCAAGGCTTGCTGCTGGGGG + Intronic
1082081130 11:48013384-48013406 GTACCGGCACTGGCTCCTGCAGG - Intronic
1083536624 11:63473983-63474005 ATACCAGGGCTGGGCGCTGTGGG - Intronic
1083616438 11:64028752-64028774 CTGCCAGGCCTGGCTGCTGGGGG + Intronic
1083772930 11:64878472-64878494 GACACGGGGCTGGCTGCTGCGGG + Exonic
1084019653 11:66409970-66409992 GTTCCAGAGCTGGTGGCTGCAGG - Intergenic
1084164885 11:67370986-67371008 GGACCAGCGCTGGCTGCGGTTGG + Intronic
1084204815 11:67585154-67585176 CCACCAGGGCTGCCTCCTGCTGG - Exonic
1084279923 11:68081613-68081635 GTACTAGTGCTGGAGGCTGCTGG - Intronic
1085100721 11:73797610-73797632 GCAGCAGGGCGGGCAGCTGCAGG - Intronic
1085127734 11:74013292-74013314 GCACCAGGTCTGGCTCCTTCAGG - Exonic
1085350124 11:75792891-75792913 GAACCAGGGCTGTCTGCTTTGGG + Intronic
1087396268 11:97603558-97603580 GCAGAAGGGCTGGCTGCAGCTGG - Intergenic
1089378306 11:118010777-118010799 GTCCAAGGGCTGGCTGGTCCGGG - Intergenic
1089672142 11:120063955-120063977 GAAACAGGGCTGGAGGCTGCAGG + Intergenic
1089704284 11:120266254-120266276 CTGACAGGGCTGGCTGATGCGGG - Intronic
1091390966 12:125822-125844 TCGCCAGGGCAGGCTGCTGCCGG - Exonic
1091545702 12:1500208-1500230 GGCCCGGGCCTGGCTGCTGCGGG - Intergenic
1091691229 12:2598817-2598839 GAACCAGGGATGGCAGCTGGGGG - Intronic
1094488724 12:30945357-30945379 GTACCAGGCCTGGCACCTGCTGG + Intronic
1095683700 12:45008013-45008035 TTGCCAGGGCTGGCTTCTTCTGG - Intergenic
1096148308 12:49294134-49294156 GTACCAGGGATGGGTGGGGCTGG - Exonic
1096227410 12:49875314-49875336 GTCCCTGGGCTGGGTGATGCGGG - Intronic
1097181469 12:57174385-57174407 GCACCAGGGTTGACTGCTGATGG + Intronic
1098530353 12:71534705-71534727 GTACAAGGGCTGGAGGCTGGAGG - Intronic
1101585629 12:106083097-106083119 GTATTATTGCTGGCTGCTGCTGG - Intronic
1102101614 12:110282151-110282173 CCACCGGGGCCGGCTGCTGCTGG - Intronic
1102498754 12:113337019-113337041 GTGCTAGGGCTGGATGCTGAAGG - Intronic
1103718424 12:122960049-122960071 GTACCGCAGCTGCCTGCTGCTGG - Exonic
1103838736 12:123845618-123845640 GTACCAGGGCATGGTGGTGCTGG + Exonic
1103954838 12:124570149-124570171 GTCCCAGGCCAGGCTGCAGCTGG + Intergenic
1104576012 12:129966436-129966458 GTAGCCAGCCTGGCTGCTGCAGG - Intergenic
1104886004 12:132108664-132108686 GTACCTGGAGCGGCTGCTGCTGG - Exonic
1105018637 12:132801811-132801833 GTGCCAGGGCGAGCTGCTGCTGG + Exonic
1105209609 13:18250095-18250117 GTCCCAGGGATGGATGGTGCCGG - Intergenic
1105914738 13:24902860-24902882 TTCCCATGGCTGCCTGCTGCGGG - Intronic
1106004154 13:25753018-25753040 CCACCAGCGCTGGCTGCTGTGGG + Intronic
1112563266 13:100532309-100532331 GTACCAGCGCACGGTGCTGCGGG - Exonic
1113834546 13:113320079-113320101 TTTGCAGGGCTGACTGCTGCAGG + Intronic
1113926467 13:113944375-113944397 GTGCCAGGGCAGGTTGCTGCTGG + Intergenic
1114763531 14:25344776-25344798 ATACCTGGGCTTGCTGCAGCTGG + Intergenic
1117546347 14:56797555-56797577 GCGCCAGGGCTGGCCGCTTCCGG + Intergenic
1118030342 14:61812607-61812629 GCCGCAGGGCTGGCGGCTGCTGG + Intergenic
1118775075 14:68968852-68968874 GTACCAGGGCTGGCTGCTGCTGG + Intronic
1121118155 14:91357960-91357982 GGACCAGGGGTGGCCTCTGCAGG + Intronic
1121180683 14:91926285-91926307 GGCCCAGGGCTGGCTGCTGGAGG + Intronic
1121344983 14:93129027-93129049 CAGGCAGGGCTGGCTGCTGCTGG - Intergenic
1122275413 14:100588246-100588268 GTTCCCACGCTGGCTGCTGCTGG - Intergenic
1122329825 14:100904669-100904691 GTGCCGGGGCTGGGGGCTGCTGG + Intergenic
1122789780 14:104179340-104179362 GACCCAGGGCCGGCTGATGCTGG + Exonic
1123057120 14:105575810-105575832 GTACAAGGCCTGTCTGGTGCAGG + Intergenic
1125241675 15:37583058-37583080 GTAGCAGGGCGGGCAGCTCCAGG - Intergenic
1127860453 15:62989538-62989560 TTTCCAGTGCTGGCTCCTGCCGG - Intergenic
1128611987 15:69081448-69081470 ATTTCAGGGCTGGCTGCTGGAGG + Intergenic
1128698667 15:69788160-69788182 GTCCCAGTACTGGGTGCTGCAGG + Intergenic
1130183305 15:81652544-81652566 GTGCCAGGGCAGGCAGCTCCAGG - Intergenic
1131424887 15:92337785-92337807 TCACCAGGGCTGGTTGCTGATGG + Intergenic
1131655243 15:94449831-94449853 ATACCAGGGGTGGCAGTTGCTGG - Intronic
1132551726 16:556429-556451 GCACCAGGGCTGGCCACTGTTGG - Intergenic
1132702836 16:1229380-1229402 CTACCAGGACCAGCTGCTGCCGG - Exonic
1132705490 16:1241488-1241510 CTACCAGGACCAGCTGCTGCCGG + Exonic
1132708618 16:1256851-1256873 CTACCAGGACCAGCTGCTGCCGG + Exonic
1132878743 16:2151774-2151796 GTACCTGGGCTGGTTGGGGCGGG + Intronic
1135922716 16:26665440-26665462 GAACTCAGGCTGGCTGCTGCTGG + Intergenic
1136110115 16:28059387-28059409 GTCCCAGGGCTGGGTGGTGACGG - Intronic
1136607472 16:31346146-31346168 CTTCCTGGGCTGGTTGCTGCAGG - Intergenic
1137056867 16:35750151-35750173 ATACCAGGGCTGGATGCTTTTGG + Intergenic
1137620501 16:49873589-49873611 TCACCAGGGCAGGCTGCTGGGGG + Intergenic
1138448403 16:57078756-57078778 CCACCATGGCTGGCTGGTGCTGG + Intronic
1139402758 16:66696025-66696047 GTTACTGGGCTGGGTGCTGCTGG - Intronic
1139493042 16:67297283-67297305 GTAACAGCCCTGTCTGCTGCTGG + Intronic
1139964335 16:70737216-70737238 GGTCCTGGGCTGGGTGCTGCAGG + Intronic
1140210171 16:72963237-72963259 GTGCCAGGGCTAGCTGGTACAGG + Intronic
1141154156 16:81585459-81585481 GGAGCAGGGCTGACTGCTGATGG - Intronic
1141705826 16:85663939-85663961 GTTCCAGGTTTGTCTGCTGCAGG + Intronic
1141722573 16:85765030-85765052 GTACCTGCGCTGGCTGCTGACGG + Intergenic
1141877316 16:86834763-86834785 GTGCCAGCGGTGGCTGCTGAGGG - Intergenic
1142875481 17:2849650-2849672 AGACCTGGGCTGGCAGCTGCCGG + Intronic
1143610025 17:8012809-8012831 GTACCTGAGCTGCCTGCAGCAGG + Intronic
1143723306 17:8828625-8828647 GTACCCGGGCTGTGTGCAGCCGG + Exonic
1143863754 17:9909317-9909339 GGGCCAGTGCTGCCTGCTGCAGG - Intergenic
1144514617 17:15908643-15908665 GTGGCAGTGGTGGCTGCTGCAGG - Intergenic
1144746942 17:17622086-17622108 CCACCAGGGCTGGATGGTGCTGG + Intergenic
1144833785 17:18146030-18146052 TGAGCGGGGCTGGCTGCTGCTGG + Exonic
1145201026 17:20944800-20944822 GCACCACGTGTGGCTGCTGCCGG + Intergenic
1145884441 17:28372329-28372351 GGAGGAGGCCTGGCTGCTGCCGG + Exonic
1147240002 17:39084633-39084655 GTAGCAGTTCTGGCTGCTGCTGG - Intronic
1147510979 17:41068689-41068711 GCACCATGGCAGGCTGATGCTGG + Intergenic
1147524857 17:41212917-41212939 GCAGCAGGGCTGGCAGCAGCTGG - Intronic
1147528994 17:41255783-41255805 GCAGCAGGGCTGGCAGCAGCTGG - Exonic
1147529904 17:41265790-41265812 GTAGCAGGGCTGGCAGCAGCTGG - Exonic
1147530487 17:41271723-41271745 GCAGCAGGGCTGGCAGCAGCTGG - Intergenic
1149469979 17:56908612-56908634 GTTCCAGGGATGGCTTCTGGTGG - Intronic
1151677436 17:75605875-75605897 GGAGCAGGGCTGGCAGCGGCTGG + Intergenic
1151816050 17:76471977-76471999 CTTCCAGAGCTGGCCGCTGCTGG - Exonic
1151943442 17:77306622-77306644 CTCCCAGGGCTGGGTGCAGCCGG - Intronic
1151960499 17:77403056-77403078 GAACCAGGGCAGGCTCATGCAGG + Intronic
1152879855 17:82808599-82808621 GTCCAAGGGCTGGCAGGTGCTGG + Intronic
1153071927 18:1116126-1116148 GTACCTGAGCAGGTTGCTGCTGG + Intergenic
1155149759 18:23113693-23113715 GAACCAGGGATGGCTGGTTCTGG - Intergenic
1155364017 18:25032719-25032741 ATGCGAGGGCTGGGTGCTGCAGG - Intergenic
1155393994 18:25367319-25367341 GCATCAGAGCTGGATGCTGCAGG - Intergenic
1156331722 18:36129552-36129574 GGGCCAGCCCTGGCTGCTGCTGG + Intronic
1156471002 18:37377215-37377237 GGAGCAGGGCTGGCAGGTGCAGG + Intronic
1156485514 18:37463285-37463307 GCACCAGGCCTGGCTGCAGCAGG + Intronic
1158326944 18:56322658-56322680 GGACCTGGGCAGGCAGCTGCCGG + Intergenic
1158414330 18:57236034-57236056 GTACCAGGTTGGTCTGCTGCAGG + Intergenic
1158941549 18:62409750-62409772 GTGGCAGGGCTGGTTCCTGCTGG - Intergenic
1159955191 18:74513950-74513972 GGACATGGGCTGGCTCCTGCTGG + Intronic
1160730552 19:639946-639968 GGGCCTGGCCTGGCTGCTGCTGG + Exonic
1160794871 19:940733-940755 GCACCAGGGCTGGCGGCCGAGGG - Intronic
1160835691 19:1123502-1123524 GTCCCAGGGCTGGGTGCAGCCGG + Intronic
1161245871 19:3251509-3251531 GTGACAGGGCTGGTTGCTGAAGG + Intronic
1161390135 19:4016384-4016406 GTACCAGGGCTATCTGCCTCTGG - Intronic
1161778045 19:6274574-6274596 GCACCAGGAATGCCTGCTGCTGG + Intronic
1161796445 19:6389466-6389488 GGACCAGCCCTGGCTGCTCCGGG - Exonic
1162785883 19:13034441-13034463 GAAGCAGAGCTGGCTGCAGCAGG - Intronic
1162791653 19:13066194-13066216 GTGCCAGGCCTGGCTACTACAGG - Intronic
1162919335 19:13890986-13891008 GTACCAGGGCCGGCGACTGGAGG + Intronic
1163033041 19:14556765-14556787 GTTCCTGAGCCGGCTGCTGCGGG + Intronic
1163735947 19:18980826-18980848 GCACCAGGCCTGGCTCATGCCGG + Intergenic
1163758554 19:19120872-19120894 GTAGCAGGGGTGGCTGCAGCAGG + Intronic
1164458161 19:28426444-28426466 GTTCCTTGGCTGGCAGCTGCAGG - Intergenic
1164679537 19:30124436-30124458 GCACCAAGGCTGGATTCTGCTGG + Intergenic
1166066559 19:40363111-40363133 GTAACAGGGCTGGCAGCGTCAGG - Intronic
1167306533 19:48713288-48713310 GTCCCACAGCCGGCTGCTGCTGG + Exonic
925451564 2:3973592-3973614 CTTCCTGGGCTGGCTGCTGCAGG + Intergenic
925462230 2:4073557-4073579 GCAGCAGGGCTGTCTGCTCCAGG - Intergenic
925719329 2:6812461-6812483 GTGTTAGGGCTGGCTGGTGCTGG - Intergenic
928373192 2:30756053-30756075 GTACCTTGGCTGACTGCTGAGGG - Intronic
929370890 2:41222826-41222848 GTCCCAGTGCTGGCTCCTGCAGG - Intergenic
932101788 2:68908012-68908034 ATACCATGGGTGGCTGCTGAGGG + Intergenic
933646203 2:84814628-84814650 GGACCAGGGCAGGCTGGTCCCGG - Intronic
934652097 2:96098618-96098640 GGTCCAGGACTGGCGGCTGCTGG + Intergenic
934921247 2:98346902-98346924 GGAGCAGGGCTGGCTCCCGCTGG + Intronic
935878664 2:107538943-107538965 TTACCAGGGGAGGTTGCTGCTGG + Intergenic
937917230 2:127105320-127105342 GGCCCAGGGCTGCCTGCTCCAGG + Intronic
938237474 2:129717733-129717755 GTCCTGGGGCTGGCAGCTGCAGG - Intergenic
940338743 2:152557247-152557269 CTAACAGGGCTGGCTACTGGTGG - Intronic
946340120 2:219061056-219061078 GGACGAGGGCTGGCTAGTGCCGG - Intergenic
947442413 2:230134621-230134643 TTTCCTGGGCTGGGTGCTGCAGG + Intergenic
947796123 2:232895044-232895066 GGGCCTGGGATGGCTGCTGCAGG + Intronic
947992064 2:234496217-234496239 GAACCAGGGCACGCCGCTGCTGG - Exonic
948035279 2:234853324-234853346 GTACCAGGTCGCCCTGCTGCAGG + Intergenic
948855455 2:240728215-240728237 GGACCAGGGAGGGCTGCTGTCGG + Intronic
948896371 2:240929787-240929809 GAACCAGGCCTGGCCCCTGCTGG - Intronic
1169131487 20:3168248-3168270 GTCCCAGGGCTGGCTGAGGCCGG + Intronic
1170819414 20:19743717-19743739 TTTCCTGGGCTAGCTGCTGCAGG - Intergenic
1171290770 20:23981762-23981784 GTCCCAGGGATGGATGGTGCCGG - Intergenic
1171878379 20:30598740-30598762 GTCCCAGGGGTGGGTGGTGCTGG - Intergenic
1172386519 20:34537736-34537758 AGAGCAGGCCTGGCTGCTGCTGG + Intronic
1172773118 20:37392973-37392995 GAACCAGGTCTGGCTGGAGCGGG - Intronic
1172883958 20:38219125-38219147 GAACCAGGGCTGTCTGATGCAGG + Intronic
1173165174 20:40682868-40682890 GGACCAGGGCCCGCTGCTCCGGG - Intergenic
1174062787 20:47844315-47844337 TCAACAGGGCTGGCTCCTGCTGG - Intergenic
1174072931 20:47911355-47911377 TCAGCAGGGCTGGCTCCTGCTGG + Intergenic
1174619339 20:51862299-51862321 GCAGCAGGGCTGGGGGCTGCAGG + Intergenic
1175626277 20:60490603-60490625 GCACCAGCCCTGGCTGCAGCTGG - Intergenic
1176427413 21:6557352-6557374 CTGGCAGGGCTGGCTCCTGCTGG - Intergenic
1179702904 21:43165669-43165691 CTGGCAGGGCTGGCTCCTGCTGG - Intergenic
1179727098 21:43346767-43346789 GTACCTGGCCTGGCTGCTTGGGG + Intergenic
1180044794 21:45300294-45300316 GTACCAGAGCTTGCTGGAGCTGG + Intergenic
1180854197 22:19036055-19036077 CAAGCAGGGCTGGGTGCTGCAGG + Intergenic
1180960211 22:19759093-19759115 GGGCTAGGGCTGGGTGCTGCTGG + Intronic
1181010617 22:20038381-20038403 GTTTCAGGGCTGCCTCCTGCAGG + Intronic
1181077715 22:20392774-20392796 CTTCCTGGGCTGGCTGCGGCCGG - Intergenic
1181913815 22:26263036-26263058 GAACCAGGGCTAGGTGCTCCTGG - Intronic
1183102211 22:35591038-35591060 GTAGGAAGGCTGGCGGCTGCTGG - Intergenic
1183472984 22:38019399-38019421 GCTCCAGGGCGGGCTGCTCCTGG - Intronic
1183648541 22:39140711-39140733 GGACCTGGGCTGCCTGCTGGTGG + Intronic
1184282163 22:43443395-43443417 GTACCAGGAGAGGCTGGTGCAGG + Intronic
1184866653 22:47205272-47205294 GTACCAGAGAGGGCTGCTCCAGG - Intergenic
1185231936 22:49688480-49688502 GTCCCAGGCCTGGCTGGTGTGGG - Intergenic
949236412 3:1814451-1814473 TTACCTGGGCTGCTTGCTGCAGG - Intergenic
949877274 3:8634522-8634544 GTGCCAGGGCTGGAGGATGCTGG - Intronic
953494312 3:43373093-43373115 TTACCAGGGCAGGTAGCTGCTGG - Intronic
953753030 3:45623945-45623967 TCTCCAGGGGTGGCTGCTGCTGG - Intronic
953880406 3:46688390-46688412 GCTCCAGGGCTGGCCGGTGCTGG - Intronic
954497813 3:50982456-50982478 GTGGCAGGAATGGCTGCTGCAGG + Intronic
959389613 3:105758687-105758709 GTAGCAGGGCGGGCAGCTCCAGG + Intronic
961537719 3:127580148-127580170 CCCCCAGGGCTGGCTGCTGGCGG - Exonic
962105052 3:132381602-132381624 GTAGCAGGGCGGGCAGCTCCAGG + Intergenic
962425337 3:135264430-135264452 GAACCAGGGCTGTGTCCTGCTGG + Intergenic
963692752 3:148525396-148525418 GTGCCCAGGCTGGGTGCTGCAGG + Intergenic
963733126 3:148991662-148991684 GTCCCGGGGCTGGCGGCGGCGGG - Intronic
964714946 3:159712136-159712158 GCAGCAGTCCTGGCTGCTGCTGG - Intronic
965206053 3:165720110-165720132 GTAGCAGGGCAGGCAGCTCCAGG + Intergenic
966584805 3:181610546-181610568 GCACCAGGGCTGACTGTAGCTGG + Intergenic
966862486 3:184238363-184238385 GTGCCAGGGCTGGCAGCAGACGG - Exonic
968755166 4:2411963-2411985 GGACCAGGGCTGACTGCAGCCGG - Intronic
968957047 4:3724896-3724918 GTGCGAGGGCTGGCACCTGCCGG + Intergenic
970024179 4:11604153-11604175 GTGCCATGGCTGGTGGCTGCTGG + Intergenic
971368067 4:25993533-25993555 AAACCAGGGCTGGCAGCTGCTGG - Intergenic
973700017 4:53527769-53527791 CTACCAGGGCTGTCAGCTACTGG + Intronic
973959322 4:56093901-56093923 GCACCAGGGCTGGCAGTTTCTGG + Intergenic
979296625 4:119039966-119039988 GTCCCAGGCCTGCCTCCTGCTGG + Intronic
982725492 4:158902231-158902253 CTAACAGGCCTGTCTGCTGCAGG + Intronic
985048755 4:185969440-185969462 GCACCTGGGCTGGCAGCTGCAGG - Intergenic
985538469 5:477054-477076 GGACCAGGACAGGCTGCTGCGGG + Intronic
985645806 5:1084193-1084215 GGACCAGGCCAGGCTGCAGCAGG + Intronic
985691912 5:1318142-1318164 GTCACAGAGCTGGGTGCTGCCGG - Exonic
985767764 5:1789084-1789106 GCACCAGGGTTGGCTGGTGAGGG + Intergenic
989043060 5:37249090-37249112 GTACCAGGGCCGGGTGCGGCGGG + Intronic
991780576 5:70128142-70128164 TTTCCAGGGCTGGCTTCTGACGG - Intergenic
991810836 5:70473718-70473740 TTTCCAGGGCTGGCTTCTGACGG + Intergenic
991859864 5:71003565-71003587 TTTCCAGGGCTGGCTTCTGACGG - Intronic
991873024 5:71128461-71128483 TTTCCAGGGCTGGCTTCTGACGG - Intergenic
997062914 5:130528607-130528629 TTCACAGGACTGGCTGCTGCAGG - Intergenic
997568124 5:134905046-134905068 CTACCAGGGCTGGCGGTAGCTGG + Intronic
998692142 5:144598807-144598829 GCACCAGGGCCGGCAGCAGCGGG + Intergenic
999150187 5:149421573-149421595 GTCTCCGGGCTGCCTGCTGCTGG - Intergenic
1000349526 5:160342454-160342476 CTGCCAGGACTGGATGCTGCTGG - Intronic
1001328805 5:170747925-170747947 GGAGCTGGGATGGCTGCTGCAGG + Intergenic
1001702991 5:173721024-173721046 ATCGAAGGGCTGGCTGCTGCTGG - Intergenic
1003166124 6:3680004-3680026 AGACAAGGGCTGGCAGCTGCAGG + Intergenic
1003637508 6:7846470-7846492 GCACAAGGGCTGGATGCTGGCGG - Intronic
1004039351 6:11960549-11960571 CTTCCTGGGCTGGTTGCTGCAGG - Intergenic
1004232926 6:13849344-13849366 TTTCCTGGGCAGGCTGCTGCAGG + Intergenic
1006582900 6:35086889-35086911 GTGCCAGGGCTGGAGGCAGCAGG - Intronic
1006738057 6:36289210-36289232 CTCCCAGGGGTGGCTTCTGCTGG + Intronic
1007397217 6:41584861-41584883 GCATGAGGGCTTGCTGCTGCTGG - Exonic
1007622460 6:43223379-43223401 GTACCTGGGCAGAATGCTGCAGG - Exonic
1015310603 6:131762795-131762817 GTAGCAGGGCTGGTTTCTTCAGG - Intergenic
1015599141 6:134895470-134895492 AGACCAAGGCTGGCTGCTGCTGG + Intergenic
1018755165 6:166842468-166842490 TCCACAGGGCTGGCTGCTGCTGG - Intronic
1018834730 6:167474338-167474360 GTGCCAGGGCTGTCGTCTGCAGG + Intergenic
1019735463 7:2647968-2647990 CTACCTGGGCCTGCTGCTGCTGG + Exonic
1019910266 7:4096243-4096265 GAACCAGGCCTGGCTGTGGCAGG + Intronic
1020002778 7:4765222-4765244 GTACCATGCCTGGCTCATGCCGG + Exonic
1020985520 7:15129228-15129250 TTTCCAGGGCTGGTTGCTACAGG + Intergenic
1022640469 7:32177883-32177905 GTACCTGGGCTGGGTTCTACAGG + Intronic
1024961494 7:54981440-54981462 CCTCCTGGGCTGGCTGCTGCAGG - Intergenic
1025231609 7:57206596-57206618 TCAACAGGGCTGGCTCCTGCTGG + Intergenic
1026540543 7:71276214-71276236 GTAGCAGGGCAGGTGGCTGCAGG + Intronic
1026888968 7:73971121-73971143 GCCCCATGGCTGGCTGCGGCTGG - Intergenic
1027967024 7:85025364-85025386 GAACCAGGGCTGGTTGCTGTTGG - Intronic
1028561327 7:92179279-92179301 GGACCCGCGCTGGCCGCTGCAGG + Intronic
1029287471 7:99475755-99475777 CTTCCAGAGCTGGTTGCTGCAGG + Intronic
1029737472 7:102472756-102472778 GCAGCAGGGGTGGCTGCTTCAGG - Exonic
1029899436 7:104023234-104023256 GGAGCAGGGCAGGCTGCTCCAGG - Intergenic
1030682784 7:112450726-112450748 GTAGCAGTGCTGGCGGCGGCGGG + Exonic
1033607949 7:142941252-142941274 TTACCAGAGCTGGCAGCGGCTGG + Exonic
1034426826 7:151018380-151018402 GGGCCAGGGCTGTCTGCAGCAGG + Exonic
1034690340 7:153008610-153008632 GGACAAGGCCTGGCTGCTTCAGG + Intergenic
1035705464 8:1671233-1671255 GAACCAGGGCAGGCTCCTGAGGG - Intronic
1036504417 8:9342417-9342439 GTGCCAAGGCTGTCTGCTGCTGG - Intergenic
1036610628 8:10346875-10346897 CTCCCTGGGCTGGTTGCTGCAGG + Intronic
1038401740 8:27289077-27289099 GCACCAGGGCTGGTCTCTGCCGG - Intronic
1039435440 8:37556526-37556548 GCTCCAGGGCTGGCTGGAGCTGG - Intergenic
1039476404 8:37841458-37841480 GTCCCAGCGCTGGCTGCCCCGGG + Exonic
1039829826 8:41204133-41204155 GCAACTGGGCTGGCAGCTGCTGG + Intergenic
1040549948 8:48430069-48430091 GGCCCAGGGCTGGATGATGCTGG + Intergenic
1041084298 8:54242889-54242911 CCACCAGGGCTGTCTGGTGCTGG + Intergenic
1041932336 8:63300636-63300658 GTACCAGGGAAGGCTGTTGATGG + Intergenic
1043346030 8:79298846-79298868 TAAACAGGGATGGCTGCTGCTGG + Intergenic
1044138078 8:88611871-88611893 CTGCCACCGCTGGCTGCTGCTGG + Intergenic
1044183762 8:89227207-89227229 GTATCAGGACTGGCAGCTACAGG + Intergenic
1048133170 8:131719812-131719834 GTGCCAGGGCTGGCTCTTCCTGG - Intergenic
1048183350 8:132216346-132216368 GCACCAGGGCTGGATGCCACAGG + Intronic
1049073976 8:140379188-140379210 TTACCAGGGCAGCCTGGTGCTGG + Intronic
1049818696 8:144621114-144621136 CTAACAGGGCAGGCAGCTGCAGG - Intergenic
1052122135 9:24730856-24730878 GGAGCAGGGGTGGCTGCTGAGGG + Intergenic
1052831198 9:33217334-33217356 GTGCCAGGGGAAGCTGCTGCTGG - Intergenic
1053069276 9:35091626-35091648 GTAGCAGGGCTGGCTGCTTCAGG - Exonic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1053381796 9:37655047-37655069 GTACCAGGGCTGGTGGCACCAGG - Intronic
1053411736 9:37920209-37920231 GTAGCAGTGGCGGCTGCTGCTGG - Intronic
1053577108 9:39364197-39364219 GGGCCATGCCTGGCTGCTGCTGG + Intergenic
1053841613 9:42192122-42192144 GGGCCATGCCTGGCTGCTGCTGG + Intergenic
1054098679 9:60922887-60922909 GGGCCATGCCTGGCTGCTGCTGG + Intergenic
1054120079 9:61198516-61198538 GGGCCATGCCTGGCTGCTGCTGG + Intergenic
1054356346 9:64067024-64067046 GGAGCATGGCTGGCTGCTGTCGG - Intergenic
1054587677 9:66984046-66984068 GGGCCATGCCTGGCTGCTGCTGG - Intergenic
1056248864 9:84727823-84727845 GTACCACGGCTGCCTCCAGCTGG + Exonic
1057313968 9:93957528-93957550 GCACCAGGGCTGCCTCTTGCTGG - Intergenic
1057371510 9:94478887-94478909 GTAGGAGGGCTGCCTGCAGCTGG - Intergenic
1057381577 9:94572087-94572109 GAATCAGGGCTTCCTGCTGCTGG - Intronic
1059380459 9:113919596-113919618 GCCCCTGGGCCGGCTGCTGCTGG + Intronic
1059670041 9:116482904-116482926 GAATCAGGCCTGGCTGCTGCTGG + Intronic
1060971140 9:127738821-127738843 GCGCCGGGCCTGGCTGCTGCTGG + Exonic
1061764041 9:132870112-132870134 GTTCCCGGGCTGGGGGCTGCAGG + Intronic
1061895296 9:133643880-133643902 GTCCCAGGGCTGGCTGGCGGTGG + Intronic
1062205981 9:135337658-135337680 GTAGCAATGCTGGCTGCAGCAGG + Intergenic
1062402566 9:136378933-136378955 GTGCCAGGTTTGGCTGCCGCGGG + Exonic
1062409651 9:136416852-136416874 TTCCCAGGGCTGGCTGCAGATGG + Intronic
1062437094 9:136551176-136551198 GCACCAGGGCTGGCACCTCCAGG + Intergenic
1188743774 X:33817164-33817186 GCACGAGGGCTGGATGCTGGTGG + Intergenic
1189005029 X:36986033-36986055 CTACCAGGGCAGCCTGCTGGCGG - Intergenic
1189043993 X:37571909-37571931 CTACCAGGGCAGCCTGCTGGCGG + Exonic
1189307882 X:40000816-40000838 GTGACAGGGCTGGCTGCAGTGGG + Intergenic
1189651225 X:43191852-43191874 ATTCCAGGACTGGCTGGTGCAGG - Intergenic
1189990555 X:46589911-46589933 GAACTATTGCTGGCTGCTGCTGG - Intronic
1190748464 X:53340992-53341014 GTTCCAGGGCTGTGTGCTGCTGG + Intergenic
1191059914 X:56284331-56284353 GCACCTGGGATGGCTGCTCCTGG + Exonic
1192123413 X:68477696-68477718 ACTCCAGGGCTGGCTGGTGCCGG + Intergenic
1193658455 X:84226303-84226325 GAAGCAGTGCTGCCTGCTGCTGG - Intergenic
1195208729 X:102629820-102629842 TTAGCAGGGCTGGCTCCTTCTGG + Intergenic
1195564423 X:106324138-106324160 GTACCAGGCCAGACTGCTTCCGG + Intergenic
1195618848 X:106933546-106933568 GTCCCAGAGTGGGCTGCTGCAGG - Intronic
1196904573 X:120418969-120418991 GCTCCAGGGCAGGCTGCTCCAGG + Intergenic
1200037656 X:153343868-153343890 GTGCCTGGGCTGGCATCTGCTGG + Intronic
1200061320 X:153485050-153485072 GGACCAGGGCTTCCTGCTGCTGG + Intronic
1200185814 X:154182635-154182657 GCACCAGGGCCGGCTGCCGTCGG + Intergenic
1200191466 X:154219773-154219795 GCACCAGGGCCGGCTGCCGTCGG + Exonic
1200197221 X:154257577-154257599 GCACCAGGGCCGGCTGCCGTCGG + Intergenic