ID: 1118815701

View in Genome Browser
Species Human (GRCh38)
Location 14:69312402-69312424
Sequence GGCCCCAAGAAACACCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118815701_1118815703 -8 Left 1118815701 14:69312402-69312424 CCCAGAGGGTGTTTCTTGGGGCC 0: 1
1: 0
2: 0
3: 16
4: 122
Right 1118815703 14:69312417-69312439 TTGGGGCCTCAGTTGCCTTGAGG 0: 1
1: 0
2: 1
3: 30
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118815701 Original CRISPR GGCCCCAAGAAACACCCTCT GGG (reversed) Intronic
902639314 1:17756303-17756325 GTCCCCAAGAAAGAGCCCCTGGG - Intronic
904750993 1:32741595-32741617 GGCCCCACGACCCGCCCTCTCGG + Intergenic
905370562 1:37480483-37480505 CTCCCCAAGAGAGACCCTCTGGG + Intronic
907247916 1:53119966-53119988 GGCCCCAGGGAAGAGCCTCTGGG + Intronic
908514309 1:64876290-64876312 GGGCCCAACAAACTCCCTCTGGG + Intronic
911152592 1:94609585-94609607 TGCTCCAAGAATCATCCTCTGGG - Intergenic
915047799 1:153033085-153033107 TGCCCAAAGCAACAGCCTCTAGG - Intergenic
915681869 1:157589282-157589304 GACCCCAGGAAACACCCTCGAGG - Exonic
918232847 1:182551300-182551322 GGCTCCAGCAAACACCCTCAAGG - Intronic
918602144 1:186375882-186375904 GGGCCCAAGTACCAGCCTCTAGG - Exonic
919097360 1:193054238-193054260 AGCCCCAAGAAAAACACTCGTGG + Intronic
919640820 1:200042091-200042113 AGCCCCAAGAGACCCCCACTAGG - Intronic
920283224 1:204859621-204859643 GGACCCAAGACCCAGCCTCTGGG - Intronic
922477292 1:225915475-225915497 GGTCCTAAGAGACACCCACTGGG + Intronic
922561755 1:226574838-226574860 GACCCCGAGACACGCCCTCTGGG - Intronic
924096999 1:240562582-240562604 GACACCAAGAAACACCATCTTGG + Intronic
1063164993 10:3453615-3453637 GTCCCCAAGAAAAACCCTTGAGG - Intergenic
1067567536 10:47349656-47349678 GGCCCACAGAAACTCCTTCTTGG + Exonic
1067777189 10:49172219-49172241 GGCCCCCTGGAACACCCTATAGG - Intronic
1067896450 10:50185706-50185728 TGCCCAAGGAAACAGCCTCTAGG + Exonic
1067952523 10:50756321-50756343 GGCCCAAGGAAACAGCCTCTAGG - Intronic
1068797598 10:61101328-61101350 GACCCCAAGAAAATCCCTTTGGG - Intergenic
1072614734 10:97042100-97042122 CACCCCAAGAAACACCATCAGGG - Intronic
1075534883 10:123262558-123262580 TGCCCCTAGTAATACCCTCTTGG + Intergenic
1076109750 10:127851411-127851433 GTCCCCATGAAGCATCCTCTGGG - Intergenic
1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG + Intergenic
1078416026 11:11165499-11165521 GGCACGTAGAACCACCCTCTGGG - Intergenic
1079083048 11:17427442-17427464 GGTCCCAAGAAACACCATCCTGG + Intronic
1081989728 11:47331483-47331505 GGCCTCAAGAAACAATGTCTGGG - Exonic
1083544450 11:63538241-63538263 GGGCCCAGGACACACCCTGTGGG - Intronic
1087014082 11:93539623-93539645 AGTCACAACAAACACCCTCTTGG + Intronic
1089677213 11:120098099-120098121 GGCCCCAAGGAGGAGCCTCTTGG - Intergenic
1090428867 11:126629420-126629442 GGCCCCATAAAACACCCCTTTGG - Intronic
1096451821 12:51749271-51749293 GGCACCAAGAAAATTCCTCTAGG - Intronic
1106913484 13:34487792-34487814 GGACCCAAGAAACTACCTCAAGG + Intergenic
1107812084 13:44210236-44210258 GGCCTCAGGTAACACCTTCTTGG - Intergenic
1110766017 13:79280056-79280078 GGCCTCAAGAAACACGATCATGG - Intergenic
1112008325 13:95273365-95273387 GGTCCCAAATAACACCCTCTAGG + Intronic
1112237477 13:97649369-97649391 GGACCCAAGAACTTCCCTCTGGG - Intergenic
1113594796 13:111523607-111523629 AGCCCCACCAAAGACCCTCTAGG - Intergenic
1115975298 14:38990485-38990507 GGCTTCAAGAAAAATCCTCTGGG - Intergenic
1118815701 14:69312402-69312424 GGCCCCAAGAAACACCCTCTGGG - Intronic
1119387610 14:74267627-74267649 GCCCCCAAGACCTACCCTCTGGG + Intergenic
1123070082 14:105638408-105638430 GGTCCCGAGAAAGACCCTCCTGG - Intergenic
1123089320 14:105735195-105735217 GGTCCCGAGAAAGACCCTCCTGG - Intergenic
1123095107 14:105763352-105763374 GGTCCCGAGAAAGACCCTCCTGG - Intergenic
1123675242 15:22704261-22704283 GGGAACAAGAAACAACCTCTGGG + Intergenic
1124327245 15:28777258-28777280 GGGAACAAGAAACAACCTCTGGG + Intergenic
1127770897 15:62229997-62230019 AGTCCCAAGAAACACCCTTGAGG - Intergenic
1128983149 15:72200698-72200720 GGCCCCAGGAAGTACCCTCAGGG + Intronic
1129927156 15:79374852-79374874 GACCCCAAGAAACACAGTCTAGG + Intronic
1130110363 15:80959049-80959071 GGCTCCAAGAGAACCCCTCTTGG + Intronic
1135569308 16:23536069-23536091 GGCCCCTAGCATCAGCCTCTTGG + Intronic
1136686411 16:31997203-31997225 GCCCCCAAAACACACCCTCCTGG - Intergenic
1136882750 16:33913057-33913079 GCCCCCAAAACACACCCTCCTGG + Intergenic
1137602325 16:49764655-49764677 GGCTCCAAGGATCAACCTCTTGG + Intronic
1203089261 16_KI270728v1_random:1202402-1202424 GCCCCCAAAACACACCCTCCTGG - Intergenic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1143099438 17:4497433-4497455 GGCGCCAAGAAACACCAGCTTGG + Intergenic
1143787337 17:9265793-9265815 GCCCCCAACAAACACACACTAGG - Intronic
1146279570 17:31536548-31536570 GGACCCAGGAAATCCCCTCTAGG + Exonic
1147147370 17:38492872-38492894 GCCCCCAAAACACACCCTCACGG - Intronic
1147457794 17:40549186-40549208 GGCCACAGAAAACACCCTCTGGG + Intergenic
1148676732 17:49449966-49449988 GTCACCCAGAAACACCCTCACGG - Intronic
1152621870 17:81368877-81368899 GACCACAAGACACACCCTCTGGG - Intergenic
1153153389 18:2121614-2121636 AGCCCCAAGAGACACCCTTAGGG + Intergenic
1156957631 18:42987787-42987809 GGCCTCAGGAAACACACTCATGG + Intronic
1157301834 18:46484945-46484967 GACCCCGAGAATCTCCCTCTTGG - Intronic
1161587483 19:5113508-5113530 GGCCCCAAGATATGCCCTCAGGG - Intronic
1164707962 19:30334446-30334468 GACCCCAAGAAACAGAATCTTGG + Intronic
1164708226 19:30335976-30335998 GACCCCAAGAAGCAGCATCTTGG + Intronic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1168422002 19:56210433-56210455 GGCCACAAAATACACCATCTGGG - Intergenic
1168423468 19:56220321-56220343 GGCCACAAAATACACCATCTGGG + Exonic
925090385 2:1150484-1150506 GCCCCCAGGGAAGACCCTCTGGG - Intronic
925936139 2:8763195-8763217 GGCCCCAAGAAACAGACTTGGGG + Intronic
927843813 2:26461253-26461275 GACCCCAGGAGAGACCCTCTGGG - Intronic
932144761 2:69307315-69307337 GGACCCAAGGGACACCCTGTGGG - Intergenic
936373207 2:111920006-111920028 AGCCCCAAGAAGCAGCCTGTGGG + Intronic
937510169 2:122586677-122586699 GGCAGCAAGAAAAACCCTCCTGG - Intergenic
942118960 2:172757855-172757877 GTGCCAAAGAAACACCTTCTAGG + Intronic
945411553 2:209515432-209515454 GGCCCCAGGAAACACAATCATGG + Intronic
1169740177 20:8884901-8884923 GACCCCAAGAAATAACCGCTGGG - Intronic
1171240949 20:23566582-23566604 GGCTTCAAGAAACACCATCTGGG + Intronic
1172301363 20:33852781-33852803 GGCCCCTAGAGACAGCCCCTGGG + Intronic
1174008458 20:47429056-47429078 GGCCCCAAGGAACAGTCTCTGGG - Intergenic
1175909267 20:62396908-62396930 GGCCCCAAGCAACACCCTGCTGG + Intronic
1176144344 20:63558997-63559019 GGTCCCAAGGAAGCCCCTCTTGG + Intronic
1176385530 21:6137137-6137159 GGCCCCCAGAAACAACCTTGGGG + Intergenic
1178725181 21:35045050-35045072 GCCCCAAAGAAACCTCCTCTTGG - Intronic
1178760163 21:35394568-35394590 GTCCCCAAGATACCCTCTCTTGG + Intronic
1179181255 21:39047135-39047157 GGCCACAAGAATGACTCTCTAGG + Intergenic
1179545448 21:42110071-42110093 GGCTCCAGGCCACACCCTCTCGG - Intronic
1179737943 21:43401115-43401137 GGCCCCCAGAAACAACCTTGGGG - Intergenic
1183002854 22:34876044-34876066 GACCACAAGAAAAACCCTCATGG + Intergenic
950959884 3:17094374-17094396 GGCCCCGTTAAACACCCTCATGG - Intergenic
954656204 3:52195781-52195803 GGCCCAAAGAACCACCCCCAGGG - Intergenic
955494602 3:59518746-59518768 TGCCACAAGGAACACTCTCTGGG - Intergenic
956837791 3:73109876-73109898 GGCCCCAAGAAACATCTTTGCGG + Intergenic
956837805 3:73109935-73109957 GGCCCCAAGAAACATCTTTGCGG + Intergenic
958965091 3:100550014-100550036 TGCCACAATAAACACACTCTGGG + Intronic
959337616 3:105086012-105086034 AGTCCAAAGAAACATCCTCTTGG + Intergenic
961565059 3:127757734-127757756 GGGGTCAAGAAACACTCTCTCGG - Intronic
966845958 3:184130057-184130079 GGCCCCAAGACTTACCCTCAAGG + Intergenic
966867493 3:184267231-184267253 GGGCCCTAGAAATACCCTCATGG - Intronic
967120546 3:186378825-186378847 GGCCACCAGCAACACCTTCTAGG - Intergenic
973793098 4:54395956-54395978 GACACCCAGAAAGACCCTCTGGG - Intergenic
975112425 4:70642645-70642667 GGGCCAAATAAACACCCTGTAGG + Exonic
976074635 4:81284016-81284038 GGCTCCAAGCCACACCCTTTGGG - Intergenic
976638502 4:87312163-87312185 GGGCCCAATAAAAACCCTCTTGG - Intronic
977324824 4:95562061-95562083 GAACACAAGAAACACCCTTTGGG - Intergenic
978256107 4:106694468-106694490 GGCCTCAAGAAACACAATCTTGG - Intergenic
981588287 4:146328116-146328138 AGCACCAACATACACCCTCTAGG + Intronic
985703169 5:1385921-1385943 CGCCCCAAGGAACGCCCTGTGGG - Intergenic
989716405 5:44468347-44468369 GGCCCCAAGAGGCACCTTGTTGG + Intergenic
991562830 5:67972597-67972619 GGCCTCAGGAAACACAATCTTGG + Intergenic
994545054 5:101155724-101155746 GGCCCCAGGAAACACAATCATGG + Intergenic
1006525428 6:34600517-34600539 GGCCACAAGATACAGTCTCTGGG - Intronic
1006807185 6:36796337-36796359 GGTGACAGGAAACACCCTCTGGG - Intronic
1013299745 6:108793754-108793776 GGCCCCAAGTAAAACATTCTGGG + Intergenic
1018640442 6:165899663-165899685 GGCCCCAGGTACCACCCTTTAGG - Intronic
1019308381 7:347092-347114 CCCTCCCAGAAACACCCTCTAGG + Intergenic
1019497118 7:1345883-1345905 GGACCCCAGTGACACCCTCTGGG - Intergenic
1019800305 7:3083441-3083463 GGCACCAAGGAACTCACTCTGGG + Intergenic
1029482087 7:100819542-100819564 GCCCCCAAGTCTCACCCTCTCGG + Exonic
1031977098 7:128101062-128101084 GGCCCCAGTAAACTCCATCTCGG - Intergenic
1032192618 7:129773318-129773340 GCCCCCAATAAATTCCCTCTGGG - Intergenic
1037207369 8:16339389-16339411 GGTGCCAAGAAAACCCCTCTAGG - Intronic
1049780592 8:144426931-144426953 GATCCCATGAAACATCCTCTAGG + Exonic
1050461158 9:5878693-5878715 TGCTCCAAGAAACACTCTTTGGG - Intergenic
1057034978 9:91805360-91805382 GACCCCAAGACACAGCCTCATGG + Intronic
1061979211 9:134090516-134090538 GGCCCCAAAAGACACCCTCCTGG + Intergenic
1062009527 9:134259483-134259505 GGCCCTTGGAAACACCCTCATGG - Intergenic
1062723694 9:138059018-138059040 AGCCCCAAGACACCCCATCTGGG - Intronic
1185866904 X:3632218-3632240 GGCCCAAAGAGATACCCTATTGG - Intronic
1195587992 X:106587937-106587959 GGACCCATGATTCACCCTCTTGG + Intergenic
1196068468 X:111492140-111492162 GGCCTCAGGAAGCACACTCTAGG - Intergenic
1197220488 X:123907980-123908002 GGCCCCTATAAAACCCCTCTGGG - Exonic
1200797091 Y:7350724-7350746 GGCCCAAAGAGATACCCTATTGG + Intergenic