ID: 1118780434

View in Genome Browser
Species Human (GRCh38)
Location 14:69004311-69004333
Sequence TTCCCTGGAAGCAGCTCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118780434_1118780438 -6 Left 1118780434 14:69004311-69004333 CCCTCGGAGCTGCTTCCAGGGAA No data
Right 1118780438 14:69004328-69004350 AGGGAAGCTCCTATTCCCCTGGG No data
1118780434_1118780437 -7 Left 1118780434 14:69004311-69004333 CCCTCGGAGCTGCTTCCAGGGAA No data
Right 1118780437 14:69004327-69004349 CAGGGAAGCTCCTATTCCCCTGG No data
1118780434_1118780445 19 Left 1118780434 14:69004311-69004333 CCCTCGGAGCTGCTTCCAGGGAA No data
Right 1118780445 14:69004353-69004375 ATGGCTGCTGTCCTTGTGTCTGG No data
1118780434_1118780439 0 Left 1118780434 14:69004311-69004333 CCCTCGGAGCTGCTTCCAGGGAA No data
Right 1118780439 14:69004334-69004356 GCTCCTATTCCCCTGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118780434 Original CRISPR TTCCCTGGAAGCAGCTCCGA GGG (reversed) Intergenic
No off target data available for this crispr