ID: 1118797934

View in Genome Browser
Species Human (GRCh38)
Location 14:69161026-69161048
Sequence TTGCATTTTTAGTAGAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 552270
Summary {0: 2144, 1: 87073, 2: 174971, 3: 173225, 4: 114857}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118797934_1118797941 0 Left 1118797934 14:69161026-69161048 CCCCATCTCTACTAAAAATGCAA 0: 2144
1: 87073
2: 174971
3: 173225
4: 114857
Right 1118797941 14:69161049-69161071 AACTTAGCTGGGCATGGTGGTGG 0: 137
1: 9208
2: 28237
3: 53714
4: 58901
1118797934_1118797944 25 Left 1118797934 14:69161026-69161048 CCCCATCTCTACTAAAAATGCAA 0: 2144
1: 87073
2: 174971
3: 173225
4: 114857
Right 1118797944 14:69161074-69161096 GCCTGTAAGTCCAGGTACTCAGG No data
1118797934_1118797946 28 Left 1118797934 14:69161026-69161048 CCCCATCTCTACTAAAAATGCAA 0: 2144
1: 87073
2: 174971
3: 173225
4: 114857
Right 1118797946 14:69161077-69161099 TGTAAGTCCAGGTACTCAGGAGG No data
1118797934_1118797942 1 Left 1118797934 14:69161026-69161048 CCCCATCTCTACTAAAAATGCAA 0: 2144
1: 87073
2: 174971
3: 173225
4: 114857
Right 1118797942 14:69161050-69161072 ACTTAGCTGGGCATGGTGGTGGG 0: 63
1: 4365
2: 21191
3: 49730
4: 74545
1118797934_1118797940 -3 Left 1118797934 14:69161026-69161048 CCCCATCTCTACTAAAAATGCAA 0: 2144
1: 87073
2: 174971
3: 173225
4: 114857
Right 1118797940 14:69161046-69161068 CAAAACTTAGCTGGGCATGGTGG 0: 418
1: 24124
2: 70164
3: 138880
4: 184679
1118797934_1118797939 -6 Left 1118797934 14:69161026-69161048 CCCCATCTCTACTAAAAATGCAA 0: 2144
1: 87073
2: 174971
3: 173225
4: 114857
Right 1118797939 14:69161043-69161065 ATGCAAAACTTAGCTGGGCATGG 0: 17
1: 1185
2: 25626
3: 57767
4: 102075
1118797934_1118797943 17 Left 1118797934 14:69161026-69161048 CCCCATCTCTACTAAAAATGCAA 0: 2144
1: 87073
2: 174971
3: 173225
4: 114857
Right 1118797943 14:69161066-69161088 TGGTGGGCGCCTGTAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118797934 Original CRISPR TTGCATTTTTAGTAGAGATG GGG (reversed) Intergenic
Too many off-targets to display for this crispr