ID: 1118794913

View in Genome Browser
Species Human (GRCh38)
Location 14:69133524-69133546
Sequence CCTGCCTACTGGTTTCGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118794913_1118794925 14 Left 1118794913 14:69133524-69133546 CCAAATCGAAACCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1118794925 14:69133561-69133583 ACAGGCAGGTCTGGAGAGATAGG 0: 1
1: 0
2: 3
3: 36
4: 400
1118794913_1118794921 -10 Left 1118794913 14:69133524-69133546 CCAAATCGAAACCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1118794921 14:69133537-69133559 AGTAGGCAGGGAAGAGGCGGGGG 0: 1
1: 0
2: 5
3: 66
4: 624
1118794913_1118794922 -4 Left 1118794913 14:69133524-69133546 CCAAATCGAAACCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1118794922 14:69133543-69133565 CAGGGAAGAGGCGGGGGTACAGG 0: 1
1: 0
2: 1
3: 49
4: 411
1118794913_1118794924 5 Left 1118794913 14:69133524-69133546 CCAAATCGAAACCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1118794924 14:69133552-69133574 GGCGGGGGTACAGGCAGGTCTGG 0: 1
1: 0
2: 1
3: 32
4: 247
1118794913_1118794923 0 Left 1118794913 14:69133524-69133546 CCAAATCGAAACCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1118794923 14:69133547-69133569 GAAGAGGCGGGGGTACAGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 366
1118794913_1118794927 22 Left 1118794913 14:69133524-69133546 CCAAATCGAAACCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1118794927 14:69133569-69133591 GTCTGGAGAGATAGGAGAGGTGG 0: 1
1: 0
2: 6
3: 53
4: 576
1118794913_1118794926 19 Left 1118794913 14:69133524-69133546 CCAAATCGAAACCAGTAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1118794926 14:69133566-69133588 CAGGTCTGGAGAGATAGGAGAGG 0: 1
1: 0
2: 2
3: 47
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118794913 Original CRISPR CCTGCCTACTGGTTTCGATT TGG (reversed) Intronic