ID: 1118810145

View in Genome Browser
Species Human (GRCh38)
Location 14:69267201-69267223
Sequence AAGGCGCATCTGAAGTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118810145_1118810148 -9 Left 1118810145 14:69267201-69267223 CCCCTAAACTTCAGATGCGCCTT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1118810148 14:69267215-69267237 ATGCGCCTTTGAACTGTATCTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1118810145_1118810150 6 Left 1118810145 14:69267201-69267223 CCCCTAAACTTCAGATGCGCCTT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1118810150 14:69267230-69267252 GTATCTGGCTAGAGACAGTATGG 0: 1
1: 0
2: 0
3: 6
4: 86
1118810145_1118810151 15 Left 1118810145 14:69267201-69267223 CCCCTAAACTTCAGATGCGCCTT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1118810151 14:69267239-69267261 TAGAGACAGTATGGTCACCCAGG 0: 1
1: 0
2: 0
3: 16
4: 151
1118810145_1118810152 16 Left 1118810145 14:69267201-69267223 CCCCTAAACTTCAGATGCGCCTT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1118810152 14:69267240-69267262 AGAGACAGTATGGTCACCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118810145 Original CRISPR AAGGCGCATCTGAAGTTTAG GGG (reversed) Intronic
902456199 1:16535590-16535612 AAGGCGCATCTCTAGTCCAGTGG - Intergenic
902495966 1:16872321-16872343 AAGGCGCATCTCTAGTTCAGTGG + Intronic
904095057 1:27970485-27970507 CAGAGGCATCTGAAGTTCAGAGG + Exonic
913071510 1:115303193-115303215 AAGGCACATGTGATGTTTATGGG + Intronic
916577823 1:166082786-166082808 AAGGCTCTTCTGGAGTCTAGGGG + Intronic
919022801 1:192129920-192129942 CAGGTGCAACTGAAGTTCAGAGG + Intergenic
923379318 1:233399181-233399203 AAAGCCCATCTGAAATTAAGAGG - Intergenic
1063201939 10:3792591-3792613 GAGGCACAACTGATGTTTAGTGG + Intergenic
1067171164 10:43907095-43907117 AATGCTCATTTGAAGTTTATTGG - Intergenic
1069711587 10:70492816-70492838 AAGGAGCATCTGTACTTTAAAGG + Intronic
1076560559 10:131360511-131360533 AAGGCTCATCTGCACTTGAGGGG + Intergenic
1080772072 11:35350891-35350913 AAGGTGTATTTAAAGTTTAGGGG - Intronic
1084541414 11:69789286-69789308 AAGCCGCATCTCAGGCTTAGAGG - Intergenic
1085853127 11:80144446-80144468 ATGAGGAATCTGAAGTTTAGAGG - Intergenic
1094767310 12:33611854-33611876 AAGGGTCATCGAAAGTTTAGTGG + Intergenic
1099573453 12:84355040-84355062 GAGGCGCATCAGAAATTTAGAGG - Intergenic
1106666359 13:31855151-31855173 AAGGCCTATCTGAAATTTATTGG - Intergenic
1111095285 13:83505891-83505913 ATGGCTCATCTGGAGTTTAGGGG + Intergenic
1118810145 14:69267201-69267223 AAGGCGCATCTGAAGTTTAGGGG - Intronic
1120444231 14:84573603-84573625 AAGGAGCACCTGAAGCTCAGTGG + Intergenic
1122022940 14:98854212-98854234 AAGTGTCTTCTGAAGTTTAGCGG - Intergenic
1126389834 15:48135410-48135432 AATGAGCATCAGAAGTTTGGAGG - Exonic
1133622491 16:7539761-7539783 AAGCCTCATCTGAAGTTCACTGG - Intronic
1152981952 18:286860-286882 AAGGCTCATCTGGACTTTGGTGG + Intergenic
1157094474 18:44675081-44675103 AAGTCACATTTGGAGTTTAGGGG - Intergenic
1159539129 18:69753116-69753138 AAGAATCTTCTGAAGTTTAGGGG + Intronic
1159645228 18:70910385-70910407 AAGGAGCAGCTGAAGTTTGTTGG + Intergenic
1202707087 1_KI270713v1_random:31946-31968 AAGGCGCATCTCTAGTCCAGTGG - Intergenic
926110429 2:10179591-10179613 AAGAAGCATCTGAAGTTATGAGG - Intronic
931403961 2:61958032-61958054 AAGGCTCATTTTAAGTTCAGGGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936495735 2:113019297-113019319 AATGCATATCTGGAGTTTAGAGG + Intergenic
942812519 2:180015876-180015898 AAGTAGCATCTGAACTTTACAGG - Intergenic
942958885 2:181806088-181806110 AAGGAGGGTCTGAAGTTTACAGG + Intergenic
943842083 2:192596322-192596344 ATGGTGGAACTGAAGTTTAGAGG + Intergenic
1181419471 22:22787941-22787963 AATACACAACTGAAGTTTAGTGG + Intronic
1181808733 22:25390911-25390933 AAGGGGCCTCTGAAGTGGAGGGG - Intronic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
954450454 3:50568854-50568876 AAGGCGCAACTGAGGTCCAGAGG + Intronic
957699151 3:83687005-83687027 CAGGCACATCTGAGGTCTAGGGG - Intergenic
960048632 3:113220515-113220537 AAGGCACTTCTCACGTTTAGAGG - Intronic
960604932 3:119495687-119495709 AATGTGGATCTGGAGTTTAGAGG + Intergenic
975057526 4:69953129-69953151 AAGGGGCAACTGCAGTTTGGAGG + Intergenic
977448696 4:97165741-97165763 AAGGCACAAATGCAGTTTAGTGG - Intergenic
981672340 4:147301349-147301371 AAGGTGCATTTGAAGGTAAGTGG - Intergenic
982028683 4:151277516-151277538 AAGGGGCATCTGAAGTACAGGGG + Intronic
988395022 5:30686158-30686180 AAGAAAGATCTGAAGTTTAGAGG - Intergenic
992542067 5:77775768-77775790 AAGCAGGCTCTGAAGTTTAGGGG - Intronic
999634468 5:153606201-153606223 AAGATGCCACTGAAGTTTAGTGG - Intronic
1011505928 6:88044048-88044070 TAGGTGCATCTGATGTTTAGTGG + Intergenic
1012165363 6:95943485-95943507 AAGTCTCATGTGAAGTTTAAAGG + Intergenic
1013842808 6:114418449-114418471 AGGGCGCATCTTGAGTTTAATGG - Intergenic
1014987698 6:128032181-128032203 AAAGGGCATCTGAAGGTGAGAGG - Intronic
1017936300 6:159008337-159008359 GATGCGAATCTGAAGTTCAGTGG + Intergenic
1022409327 7:30125431-30125453 AAGGAGCATCTGGACTTTAGAGG + Intronic
1024580299 7:50795534-50795556 CAGGGGCATCTGGAGTTTGGGGG - Intergenic
1026789939 7:73324883-73324905 AAGGAGCACCAGAATTTTAGAGG + Intronic
1028126818 7:87122535-87122557 AAGTAGCATCTGTAGTGTAGTGG - Intergenic
1032223771 7:130013997-130014019 AAGGAGAATCTGAAGTTTGGGGG + Intergenic
1034065098 7:148128835-148128857 AAGCCACCTCTGAAGTGTAGTGG - Intronic
1034253604 7:149712910-149712932 AAGGCGCAACTAAAATTTGGGGG + Intergenic
1036088492 8:5638944-5638966 AGAGCTCATCTGAAGTTTACAGG - Intergenic
1039282481 8:36001134-36001156 AAGGAGCATCTGATTTTTGGTGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056124319 9:83520222-83520244 AGGGAGCATCTGAAGTCCAGGGG - Intronic
1057693297 9:97306418-97306440 CAGGCACATCTGTAATTTAGGGG - Intergenic
1194786775 X:98095298-98095320 ATGGGGCATATGAAGTATAGTGG - Intergenic
1195083159 X:101389683-101389705 CAGGGGCATCTGCAGTGTAGAGG - Intronic
1196506425 X:116449628-116449650 AAGGTGTATCTGAAGTGAAGAGG + Intronic