ID: 1118795245

View in Genome Browser
Species Human (GRCh38)
Location 14:69137702-69137724
Sequence GGCAAAGGGGCTTACTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118795245_1118795252 21 Left 1118795245 14:69137702-69137724 CCAGTACAGTAAGCCCCTTTGCC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1118795252 14:69137746-69137768 CAGTTACCATTAGTCAACCAGGG 0: 1
1: 0
2: 19
3: 119
4: 321
1118795245_1118795251 20 Left 1118795245 14:69137702-69137724 CCAGTACAGTAAGCCCCTTTGCC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1118795251 14:69137745-69137767 TCAGTTACCATTAGTCAACCAGG 0: 1
1: 0
2: 1
3: 17
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118795245 Original CRISPR GGCAAAGGGGCTTACTGTAC TGG (reversed) Intronic
901250814 1:7778123-7778145 GGCAATCGGGATTACTGTTCTGG + Exonic
902366324 1:15976741-15976763 GGCAAAAGAGCTTACAGTAGTGG - Intergenic
904916369 1:33973333-33973355 GGCCAAGGGGCTTCCTGCACAGG + Intronic
915733088 1:158067802-158067824 GGCAAGAAGGCTTACTGTTCTGG - Intronic
915943612 1:160134627-160134649 GGCACAGGGGCTTCCTGCAGAGG - Intronic
918093979 1:181319357-181319379 GGAAAAGGGGCTTTCTCTCCTGG + Intergenic
922972300 1:229752947-229752969 GGCAGAGGGGCTTCCTCTTCAGG + Intergenic
923554216 1:234987878-234987900 GGCAGTGGGGCTTACTGTGTGGG - Intergenic
923638157 1:235722366-235722388 GGCTAAGGGGCTTTCTATAGAGG + Intronic
923663137 1:235976259-235976281 GGCAGAGAGGCTGAGTGTACTGG + Exonic
924197997 1:241628847-241628869 GGTAAAGTGGTTTACTGAACTGG - Exonic
924466855 1:244305891-244305913 GGCAAAGGGGCAAGCTGTGCCGG - Intergenic
1063905651 10:10777724-10777746 GGCAAAGGGGGCTAGTGTAGAGG - Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1068420779 10:56789541-56789563 GGAAATGAGGCCTACTGTACTGG + Intergenic
1071481954 10:86071240-86071262 GGGAAATGGGCTCACTGTCCTGG + Intronic
1073832289 10:107399063-107399085 ATCAAAGGGGCTTAGTGTACAGG + Intergenic
1074794651 10:116930298-116930320 GTCACAGGGGCTTGGTGTACAGG + Intronic
1077352249 11:2098442-2098464 GGCAAAGGGGCCTCCAGTGCTGG - Intergenic
1078014622 11:7602468-7602490 GGCAGAGGAGCTTATTGTGCAGG - Intronic
1091793988 12:3286954-3286976 GGGTAAGGGGCTTCCTGTAGGGG + Intergenic
1092261701 12:6956369-6956391 GGCCAAGGGGCTCACTGTCTTGG + Intronic
1094742110 12:33301729-33301751 GGCAAAAGGGCTTTCCCTACTGG - Intergenic
1095991505 12:48037641-48037663 GGCAGAGGGGCTCAGTGTATGGG + Intergenic
1096570338 12:52519454-52519476 TATAAAGGGGCTGACTGTACAGG - Intronic
1099823515 12:87746021-87746043 GTCAAAAGGGCTTTCTGTAAGGG + Intergenic
1112381089 13:98891038-98891060 GGCACAGGGGCAAACTGTAGGGG - Intronic
1113319020 13:109213977-109213999 GGAAAATGTGCTTACTGCACTGG - Intergenic
1118795245 14:69137702-69137724 GGCAAAGGGGCTTACTGTACTGG - Intronic
1121559491 14:94864245-94864267 GGCAGAGGGGCTAACTAGACTGG + Intergenic
1125758208 15:42080198-42080220 ACCATAGTGGCTTACTGTACTGG + Intronic
1126816182 15:52457152-52457174 GGCAAAGGGGCTTGGTGTGGTGG + Intronic
1128541173 15:68534551-68534573 GGAAAAGGGGATTCCTGGACTGG - Intergenic
1129015805 15:72467711-72467733 TACAAAGGGGCCTATTGTACAGG - Intergenic
1130202313 15:81843314-81843336 GCCCAATGGACTTACTGTACTGG - Intergenic
1130365615 15:83235581-83235603 GGCAAAGGAGGTTATTGTATTGG + Intergenic
1132324943 15:100961175-100961197 GGCAAAGGGCCTGAGTGTGCTGG + Intronic
1135602043 16:23791862-23791884 GACCAAGGGGCACACTGTACAGG - Intergenic
1139321772 16:66120118-66120140 GACAAAGGGGCTAACTGTGAAGG - Intergenic
1139973423 16:70790636-70790658 GGCAAGGGGGATTTCTGTGCTGG + Intronic
1141218318 16:82045537-82045559 TGCCAAGGGGATTACTGAACTGG - Intronic
1147795972 17:43043112-43043134 GGCAAAGGGTCTTACAGGAGTGG - Intergenic
1156867240 18:41902667-41902689 GGCCCAGTGGCTTCCTGTACTGG - Intergenic
1157203219 18:45676947-45676969 GGAAAAGGGCCTAACTGTTCTGG - Intronic
1160292422 18:77606936-77606958 GGCAAAGGGTCTAATTGTCCAGG + Intergenic
1161296400 19:3522697-3522719 GGGAAAGGGGCTTTCTGCCCTGG - Intronic
1163439584 19:17314886-17314908 GGCAAAGGGGCCCACAGCACAGG + Intronic
1166834815 19:45660889-45660911 TGCAAAGGGGCTGGCTGCACAGG - Intergenic
925243592 2:2358322-2358344 GGCAAAAGGGGATATTGTACTGG + Intergenic
925439123 2:3868678-3868700 GCCAAAGGGACTTTCTGTACTGG - Intergenic
935271845 2:101441438-101441460 GGCAAGGGGGCTGAGTGTGCTGG - Intronic
939424725 2:142020118-142020140 TGCAAAAGGGCTTAGAGTACAGG + Intronic
942227082 2:173826488-173826510 GGCAGAGGTGTTTCCTGTACAGG + Intergenic
1173882417 20:46426032-46426054 GGCAAACGGGCAGACTGTAGTGG + Intronic
1174474413 20:50786231-50786253 TGCATAGGGGCTAACTGCACAGG - Intergenic
1175513396 20:59551200-59551222 GACAAAGGGGTTTGATGTACAGG - Intergenic
1176042019 20:63070891-63070913 GGCAAAGGGGGACACAGTACTGG - Intergenic
1183968218 22:41456381-41456403 GGCAAAGGGGCTGAGAGTGCTGG + Intergenic
959098427 3:101982924-101982946 GTCACAGGGGTTTGCTGTACAGG + Intergenic
968137010 3:196227053-196227075 GGCAAAGGGTGTTCTTGTACAGG - Exonic
968946002 4:3664623-3664645 GGCCCAGGGGCTTTCTGAACTGG + Intergenic
976503683 4:85821174-85821196 GGTAAATAGGCATACTGTACAGG + Intronic
980208774 4:129757530-129757552 TGCAAAGAGGATTAGTGTACAGG - Intergenic
984480644 4:180297154-180297176 GGCAAAGGGGCTTGCTTTCATGG - Intergenic
991340904 5:65607573-65607595 AGGAAAGGGGCTTAATTTACAGG - Intronic
993020636 5:82586366-82586388 AGCAGAGGGGCTTCCTGTGCAGG + Intergenic
994511370 5:100708628-100708650 GGCCAAGGCGCTCTCTGTACAGG + Intergenic
999201799 5:149822001-149822023 GGCAAAGGGGTTCAGTGTAGCGG - Intronic
999697109 5:154196990-154197012 GGCAAAGGGGTTTTCTCTCCAGG - Intronic
1003232706 6:4269171-4269193 GGTAAAGGGGCTGAGTGTGCTGG - Intergenic
1004515611 6:16320101-16320123 TGCAAAGGGACTGACTCTACAGG + Intronic
1004962472 6:20806064-20806086 GTCACAGGGGTTTGCTGTACAGG + Intronic
1007744553 6:44035345-44035367 GGCACAGGGCCTTACTGTGGAGG - Intergenic
1011700949 6:89954225-89954247 GGCAAAGGTGCTCACTATATGGG + Intronic
1014747974 6:125222271-125222293 GGCAGAGGGGCTGACTCTATAGG - Intronic
1016261292 6:142173959-142173981 GGCAAAGGGGCTTAGGGAGCAGG - Intronic
1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG + Intronic
1024379423 7:48678222-48678244 GGTACAGTGGCATACTGTACAGG + Intergenic
1025118810 7:56281719-56281741 GGCAAAGAGGCTTCCTGAGCTGG - Intergenic
1026656922 7:72264742-72264764 GTCATAGGGGTTTGCTGTACAGG + Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041647123 8:60264382-60264404 GGCAAAGGCGCTGACAGTCCAGG + Intronic
1047883937 8:129227338-129227360 TTTAAAGGGGCTTACTGTAGTGG + Intergenic
1048337521 8:133514284-133514306 GGCCAGGGAGCTTGCTGTACTGG - Intronic
1049069571 8:140346020-140346042 CCCAAAGGGGCTTACGGGACTGG + Intronic
1052567951 9:30182684-30182706 GTCACAGGGGTTTAGTGTACAGG + Intergenic
1053003537 9:34590506-34590528 GGGAAAGGGGCTTCCTTGACCGG + Intergenic
1062540014 9:137037415-137037437 GGCAAGGGGGCTTCCTGGTCTGG + Exonic
1187143393 X:16615673-16615695 GGCAAAAGGGCATACTCTAATGG - Intronic
1189179839 X:38993075-38993097 TGGAAAGGGGCTAATTGTACCGG + Intergenic