ID: 1118776522

View in Genome Browser
Species Human (GRCh38)
Location 14:68977693-68977715
Sequence CCCCCTTTTAAGTTTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118776518_1118776522 20 Left 1118776518 14:68977650-68977672 CCTTTGGCTGAAAAAAAAAACTT 0: 1
1: 0
2: 4
3: 71
4: 799
Right 1118776522 14:68977693-68977715 CCCCCTTTTAAGTTTAAAAAAGG 0: 1
1: 0
2: 1
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118776522 Original CRISPR CCCCCTTTTAAGTTTAAAAA AGG Intronic
902145558 1:14395871-14395893 CCCCACTTTAAGTCTTAAAAAGG - Intergenic
903001644 1:20270440-20270462 CCACCTTTTAAGATAAAAATTGG + Intergenic
905935954 1:41824433-41824455 CCTCCTTTTCAGTTCAAAACAGG + Intronic
909458136 1:75873636-75873658 CCCACTTTTAAGTGAAAACATGG + Intronic
912407442 1:109452444-109452466 CCCCATTCTAAGTTCATAAAAGG - Intergenic
917783883 1:178431155-178431177 CCCCAGTTTATGTTTACAAAGGG - Intronic
918417206 1:184322801-184322823 CTTTCTTTTTAGTTTAAAAAAGG + Intergenic
919666035 1:200293408-200293430 CCCCATTTTAGGTTTTAAACAGG + Intergenic
920791109 1:209093796-209093818 CCTCCTTTTAGGGTAAAAAATGG + Intergenic
924652815 1:245946109-245946131 CCCGCAGTTAAATTTAAAAAAGG + Intronic
1063273118 10:4534431-4534453 CCCCCTTCTATTTTTAAAATTGG - Intergenic
1064094605 10:12413930-12413952 CCTCATTTTAAGGTGAAAAAGGG - Intronic
1064404297 10:15047390-15047412 CTCCCTTTTTAGTTTGAAAGAGG + Intronic
1065630946 10:27680426-27680448 CCCCACTTTAAGTTTCAACATGG - Intronic
1065858836 10:29853422-29853444 CTCTATTTTAAGGTTAAAAAGGG + Intergenic
1065975586 10:30839109-30839131 CCCCATTTGCTGTTTAAAAAGGG - Intronic
1067777480 10:49174060-49174082 CCCCATTTTCAGATGAAAAAAGG - Intronic
1068268832 10:54692669-54692691 TTCGCTTTTAAGTTTAAGAATGG - Intronic
1070052495 10:72902911-72902933 CTACCTTTGATGTTTAAAAATGG - Intronic
1071998389 10:91169193-91169215 CTCTCTTTTAAGATTAAAATTGG - Intronic
1072107393 10:92287697-92287719 ACCCCTTTTAAGTGTACAATGGG + Intronic
1073024579 10:100478081-100478103 GCCCATTTTTAGTTTTAAAAGGG + Intronic
1073024582 10:100478083-100478105 GCCCCTTTTAAAACTAAAAATGG - Intronic
1076476480 10:130757307-130757329 CACCCTTTCAAGCTTGAAAAAGG + Intergenic
1080039181 11:27740837-27740859 CCCCCATTTACATTTGAAAAAGG + Intergenic
1081192459 11:40120349-40120371 CCTCCTTGTAAATTTAAATATGG + Intronic
1084235858 11:67787763-67787785 GCCTCTTTTAAGTTTTCAAACGG + Intergenic
1088097817 11:106120262-106120284 CCCCCTTTGATGTGTAAAAGAGG + Intergenic
1089478429 11:118785337-118785359 CCTCCTTTTACATATAAAAAGGG - Intronic
1090521012 11:127479399-127479421 TCCCCCTTTAGGTTTAGAAATGG + Intergenic
1093442161 12:19211848-19211870 CCTGCTTTAAACTTTAAAAAAGG - Intronic
1093486577 12:19659424-19659446 CCCCTTTTTAATTTAAAATATGG + Intronic
1095746634 12:45666712-45666734 CCCCCTGTTTGGTGTAAAAATGG - Intergenic
1096222597 12:49841169-49841191 CCCCCTTTTAGTTTTACAAATGG - Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1100739840 12:97579900-97579922 CCCCATTTTACGGTTATAAATGG - Intergenic
1101397159 12:104358455-104358477 CCCACTTTTTAGATGAAAAAAGG + Intergenic
1104496733 12:129247705-129247727 CCCCCTATTAACATTACAAAGGG - Intronic
1104900652 12:132188070-132188092 CCCCCTTTTGAGTTTAACTGAGG - Intergenic
1112645394 13:101325725-101325747 TCTCCTTTTAGGTTTAAACATGG + Intronic
1114575009 14:23705268-23705290 CCTCATTTAAAGTTAAAAAAAGG - Intergenic
1118348234 14:64955252-64955274 ACCTCTCTTAAATTTAAAAAAGG + Intronic
1118776522 14:68977693-68977715 CCCCCTTTTAAGTTTAAAAAAGG + Intronic
1119102884 14:71896350-71896372 CCCCCTTTTAAGACCATAAAGGG + Intergenic
1121916920 14:97843989-97844011 TGGCCTTTGAAGTTTAAAAACGG + Intergenic
1122030107 14:98905833-98905855 GCCCCTTAAAAGTTTGAAAATGG - Intergenic
1122382407 14:101317811-101317833 CCCACTTCTAAATTTAACAAGGG - Intergenic
1125098690 15:35884942-35884964 TTTCCTTTTAAGTTTAAAAAGGG - Intergenic
1125471348 15:40007396-40007418 CCACCAATTAAGTTTTAAAAGGG - Intronic
1126210592 15:46097336-46097358 CTCCCTTTAAAGTTTTAATAAGG + Intergenic
1126911324 15:53420039-53420061 CCACTTTTAAAGTTTAATAAAGG - Intergenic
1126960346 15:53986236-53986258 CCCCATTTCAAGTTCAAACAAGG - Intergenic
1126963084 15:54020211-54020233 ATCTCTTTCAAGTTTAAAAAGGG - Intronic
1131222152 15:90593760-90593782 CTCCCTTTGAAGAGTAAAAAAGG - Intronic
1131379522 15:91952495-91952517 CCACCTTTTGAGAGTAAAAATGG + Intronic
1131653270 15:94425748-94425770 CAACATTTTAAGTTTAAAATTGG - Intronic
1131922511 15:97344941-97344963 CCCCTTTTTAAGTTGACAAATGG - Intergenic
1132193401 15:99889846-99889868 CCCCATTTAAACTTTGAAAAGGG + Intergenic
1133706948 16:8363896-8363918 CCCACTTTATAGATTAAAAATGG - Intergenic
1139714094 16:68798833-68798855 CATCCTTTTAAGTCTAAAATAGG - Intronic
1144157506 17:12520688-12520710 CCCACTTTCAAGCTTAAAATGGG + Intergenic
1144250471 17:13411534-13411556 CCACCTTTTAACTCTTAAAAAGG - Intergenic
1145976539 17:28987217-28987239 GCCCCTTTCAAGTTTTAATAGGG + Intronic
1146170934 17:30632549-30632571 CACCATTTTAATTTTAGAAATGG + Intergenic
1146344385 17:32048553-32048575 CACCATTTTAATTTTAGAAATGG + Intronic
1147990343 17:44328842-44328864 TCCCCTTTTACAGTTAAAAAGGG - Intergenic
1153500599 18:5745591-5745613 CTCCCTTTTTCTTTTAAAAATGG - Intergenic
1154209115 18:12364141-12364163 CCTGTTTTTAACTTTAAAAATGG + Intronic
1155753653 18:29462019-29462041 CACACATTTAAGTTTAAAATTGG + Intergenic
1156095426 18:33525723-33525745 CTACCTTCTATGTTTAAAAATGG + Intergenic
1156142280 18:34129283-34129305 TGCCCTTGAAAGTTTAAAAATGG - Intronic
1156316161 18:35970984-35971006 CTCCCTTTTAAAATTAAAAATGG + Intergenic
1156691443 18:39711849-39711871 TCCCCTTTGAAGCTTAAAAAAGG - Intergenic
1156749833 18:40438682-40438704 TCTCCTTTTAAGTCTAAAAGTGG + Intergenic
1158375017 18:56853771-56853793 ACCCATTTTAAGCTTAAAAAAGG + Intronic
1159366263 18:67469294-67469316 CCCAGTTTTGAGATTAAAAAGGG - Intergenic
1159945554 18:74442069-74442091 CCTCATTTTAGGTTCAAAAAAGG + Exonic
1160221612 18:76982013-76982035 CCCCCTTTTGACATTGAAAATGG + Intronic
1160476408 18:79192986-79193008 CACCCTGTCAAGCTTAAAAATGG + Intronic
1162618511 19:11821115-11821137 CACCCTTTGAAGTTTCCAAAGGG - Intronic
1164121747 19:22272012-22272034 CCACCTTGTAAGTGTAAACAAGG - Intergenic
1167026336 19:46921816-46921838 CCCCCTTTGTAATTTCAAAATGG - Exonic
1168313204 19:55472067-55472089 CTCCATTTTAAGTGCAAAAACGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
928649902 2:33392987-33393009 TCTCCTTTAAAGTTTTAAAATGG + Intronic
930532450 2:52606974-52606996 CCCCCATTTTACTTGAAAAATGG + Intergenic
930566620 2:53028616-53028638 CCCAGTCTTGAGTTTAAAAAAGG - Intergenic
930676244 2:54203799-54203821 CCCCCTTTTTTTTTTCAAAAAGG + Intronic
931293767 2:60901711-60901733 CCCCCTTTTGAGTGTTAAATAGG + Intronic
931340300 2:61394638-61394660 ACCCCTTTTAGCTTTAAAACAGG + Intronic
932465247 2:71918136-71918158 CCCCATTTCTAATTTAAAAAAGG - Intergenic
932942371 2:76182549-76182571 ACTCCTTTCAAGTTAAAAAATGG + Intergenic
933865231 2:86509951-86509973 CTCCTTTTTTAGTTTAAAACAGG + Intronic
935427465 2:102935105-102935127 CCACCTTTTAATGTGAAAAATGG - Intergenic
937827106 2:126379118-126379140 CCGCCTTTTATTTTTAAGAAAGG + Intergenic
940145224 2:150538657-150538679 TCCCCTTTAAGTTTTAAAAATGG - Intronic
940159018 2:150691994-150692016 CACCCTTTAAACTTTAGAAAAGG - Intergenic
940561322 2:155301065-155301087 CCTTATTTCAAGTTTAAAAAGGG - Intergenic
941175119 2:162187779-162187801 CTGCCTCTTAAGTTTAGAAATGG - Intronic
943878389 2:193103835-193103857 CTAGCTTTCAAGTTTAAAAAGGG - Intergenic
946030422 2:216699391-216699413 CCCCCTGTTAAATTAAAAAAAGG + Intergenic
946140723 2:217688380-217688402 CCCCCATTTAAGTTTCAATGTGG - Intronic
948113044 2:235472221-235472243 CGCCCTGCTAATTTTAAAAAAGG - Intergenic
1170556668 20:17520354-17520376 CCACCATTTGAGTTAAAAAAGGG - Intronic
1170617314 20:17964410-17964432 CCAACACTTAAGTTTAAAAATGG - Intronic
1174635057 20:51992150-51992172 CCCCAATTTGTGTTTAAAAACGG + Intergenic
1177669361 21:24206370-24206392 CCCACTTTTTAATTTATAAATGG - Intergenic
1182530669 22:30953847-30953869 GCCCTTTTTAGGTTTAAAAATGG + Intronic
953039998 3:39247936-39247958 CCAACTTTTTATTTTAAAAATGG - Intergenic
953094087 3:39757667-39757689 CCCCCATGTAAGTGTAACAAGGG + Intergenic
955307380 3:57847914-57847936 ACCACTTTTACTTTTAAAAAAGG - Intronic
956895074 3:73651497-73651519 CCCACTTTCTAGTTCAAAAATGG - Intergenic
958104518 3:89054978-89055000 CACCATTATAAATTTAAAAAGGG - Intergenic
958170019 3:89927758-89927780 CCCCATTCTAAGTTCATAAAAGG + Intergenic
958193706 3:90215663-90215685 CCCCTTTTTAAGCCTGAAAATGG - Intergenic
958869730 3:99543645-99543667 AAGCATTTTAAGTTTAAAAATGG + Intergenic
961243290 3:125430700-125430722 CCTCCTTTTCTGTTTAATAAGGG + Intergenic
962122288 3:132574725-132574747 CTCCCTTCTAAGTTTTAAGAAGG - Intronic
962299028 3:134221088-134221110 ATCCCTTTTTTGTTTAAAAAGGG + Intronic
963856974 3:150264564-150264586 CCCACTTTTAATTTTAACCAGGG - Intergenic
965817038 3:172647701-172647723 CCCCCTTTTCACTCTCAAAAGGG - Intronic
966530928 3:180978888-180978910 CCCCCTTTAAGGCTTAACAAAGG - Exonic
967545723 3:190724921-190724943 CCACCTTTTTATTTTTAAAATGG - Intergenic
967929602 3:194681243-194681265 TCCCCTTTTAACCTTCAAAATGG - Intergenic
968720148 4:2196602-2196624 CAACTTGTTAAGTTTAAAAATGG + Intronic
969976719 4:11110255-11110277 TCCTCTTTTTATTTTAAAAATGG + Intergenic
970577862 4:17445365-17445387 CCTCCTGTTATGTTTAATAAGGG - Intergenic
973228493 4:47814452-47814474 CCCTCATTTAAGATGAAAAATGG + Intronic
973317051 4:48772563-48772585 ACCCATCTTAAGTTTTAAAATGG + Intronic
974025716 4:56731691-56731713 CACCCTTTTGTGTATAAAAAGGG - Intergenic
975664434 4:76720963-76720985 CCCCCTTTCACATTTTAAAAAGG - Intronic
975963082 4:79936658-79936680 TTCCCTTTTACGTTTAATAAAGG - Intronic
976042980 4:80909657-80909679 TCCCGTTTAAAGTTTATAAAAGG - Intronic
976219637 4:82745743-82745765 CATACTTTTAATTTTAAAAATGG - Intronic
977229215 4:94431865-94431887 TCACCTTGTAATTTTAAAAAGGG - Intergenic
979037364 4:115739774-115739796 CACCATTTTATTTTTAAAAATGG + Intergenic
980327257 4:131362955-131362977 CCCCACTTTAAGTGTAAAGAAGG - Intergenic
981115480 4:140985232-140985254 CTCCTTTTTAAGTTAAAAATGGG - Intronic
982765374 4:159341229-159341251 CCACATTTTTAGTTTAAAAAGGG - Intronic
984092890 4:175396344-175396366 CCCCTTTTCAAGATGAAAAAAGG - Intergenic
984494852 4:180484015-180484037 CCCCCTCCTAAGTAAAAAAAGGG + Intergenic
988409374 5:30866980-30867002 GCTCTTTTTAATTTTAAAAAAGG - Intergenic
990379944 5:55213322-55213344 TGACCTTTTAATTTTAAAAATGG - Intergenic
990433511 5:55762726-55762748 CCTTGTTTTAATTTTAAAAATGG + Intronic
991632747 5:68673086-68673108 CCCGCTTCTAAGTTTGAAAATGG - Intergenic
991985879 5:72286627-72286649 TCCCATGTTAATTTTAAAAACGG - Intronic
992272430 5:75078925-75078947 AGTCCTTTTAAGTTTTAAAATGG - Intronic
992291059 5:75280687-75280709 CCCATTTCTAAATTTAAAAATGG - Intergenic
992833364 5:80616911-80616933 CCCCCATTTCTGTATAAAAATGG - Intergenic
994894029 5:105678334-105678356 ACCATTTTTAATTTTAAAAATGG + Intergenic
994894030 5:105678335-105678357 CCCATTTTTAAAATTAAAAATGG - Intergenic
996653461 5:125911823-125911845 CCCCCCTCTAAGTTTAAATATGG + Intergenic
999699412 5:154214529-154214551 CCCTTTTTTAAGTTTAAAAAAGG - Intronic
999703662 5:154251246-154251268 CACTCTTTTCATTTTAAAAATGG + Intronic
999768682 5:154758039-154758061 TACCCTTTTGAGTTTAAAGAGGG - Intronic
1001129483 5:169052114-169052136 CTCCCTTTCAAGTTTTAAAGGGG - Intronic
1002854947 6:1028182-1028204 CCCCATTTTAAATTAAGAAAAGG + Intergenic
1003197147 6:3925519-3925541 CACACTTTTAAGTTGAGAAAAGG - Intergenic
1003318676 6:5033628-5033650 CACACTTTTAAGTTGAGAAAAGG + Intergenic
1003679545 6:8238415-8238437 CTCCCTTTAAACTTTAATAAAGG - Intergenic
1005133255 6:22536893-22536915 CCCCCTTTTAATTCAAACAATGG - Intergenic
1005257082 6:24014694-24014716 TCCCCTTTTAGGTTTAAAATAGG + Intergenic
1005414717 6:25587615-25587637 CCTCCATTTAAGTGTAGAAAAGG - Intronic
1005673445 6:28130466-28130488 CCCCATTTTAAGATAAAAAAGGG - Intergenic
1005683738 6:28232020-28232042 CTCCCTATGAAGTATAAAAAAGG + Intronic
1007803764 6:44421066-44421088 CACCCATTTAAGTTGACAAATGG + Intronic
1007916405 6:45565574-45565596 CTACATTTTAATTTTAAAAATGG - Intronic
1008793230 6:55265819-55265841 CCCCATTTTAAAGTTAATAAAGG - Intronic
1008950410 6:57152202-57152224 CCTCCTATTAATTTTAGAAAAGG - Exonic
1010126236 6:72435198-72435220 GTCCCTTTTAAGTGTTAAAAGGG + Intergenic
1010570927 6:77474228-77474250 CCCCATTCTGAGTTTATAAAAGG + Intergenic
1010571502 6:77478527-77478549 CCCCATTCTGAGTTTATAAAAGG + Intergenic
1011753223 6:90474074-90474096 CCAGGTTTTAAGTTTTAAAACGG + Intergenic
1012119943 6:95354175-95354197 CACCCTTTTAAATTTGCAAATGG - Intergenic
1014133168 6:117857770-117857792 CACCTTTTTATTTTTAAAAAAGG + Intergenic
1014268304 6:119307183-119307205 TACCCTTTTATGTTTACAAATGG + Intronic
1015490229 6:133816939-133816961 CACCCTTCTATTTTTAAAAAGGG - Intergenic
1016886249 6:148962536-148962558 CCCCCTTTTAAAATTAAATTGGG - Intronic
1018109523 6:160521573-160521595 CCCACTTTTAAAGTAAAAAAGGG - Intergenic
1024088904 7:45919923-45919945 CCCCCATTTCAGATTAAGAAGGG + Intronic
1025790379 7:64682404-64682426 CCCCTTTATAAGCTTACAAAAGG + Intronic
1026630730 7:72035445-72035467 CCTCCTTATTAGTCTAAAAAAGG - Intronic
1028520716 7:91727540-91727562 CCCCGTTTGAAGTTTAAGATGGG - Intronic
1030282832 7:107794684-107794706 CCACCTTTTAAGATCAAAAAAGG + Intronic
1031506018 7:122584465-122584487 ACCTCTGTTAAGTTTAAAAATGG - Intronic
1031761453 7:125717449-125717471 CCCCCTTGTAAGTAAAAAAGAGG + Intergenic
1031843370 7:126774143-126774165 TCCACTTTTAAGTTTAGAAATGG - Intronic
1032571430 7:133003872-133003894 GACCCTTTGAAGTTTTAAAAAGG - Intronic
1034134531 7:148754037-148754059 CCTCCTTCTAAGTCGAAAAAGGG + Exonic
1036677620 8:10848166-10848188 CCCACTTTTAAATACAAAAAAGG + Intergenic
1037280157 8:17231995-17232017 ACCCCTTTTAAGGTTTAAACTGG - Intronic
1039854196 8:41398422-41398444 ACCTCTTTGCAGTTTAAAAAGGG - Intergenic
1042234075 8:66590316-66590338 CCCCTTTTTACATTTAGAAAAGG - Intronic
1045249876 8:100474435-100474457 CCCCCTTATCACTTTAAATAGGG + Intergenic
1045445066 8:102253122-102253144 CCACCTTTTCATTTTACAAATGG - Exonic
1046042659 8:108925208-108925230 GTCCCTTTTTAGTTCAAAAATGG - Intergenic
1050778505 9:9299725-9299747 CTCCATTTTATGTTTATAAATGG + Intronic
1051243421 9:15084157-15084179 CCCACTTTTATGGTTAAACAAGG + Intergenic
1051484659 9:17594863-17594885 CCCCCTTTTAAATATACATAAGG - Intronic
1053099136 9:35354660-35354682 ACCCCATTTAAATTTAAAACTGG - Intronic
1056536282 9:87530535-87530557 CTCCCTTTTAGATTTAATAATGG + Intronic
1057437210 9:95052364-95052386 TCTCCTTTTGAGTTTAAACAAGG - Intronic
1057588318 9:96349144-96349166 CACTCTTTTAAGATTGAAAAGGG - Intronic
1057734180 9:97638407-97638429 CCCTCTTATAAGCTTGAAAAGGG - Intronic
1057942632 9:99298287-99298309 CCTCCTTTTAAGTTGAGAATGGG + Intergenic
1060241039 9:121903453-121903475 CCCAGTTTTGAGTTTAAAACAGG - Intronic
1061364101 9:130161990-130162012 CCCCATCTCAATTTTAAAAAAGG + Intergenic
1186303922 X:8233176-8233198 CCCCATTTTAAATTAATAAAAGG + Intergenic
1189014068 X:37077620-37077642 TCCCCATGCAAGTTTAAAAAGGG - Intergenic
1190230477 X:48578312-48578334 CCCACTTTTAATTTGCAAAATGG - Exonic
1193102424 X:77629617-77629639 GCCCCTCTTAAGTTTTAACAAGG + Intronic
1193709532 X:84862563-84862585 CCTCCTTTTAAGAAAAAAAAGGG - Intergenic
1194481297 X:94428341-94428363 CCCTTTTCTAAGTTTTAAAATGG - Intergenic