ID: 1118806806

View in Genome Browser
Species Human (GRCh38)
Location 14:69245046-69245068
Sequence TGGGACAGGCAGAAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118806806_1118806816 13 Left 1118806806 14:69245046-69245068 CCCAGCACCTTCTGCCTGTCCCA No data
Right 1118806816 14:69245082-69245104 TTTGCATCAGGCAATGGAGTAGG No data
1118806806_1118806815 7 Left 1118806806 14:69245046-69245068 CCCAGCACCTTCTGCCTGTCCCA No data
Right 1118806815 14:69245076-69245098 AGTAGTTTTGCATCAGGCAATGG No data
1118806806_1118806817 14 Left 1118806806 14:69245046-69245068 CCCAGCACCTTCTGCCTGTCCCA No data
Right 1118806817 14:69245083-69245105 TTGCATCAGGCAATGGAGTAGGG No data
1118806806_1118806813 1 Left 1118806806 14:69245046-69245068 CCCAGCACCTTCTGCCTGTCCCA No data
Right 1118806813 14:69245070-69245092 TCCTGGAGTAGTTTTGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118806806 Original CRISPR TGGGACAGGCAGAAGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr