ID: 1118788150

View in Genome Browser
Species Human (GRCh38)
Location 14:69064083-69064105
Sequence CCCCTAGCACTGGCTTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118788150 Original CRISPR CCCCTAGCACTGGCTTCCTA AGG Intronic
900115224 1:1025343-1025365 CCCCTAGGACTGCCGTCCTGAGG - Intronic
900483133 1:2909011-2909033 CACCCAGCTCTGGCTTCCAAGGG + Intergenic
900765999 1:4505853-4505875 CCCCTAGCAGTTGCTTCTCAGGG + Intergenic
901740202 1:11336631-11336653 CCCCTGCCACAGGCTTCCTTGGG - Intergenic
901847035 1:11989936-11989958 ACTCCAGCACTGGCTTCCTCAGG + Intronic
903834048 1:26191227-26191249 CCCCAGGCAGAGGCTTCCTATGG + Intronic
904064658 1:27739936-27739958 GCCATAGCACTGGCTCCCAAGGG - Intronic
904968739 1:34402206-34402228 CCCCTAGACCTGACTGCCTAGGG + Intergenic
905311000 1:37048973-37048995 CCTCTAGCACTTGCTACCTGTGG - Intergenic
907801477 1:57769996-57770018 CCCCAGACACTGGCTTCTTAAGG + Intronic
907861812 1:58361194-58361216 CCCCTGGGTCTGGCCTCCTAGGG + Intronic
908939257 1:69411298-69411320 TCCCTATCACTGGCTTCTTAAGG + Intergenic
910500333 1:87883023-87883045 CCCCATGCACTGGCTTCCCCAGG + Intergenic
910777877 1:90893824-90893846 GCGCTAGCACTGGCTTCCCGCGG + Intergenic
916274397 1:162978196-162978218 CCCCTAACACTGGCCTTCTAAGG - Intergenic
916550975 1:165849560-165849582 GCCCTAGCACTGGCTTCCTCAGG - Intronic
922957146 1:229612691-229612713 GTCCTAGCACTCTCTTCCTATGG + Intronic
923685385 1:236149771-236149793 CCCCTGGCACCGGCTCCCTGCGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069737206 10:70664660-70664682 CCCCTGGCATTGGCTGCCTGGGG - Intergenic
1070630750 10:78082699-78082721 CCCCCAGGACTTGCTTCCCAGGG + Intergenic
1075484846 10:122813873-122813895 CCCCTAGCCCTGGCCTCCCATGG - Intergenic
1075484880 10:122814033-122814055 CCCCCAGCCCTGGCCTCCCATGG - Intergenic
1075484899 10:122814113-122814135 CCCCCAGCCCTGGCCTCCCATGG - Intergenic
1075721216 10:124588755-124588777 CCCCCAACACTGCCTTCCAAGGG + Intronic
1079783759 11:24643662-24643684 CCCCAAGCACTTGCTTTGTAAGG + Intronic
1090419175 11:126562270-126562292 CCTCTTGCACTGGCTTCATTGGG - Intronic
1090578433 11:128133643-128133665 CTCCTAGCACTGGCTTAATTTGG + Intergenic
1091644269 12:2261997-2262019 GCCCTGGCACTGCCTTCCCAAGG - Intronic
1096627213 12:52903448-52903470 CCCCGACCACTGGGTTCCTGGGG + Intronic
1097020292 12:56016006-56016028 CTCCATGCCCTGGCTTCCTAGGG + Intronic
1102459142 12:113089471-113089493 CCCCTAGCTCTGCCTTCTTGGGG - Intronic
1102961430 12:117096023-117096045 GCCCTAACACTGCCTTCCTGGGG + Intronic
1104111427 12:125708599-125708621 CCTCTAGCACAGTCTCCCTAAGG - Intergenic
1104386086 12:128352812-128352834 GCCCTGGCCCTGGCTTCCTGAGG - Intronic
1105805845 13:23951190-23951212 TCCATAGCAGTGGCTTCCCAGGG + Intergenic
1105815647 13:24033798-24033820 CCCCTGGCACTGACTTCCTGAGG - Intronic
1108116344 13:47132764-47132786 CCCAAAGCACTGGCTTACTCAGG - Intergenic
1117178616 14:53170177-53170199 TTCCTAGCACTGGAGTCCTAGGG + Intergenic
1118788150 14:69064083-69064105 CCCCTAGCACTGGCTTCCTAAGG + Intronic
1124812163 15:32951962-32951984 GCCTTGTCACTGGCTTCCTATGG + Intronic
1124995229 15:34717149-34717171 GCCCAAGCAGTGGCTTTCTAAGG + Intergenic
1125898046 15:43319117-43319139 CCTGTACCACTGGCTTCCTGGGG - Intergenic
1125987601 15:44070179-44070201 CACCCAGCCCTGGTTTCCTATGG - Intronic
1129412659 15:75358602-75358624 GGCCCAGCACAGGCTTCCTATGG + Exonic
1130990522 15:88873184-88873206 CTCCTAGCACCGGCATCCCAGGG + Intronic
1131269938 15:90941061-90941083 CCCCAAGCACTTGCTTTGTAGGG + Intronic
1132663437 16:1071470-1071492 CCCACAGCAGTGGCTTCCCAAGG - Intergenic
1132847067 16:2005575-2005597 CCCCTGGCACGGGTTTCCTCTGG - Intronic
1133021915 16:2970475-2970497 CCTCTAGTACTGGCCTCCCAGGG - Intronic
1134906486 16:17983950-17983972 CTCCAAGCACCTGCTTCCTAAGG - Intergenic
1135469013 16:22712587-22712609 CCTGTAGCACAGGCTTCCTTGGG - Intergenic
1140355898 16:74306202-74306224 CCCATAGCTCTGGCATCCTCAGG + Exonic
1141689365 16:85587710-85587732 CCTCTAGCACTGGCTCCCTGAGG - Intergenic
1142189178 16:88709751-88709773 CCTCTGGCAGTGGCTTCCTCAGG - Intronic
1145961089 17:28886915-28886937 CCCCTAACACTAGCATCCTTGGG + Intronic
1146659456 17:34654680-34654702 CCCCGACCACTGGCTTACTTTGG + Intergenic
1151997280 17:77618031-77618053 TCCCCGGCACTGGCTGCCTATGG + Intergenic
1152197128 17:78924634-78924656 CCCCCAGCGCTGGCATCCCAGGG + Intronic
1152683649 17:81683311-81683333 CCCCTCGCAACGGCTTCCTGTGG - Intronic
1162462069 19:10819124-10819146 GCCCTATCACTTGCTTTCTAAGG - Intronic
1165147501 19:33740745-33740767 CCCCCAGAACTGGCATCATATGG + Intronic
927598922 2:24423148-24423170 CCCCTTGAGCTGGCTTCCCATGG - Intergenic
928954327 2:36847127-36847149 GCCACAGCACTGGCTTTCTAAGG + Exonic
938796175 2:134719360-134719382 CCCCTCCCACTGGATTCCTCTGG + Intergenic
942239531 2:173946964-173946986 CCTCCTGCATTGGCTTCCTAAGG + Intronic
1168817743 20:751855-751877 ACCCTTCCACTGACTTCCTAGGG - Intergenic
1169150162 20:3283246-3283268 CCACCACCACTGGCTTCCAAAGG - Intronic
1169247855 20:4037991-4038013 CTCACAGCACTGGCTTCCTCTGG - Intergenic
1173249371 20:41356643-41356665 CCCCAAGGAGGGGCTTCCTATGG + Intronic
1173839143 20:46145845-46145867 CCCCTAGCACTGCCCTTCTCTGG + Intergenic
1175199820 20:57269076-57269098 CCTCCAGCGCTGGCTTGCTAGGG + Intergenic
1177624349 21:23640608-23640630 CCTCTAGCATTGTCTTCCAAAGG - Intergenic
1177776177 21:25569054-25569076 CCCCCAGCAATGGCTTACTCAGG + Intergenic
1179781404 21:43703162-43703184 CCCCTATCACGGGCTTTCTGCGG + Intergenic
1181468386 22:23122992-23123014 ACCCTAGCAAAGGCTTCCTCTGG + Intronic
1182828307 22:33284361-33284383 TCACCAGCACTGGCTGCCTAGGG - Intronic
1183406560 22:37633161-37633183 CCCCAGTCACTGGGTTCCTATGG - Exonic
1183864095 22:40690549-40690571 GCACTAGCACTGGCTGCCTTGGG - Intergenic
950165308 3:10792859-10792881 CCTCTAGCACTGGCTCCTTCGGG - Intergenic
954710238 3:52501891-52501913 CCCCTTGCTCTTGCTTCCTTGGG + Intronic
955498212 3:59558616-59558638 CCCCAGGAGCTGGCTTCCTAGGG - Intergenic
956049458 3:65231973-65231995 CCAATAGCACTAGCTTCCTAGGG - Intergenic
962219028 3:133547781-133547803 TCCCTAGCACTGGTTTGCTGGGG - Intergenic
964497169 3:157303722-157303744 CCCCTTGGTCTGGCTTCTTAGGG + Intronic
966078339 3:175966540-175966562 TCTCTAGCCTTGGCTTCCTAGGG - Intergenic
968920944 4:3522088-3522110 GGCCTGGCACTGGCTTTCTAAGG - Intronic
976204805 4:82614624-82614646 CCACTTGCCTTGGCTTCCTAAGG + Intergenic
977569850 4:98617752-98617774 CCGCTAGCTTTGGCTTCCTATGG - Intronic
978478425 4:109159520-109159542 TCCCCAGCACTGGCTCCCTCAGG + Intronic
986560075 5:9051922-9051944 CCCGGAGCACTGGCTGCCCATGG + Exonic
987588495 5:19891082-19891104 CCCTTGGCACTGGCATCCTTTGG + Intronic
987642693 5:20633003-20633025 CACCTAGCACTCGCCTCCTCTGG + Intergenic
990436607 5:55798927-55798949 TTCCTAGCTCTTGCTTCCTAAGG + Intronic
997795000 5:136800265-136800287 TCCCTACCAGTGGCTTCCTCTGG + Intergenic
1003384488 6:5654606-5654628 CCCCTAACACAGTCTTCCCAAGG - Intronic
1004107145 6:12676596-12676618 CCCCTAGGACTGGTTTCTTCAGG - Intergenic
1006646698 6:35519915-35519937 ACCCTGGCACTGGACTCCTAGGG - Intergenic
1010570103 6:77464676-77464698 CGCCTAACACTGGCCTCCTAGGG - Intergenic
1013178933 6:107701561-107701583 TCCCAAGCACTCACTTCCTAAGG + Intergenic
1018999183 6:168734040-168734062 CCCCAAGCACAGGCTTCCGTAGG - Intergenic
1022789213 7:33670143-33670165 CCCCAAGCACTGTCTCCCTGTGG + Intergenic
1024010959 7:45266403-45266425 CCCCCTGCAGTAGCTTCCTAGGG + Intergenic
1024566087 7:50682086-50682108 CCCCCAGCACTGGCCACCTTGGG + Intronic
1025812091 7:64881971-64881993 CCCCTGGAACTGGCATCCCACGG - Intronic
1028979217 7:96948530-96948552 AACTTAGCACTGGCGTCCTAAGG + Intergenic
1030220317 7:107091757-107091779 TCTCCAGCAGTGGCTTCCTATGG + Intronic
1035252556 7:157606588-157606610 CACCAAGCACTGGCCTCCGAGGG - Intronic
1039495128 8:37974741-37974763 TCCCCAGCACTTGCTTCCCAGGG - Intergenic
1041180911 8:55247041-55247063 ACCTTAGCTCTGGTTTCCTAAGG - Intronic
1041826145 8:62098249-62098271 CTCCAAGCTCTGGCTTCCTCAGG + Intergenic
1057729626 9:97597395-97597417 CCCCTGGCACTGGCTTTTTCAGG - Intronic
1058200465 9:102032966-102032988 CCCCTACCTATGGCTGCCTATGG + Intergenic
1059569820 9:115422900-115422922 CCCCTAAGGCTGGCATCCTAAGG - Intergenic
1060297950 9:122355787-122355809 CCCCCAGCACTGGTTTCTTCTGG + Intergenic
1062382621 9:136294750-136294772 CCCCAAGGACAGGCTTCCCATGG + Intronic
1187767737 X:22661843-22661865 CCCCTATCCCTTGTTTCCTAGGG - Intergenic
1190334414 X:49253679-49253701 CCCCTAGCCCTGACTCCCTTGGG - Intronic
1191870356 X:65740267-65740289 CCCCTACCACTGTCTTCTTCAGG + Exonic
1192624542 X:72714092-72714114 GCGCTAGCACTGGCTTCCCGCGG + Intronic
1197119294 X:122871120-122871142 CTCTTAGGACTGGCTTCCCAGGG - Intergenic
1200076686 X:153554710-153554732 CCCCAGCCACAGGCTTCCTATGG - Intronic
1201181904 Y:11356677-11356699 GCCATATCACTGGCTTCCTTGGG + Intergenic
1201642518 Y:16194643-16194665 CCCCTGGCACAGGCATCATAAGG - Intergenic
1201660296 Y:16390677-16390699 CCCCTGGCACAGGCATCATAAGG + Intergenic