ID: 1118797943

View in Genome Browser
Species Human (GRCh38)
Location 14:69161066-69161088
Sequence TGGTGGGCGCCTGTAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118797934_1118797943 17 Left 1118797934 14:69161026-69161048 CCCCATCTCTACTAAAAATGCAA 0: 2144
1: 87073
2: 174971
3: 173225
4: 114857
Right 1118797943 14:69161066-69161088 TGGTGGGCGCCTGTAAGTCCAGG No data
1118797935_1118797943 16 Left 1118797935 14:69161027-69161049 CCCATCTCTACTAAAAATGCAAA 0: 2282
1: 93703
2: 242781
3: 155312
4: 85843
Right 1118797943 14:69161066-69161088 TGGTGGGCGCCTGTAAGTCCAGG No data
1118797936_1118797943 15 Left 1118797936 14:69161028-69161050 CCATCTCTACTAAAAATGCAAAA 0: 4729
1: 200398
2: 140886
3: 66420
4: 54242
Right 1118797943 14:69161066-69161088 TGGTGGGCGCCTGTAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118797943 Original CRISPR TGGTGGGCGCCTGTAAGTCC AGG Intergenic
No off target data available for this crispr