ID: 1118779631

View in Genome Browser
Species Human (GRCh38)
Location 14:68998579-68998601
Sequence GTGGAGAGAAGGTATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118779625_1118779631 3 Left 1118779625 14:68998553-68998575 CCCGGGGGTGGGGAGTGGAGTTT No data
Right 1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG No data
1118779626_1118779631 2 Left 1118779626 14:68998554-68998576 CCGGGGGTGGGGAGTGGAGTTTT No data
Right 1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118779631 Original CRISPR GTGGAGAGAAGGTATGAGAA AGG Intergenic
No off target data available for this crispr