ID: 1118808928

View in Genome Browser
Species Human (GRCh38)
Location 14:69260060-69260082
Sequence CCCCGAGCGCGCGCGTCCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118808928_1118808933 1 Left 1118808928 14:69260060-69260082 CCGGGGGACGCGCGCGCTCGGGG 0: 1
1: 1
2: 3
3: 19
4: 152
Right 1118808933 14:69260084-69260106 TGAAGGGCATTAGGACCGTGAGG 0: 1
1: 0
2: 1
3: 2
4: 77
1118808928_1118808932 -8 Left 1118808928 14:69260060-69260082 CCGGGGGACGCGCGCGCTCGGGG 0: 1
1: 1
2: 3
3: 19
4: 152
Right 1118808932 14:69260075-69260097 GCTCGGGGCTGAAGGGCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118808928 Original CRISPR CCCCGAGCGCGCGCGTCCCC CGG (reversed) Exonic
900126005 1:1069187-1069209 CCCCAAGCGCGCTTGTCCGCAGG + Intergenic
900227567 1:1540232-1540254 CCCCGCCCGCGCGCGCCGCCTGG - Intronic
901242618 1:7704203-7704225 CGCCGAGGGCCCGCGTTCCCGGG - Intronic
901762520 1:11479948-11479970 CCGCGCGCGCGAGGGTCCCCAGG + Intronic
901811078 1:11767003-11767025 CCCCGAGGGAGCGGGTCCACAGG + Exonic
902431604 1:16367527-16367549 CCACTAACGCGCGCGTCACCCGG + Intronic
903016781 1:20366664-20366686 CCCCGACCGCGCACGCCCCGCGG + Intergenic
905789818 1:40784031-40784053 CCCCGAGCGCGCCCCCGCCCCGG + Exonic
905866948 1:41381845-41381867 CCCCGAGTGCGCCCGCCCCGGGG + Exonic
906403344 1:45521729-45521751 ACCCGAGCGCGGGCGGGCCCCGG + Exonic
914373386 1:147050783-147050805 CCGGGAGCCCGCGCCTCCCCCGG - Intergenic
915900945 1:159846393-159846415 CCCCAAGCGCGCTCATCACCTGG - Intronic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
922933389 1:229407292-229407314 CGCAGAGCGAGCGCGTCCTCTGG + Intergenic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
924090105 1:240492923-240492945 CCCCGCGCGCGCCCGGCCGCTGG - Exonic
1062843668 10:689347-689369 CCCGGAGCGTGCGCGTCCCCCGG - Intronic
1062890467 10:1056450-1056472 CCCTGAGCGCAGGCGGCCCCGGG + Intronic
1063376500 10:5557648-5557670 CCCTGAGCGCCTGCGTCTCCTGG + Intergenic
1063459093 10:6204059-6204081 CCCCGGGCGCACGCACCCCCCGG + Intronic
1064086601 10:12350057-12350079 CCCCGAGCGCGCCCGACGCGTGG + Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070328999 10:75404865-75404887 CCCCGGGCGCGCAGGCCCCCAGG - Intergenic
1070329799 10:75409016-75409038 TCCCGAGCGCGCACATTCCCAGG - Intergenic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1072700885 10:97640769-97640791 CCCCGAGCGGGCCCAACCCCCGG + Exonic
1073363565 10:102918867-102918889 CCCCCAGCCCGCGCTCCCCCGGG - Exonic
1074815205 10:117137434-117137456 TCCAGAGCGCGGGAGTCCCCTGG + Intronic
1075430448 10:122375282-122375304 CCCGCGGGGCGCGCGTCCCCGGG + Intronic
1076857120 10:133122815-133122837 CCCCAGGCACACGCGTCCCCAGG + Intronic
1076857124 10:133122831-133122853 CCCCAGGCACACGCGTCCCCAGG + Intronic
1076857128 10:133122847-133122869 CCCCAGGCACACGCGTCCCCAGG + Intronic
1076878950 10:133230780-133230802 CCCCCAGCGCGCCCGCCGCCCGG + Exonic
1077386544 11:2271933-2271955 CCCCGAGGGCACGCGTTTCCCGG - Intergenic
1079353454 11:19712616-19712638 CCCCGGCCGCGCGCCTCCCGGGG - Intronic
1079407061 11:20156629-20156651 CCCCGCCCCCGTGCGTCCCCCGG - Intronic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1090699257 11:129279453-129279475 GCCCGAGGACCCGCGTCCCCGGG - Intergenic
1091563330 12:1630368-1630390 CCCCGAGAGCCCCTGTCCCCAGG - Intronic
1095875905 12:47079864-47079886 CCCCGGGCGCGCGGGAACCCCGG - Exonic
1096795571 12:54075542-54075564 CCCCCAGCCCCCGCCTCCCCAGG + Intergenic
1097262353 12:57726812-57726834 CCGCGTGACCGCGCGTCCCCAGG + Intronic
1104049446 12:125186154-125186176 CCGCGAGCGCCCGCGACCCCCGG + Intergenic
1106247160 13:27960424-27960446 CCCAGAGCGCGCGCGCCCTCTGG + Intergenic
1106264784 13:28100382-28100404 ACCCGGGCGCGCGCCTCCTCCGG - Intronic
1106304182 13:28495315-28495337 CCCCACGCGCGCTCGGCCCCGGG - Intergenic
1112504576 13:99968447-99968469 CCACGCACGCGCGCGTGCCCCGG + Intronic
1112506339 13:99978560-99978582 GCCCGGCCGCGCGCGGCCCCTGG + Intergenic
1113379018 13:109786349-109786371 GGCCCAGCGAGCGCGTCCCCCGG - Exonic
1113820365 13:113209018-113209040 CCTCGGGCGCGCGCGCCCCGAGG - Intronic
1116849366 14:49893123-49893145 CCCCGAGCGCGGGCTCCCTCCGG - Exonic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1119383019 14:74240504-74240526 CCCCGAGCCCGCGCGTCCCCGGG - Intronic
1121439338 14:93939039-93939061 CCATGCGCGCGCGCGTCCCTGGG + Intronic
1122688862 14:103522283-103522305 CCCCGAGGGGTCGCGTACCCGGG + Exonic
1123040326 14:105487710-105487732 CCCCGCGCCCGCGCGCCCCGAGG + Intronic
1123630713 15:22258136-22258158 CCCCGCGCGCGCCCGCCCGCCGG + Intergenic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1130411835 15:83654222-83654244 CGCCGAGCCCGCGCGGCCCCGGG + Exonic
1132044022 15:98548869-98548891 CCCCCTCCGCGCCCGTCCCCTGG + Intergenic
1132731129 16:1362530-1362552 CCCCGAGCGCACGCTTACCTGGG - Exonic
1132778868 16:1612314-1612336 CCCCGCGCGCCCGCGCACCCCGG + Exonic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1137257652 16:46790131-46790153 CCCCGAGCGCGCGCACCTCCCGG - Intronic
1139750317 16:69106081-69106103 CCCCGACCCCGCGCGGTCCCAGG - Intronic
1140462248 16:75148961-75148983 TCCCGCGCGCGCGCGCCCGCCGG - Intronic
1141972338 16:87492443-87492465 CCCCGCGCGCGCCCGCCCGCCGG - Intergenic
1142176142 16:88646311-88646333 CCCGGTCCGCGCACGTCCCCTGG - Intronic
1142293223 16:89202003-89202025 GCCGGAGCCCGCGCGCCCCCGGG - Intergenic
1142553047 17:752524-752546 CCCCCACCGAGCGCCTCCCCCGG + Intronic
1142762267 17:2049736-2049758 GCTCGAGCGCGCGCGTCCTGCGG - Intergenic
1143026619 17:3945025-3945047 CCGCCCGCCCGCGCGTCCCCTGG + Intronic
1143749949 17:9021148-9021170 CCCCGCCCGCGCGCTCCCCCGGG + Intergenic
1147110366 17:38257154-38257176 CACCGAGCGCGGGCGACCGCCGG + Intergenic
1147742510 17:42676985-42677007 CCCCCAGCGCGCCAGTCCCGGGG - Intronic
1147786196 17:42980445-42980467 CCCCGAGGGCGCGCCTTCCCCGG - Exonic
1148271718 17:46266883-46266905 CCGTGAGCGCGCGCGTCTCGGGG - Intergenic
1148337432 17:46851341-46851363 CCCCGGGCGGGCGCGGCGCCAGG + Intronic
1148419144 17:47531277-47531299 CACCGAGCGCGGGCGACCGCCGG - Exonic
1150764667 17:67993671-67993693 CCGTGAGCGCGCGCGTCGCGGGG + Intergenic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1152136122 17:78504718-78504740 TCCCCAGCAAGCGCGTCCCCCGG - Intronic
1153900633 18:9614555-9614577 CCCCTCCCGCGCGCGTCCACCGG - Exonic
1155508235 18:26550965-26550987 CCCGGAGCCAGCGCGGCCCCCGG - Intronic
1158725684 18:59969594-59969616 CCCCGAGCACGCGCACCTCCCGG - Intergenic
1160053232 18:75455888-75455910 CCCCGCGCTCGCGGGTTCCCGGG - Intergenic
1160499661 18:79395639-79395661 CCCCGGGCGCCCCCCTCCCCGGG + Intergenic
1160500706 18:79400118-79400140 CCTCGCGCGCGCGCGACCGCAGG - Intronic
1160719369 19:590614-590636 CCCCGCGCGCCCGGCTCCCCGGG - Intronic
1160725696 19:616929-616951 CCCCGTCCGCGCGCGTCCCCCGG + Exonic
1161153609 19:2721467-2721489 CCCCGTGGGCGCGGGTCCCCGGG - Intronic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161498128 19:4598396-4598418 ACCTGACCGCGTGCGTCCCCGGG + Intergenic
1162095657 19:8308342-8308364 CCCCGCGCGTGCGCGTGCGCAGG - Exonic
1162393827 19:10404892-10404914 GTCCGTGCGCGCGCGTGCCCGGG - Intronic
1163154523 19:15432606-15432628 CCCCGCGGGCGCGCGCTCCCGGG + Intronic
1164989653 19:32674893-32674915 GCCCCAGCCCCCGCGTCCCCAGG - Intronic
1165157022 19:33795430-33795452 CCCCGAGCGCCCCCCACCCCGGG + Intergenic
1167072773 19:47230537-47230559 CCCCCAGCGGGCGCGCGCCCTGG + Intronic
1167508697 19:49884382-49884404 CCCCGGCCACGCCCGTCCCCAGG - Intronic
1167578295 19:50328195-50328217 CCCCGAGAGCGCGCTCACCCTGG + Exonic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
926580891 2:14632509-14632531 ACCCGACCGCGCGCCGCCCCGGG - Intergenic
927751261 2:25673089-25673111 CCCCGCTCGCGCCCGTGCCCCGG + Intronic
929647049 2:43637745-43637767 CCCTGACCGCGCGGGTCCCTCGG - Intronic
930798698 2:55420047-55420069 TCCCGAGCGAGCGCGCCCCCGGG + Intergenic
932812284 2:74835074-74835096 CCGCGAGCGCGGACGGCCCCCGG - Intronic
934846359 2:97663680-97663702 CCAAGAGGGCGCGCGCCCCCGGG + Intronic
942284017 2:174395814-174395836 CCCCGTGCGCGCCCCTCACCTGG - Exonic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948402003 2:237691744-237691766 CCCGGAGCGCCCGCTTCCCACGG + Intronic
948805757 2:240452973-240452995 CCCAGAGCCCGCGCGCCGCCCGG + Intronic
948906797 2:240983521-240983543 CACCGAGCGGGCGCGTCTGCAGG + Intronic
1169143838 20:3239954-3239976 CCCCGAAAAGGCGCGTCCCCGGG - Intergenic
1171173646 20:23035598-23035620 CCCGCCGCCCGCGCGTCCCCGGG - Exonic
1172529205 20:35618618-35618640 CCACGAGCGCGTGCGCTCCCAGG + Exonic
1173827595 20:46057627-46057649 GCCCGAGCGCGCCCGGCCCGCGG + Exonic
1174649302 20:52111008-52111030 CACCAAGCGCGCCCTTCCCCTGG - Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175998329 20:62821195-62821217 CCCCCAGCCCGGGCGGCCCCGGG - Exonic
1176068896 20:63215964-63215986 ACCCTAGCTCGCGCGGCCCCGGG + Exonic
1176418948 21:6499088-6499110 CCCCGATCGCGCCCAACCCCCGG + Intergenic
1179694441 21:43107410-43107432 CCCCGATCGCGCCCAACCCCCGG + Intronic
1181760794 22:25057441-25057463 CCTGGCGTGCGCGCGTCCCCTGG + Intronic
1182036492 22:27202750-27202772 CCCCGAGAGCACCCCTCCCCGGG + Intergenic
1182222885 22:28772796-28772818 CCTCGGCCGCCCGCGTCCCCAGG - Exonic
1183393809 22:37560595-37560617 GCCCGGGCGCGCGGGTCCTCGGG + Intronic
1184698128 22:46150806-46150828 CCCCGGGCCCCCGGGTCCCCGGG - Intronic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
966378835 3:179323335-179323357 GCCCGCACGCCCGCGTCCCCTGG - Intronic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
972418805 4:38867871-38867893 CCCCGCGCTCGCCCGCCCCCCGG - Intronic
973931072 4:55793695-55793717 CCCCGGGCGGGCGCGGCCTCAGG + Intergenic
980158471 4:129133548-129133570 CCCTGAGGGCGCTCTTCCCCTGG - Intergenic
981429844 4:144646008-144646030 CCCCGCGCGAGCGCGTCCCCCGG - Exonic
982033629 4:151325254-151325276 GCCCGAGAGCGCACGGCCCCGGG + Intronic
982484756 4:155953689-155953711 TACCGAGCGCGCGCCTCCCCGGG - Intronic
984714965 4:182917182-182917204 CCCCCAGCGTCCGCGGCCCCAGG + Intronic
985653978 5:1120434-1120456 TGCCGACGGCGCGCGTCCCCCGG - Intergenic
987340549 5:16935907-16935929 CCCCGCGGGCGCGCGTCCTCGGG - Exonic
993901237 5:93585195-93585217 CCCGGAGCGCCCGCCACCCCCGG + Exonic
997282399 5:132657000-132657022 CCCCGAACCAGCGCCTCCCCAGG - Intronic
997302049 5:132813551-132813573 CCCCGCTCCCGCGCGTCCCGCGG + Intergenic
1002508668 5:179698686-179698708 CGCCGGGCGCGCGCGTCTCGGGG - Intronic
1002521759 5:179796267-179796289 ACGCGAGCGCGCGCGCCCTCTGG + Exonic
1002559595 5:180072195-180072217 CCCCGAGCGCATGCGTGCCAGGG + Intergenic
1002632321 5:180590371-180590393 CCGCGCGGGTGCGCGTCCCCCGG - Intronic
1004722204 6:18277460-18277482 CCCCGAGCGCGCGCGCGCCTTGG + Intergenic
1006136202 6:31897567-31897589 GCACGGGCGCGCGCTTCCCCCGG + Intronic
1006931118 6:37689077-37689099 CCCCGAGCTCCCCAGTCCCCCGG + Intronic
1007320944 6:41028408-41028430 CCCCGAGCGCGGGGGCGCCCGGG - Exonic
1007775706 6:44223420-44223442 CCCCGAGCCCCTGCGCCCCCAGG - Intronic
1011277301 6:85643347-85643369 GCCCGCGGGCGCGCGTCCCGAGG - Intronic
1018612914 6:165661712-165661734 CCCCGAGCGCTCGCGGAGCCTGG + Intronic
1019421975 7:954788-954810 CCCCCAGCCCGCGCGCCCCGGGG + Intronic
1019828371 7:3301721-3301743 CCCGGAGCCCTCGCGACCCCGGG + Exonic
1020274402 7:6615763-6615785 CCCCGAGGACCCGCGTCGCCTGG + Exonic
1021992690 7:26152774-26152796 CCCCGAGCGCGCGCACCTCCCGG - Exonic
1023629428 7:42148872-42148894 CCCGGAGGCCCCGCGTCCCCAGG - Intronic
1029390680 7:100272044-100272066 CGCCGAGCTCCCGGGTCCCCGGG - Exonic
1034342668 7:150368518-150368540 TGCGGAGCACGCGCGTCCCCGGG - Intronic
1034435072 7:151059578-151059600 CCCCCTGCGTGCGCGCCCCCCGG - Intronic
1035570829 8:671269-671291 CACTGAGCGCGCTGGTCCCCAGG + Intronic
1039911130 8:41828080-41828102 CCCTGAGCGCTCGCGGCCCTGGG - Intronic
1041059393 8:54021921-54021943 CCCGCCGCGCCCGCGTCCCCGGG - Intronic
1042858952 8:73294686-73294708 CCCCGAGGGCTCGCGTTCCCCGG - Exonic
1044692871 8:94896180-94896202 CCCTGAGCGCGGTGGTCCCCGGG + Intronic
1047739396 8:127794571-127794593 CCCCGAGCCCGCCCGGCCCGCGG - Intergenic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1053410676 9:37914435-37914457 CCCCGAGCACAGGCGTTCCCCGG + Intronic
1055266267 9:74498630-74498652 GCCCGAGCCCGCGCGGCCCAGGG + Intronic
1061415576 9:130445236-130445258 CCCCGGGGGCGCGAGTCCCCGGG + Intronic
1061976004 9:134068225-134068247 CCCCGCCCCCGCGCGCCCCCCGG - Intronic
1062551034 9:137086597-137086619 CCCCGCCCGGGCGCCTCCCCGGG + Intergenic
1199772779 X:150984540-150984562 CCCCGGCCCCGCGCGTCCCCCGG + Intronic
1200249885 X:154547181-154547203 CCGCGAGCGCGCGAGGCCGCCGG - Exonic