ID: 1118815988

View in Genome Browser
Species Human (GRCh38)
Location 14:69314372-69314394
Sequence GCCAGGGCTTTGAACTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118815988_1118815995 28 Left 1118815988 14:69314372-69314394 CCATGAGAGTTCAAAGCCCTGGC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1118815995 14:69314423-69314445 GGCAATGTGCAGCAGAAGATGGG 0: 1
1: 0
2: 0
3: 15
4: 125
1118815988_1118815994 27 Left 1118815988 14:69314372-69314394 CCATGAGAGTTCAAAGCCCTGGC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1118815994 14:69314422-69314444 AGGCAATGTGCAGCAGAAGATGG 0: 1
1: 0
2: 0
3: 22
4: 272
1118815988_1118815992 7 Left 1118815988 14:69314372-69314394 CCATGAGAGTTCAAAGCCCTGGC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1118815992 14:69314402-69314424 TTCTATAATTGCCACTTTTGAGG 0: 1
1: 0
2: 0
3: 24
4: 279
1118815988_1118815996 29 Left 1118815988 14:69314372-69314394 CCATGAGAGTTCAAAGCCCTGGC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1118815996 14:69314424-69314446 GCAATGTGCAGCAGAAGATGGGG 0: 1
1: 1
2: 1
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118815988 Original CRISPR GCCAGGGCTTTGAACTCTCA TGG (reversed) Intronic
900358292 1:2275228-2275250 GCCACTGCTCTGACCTCTCAGGG - Intronic
904330409 1:29754758-29754780 GCCTGGGCTGTGAGCTCTCCAGG - Intergenic
908804880 1:67919843-67919865 ACCAGGGCTTGGAAGTTTCAGGG + Intergenic
911678240 1:100683733-100683755 CCCAGGCCTATGAAGTCTCAGGG - Intergenic
913443674 1:118926575-118926597 GCCAGTGATTTTCACTCTCATGG + Exonic
916328624 1:163591739-163591761 GACAGGGGATTGATCTCTCAAGG - Intergenic
916644448 1:166769084-166769106 GCCAAGGCTTAGCAATCTCATGG - Intergenic
916888231 1:169091171-169091193 GCCTGGGCTTGGGGCTCTCATGG + Intergenic
918568013 1:185953708-185953730 GACAGGGGATTGAACTCCCAAGG + Intronic
920435988 1:205947535-205947557 GCCAGGGTCTTGATCTCCCAAGG - Intergenic
923962168 1:239098034-239098056 GTCAGGGCTCTCAGCTCTCATGG - Intergenic
1062834801 10:628663-628685 GGCAGTGCTTTGAGCTCTAATGG + Intronic
1065793019 10:29278936-29278958 GCCAGGGGTTTGAACTGTGTGGG + Intergenic
1067221622 10:44348106-44348128 TCCAGGGCATGGAGCTCTCAGGG - Intergenic
1073003135 10:100300149-100300171 GCCAAGGCCTTGAACTCTAGAGG - Intronic
1074875895 10:117613218-117613240 GCCAGGCCTTCCATCTCTCAGGG + Intergenic
1075170093 10:120105196-120105218 GCCAGGGCCTTGTCCTCTCAGGG + Intergenic
1075601836 10:123775099-123775121 GCCAGGACTTTGGCCTTTCAGGG + Intronic
1077108939 11:853671-853693 ACCAGTGCTCTGAACTCTGAAGG - Intronic
1077452941 11:2661877-2661899 GCCAGGCCTGTGAGCTCCCAGGG - Intronic
1081744263 11:45462049-45462071 GCCCTGGCTTTGTGCTCTCAGGG + Intergenic
1086011265 11:82106364-82106386 GGCAGGGCTTAAAACTCACAGGG - Intergenic
1086677802 11:89630598-89630620 TTCAGGGCTTTGAGCTCTGAAGG + Intergenic
1087220662 11:95543138-95543160 GCCAGTGCTTTGCCCTCACAGGG - Intergenic
1088607981 11:111549552-111549574 ACAAAGGCTTTGAAGTCTCAGGG + Intronic
1090674600 11:128978778-128978800 GCCATGGCTTTCATCTCTGAAGG + Exonic
1090821960 11:130350524-130350546 GCCTGGCCTCTGAACTCTTATGG + Intergenic
1091424742 12:377439-377461 CCCAGGGCTTTGAAATTTCACGG - Intronic
1091651101 12:2310689-2310711 GCAAGGGCTTTCGACTCACAGGG + Intronic
1102005278 12:109585793-109585815 GCCTGGGCTTTGGACTCCCGTGG - Intronic
1102015831 12:109647390-109647412 TCCATGGCTTTGAACTTTCTAGG - Intergenic
1102315990 12:111888082-111888104 GTCAGGGCTCTGAGCTGTCAGGG + Intronic
1102648013 12:114416131-114416153 GCCAGGTCTGTGAACCCTCGGGG - Intergenic
1104423443 12:128655770-128655792 GCCAGGGACTTGACTTCTCATGG + Intronic
1105059187 12:133132633-133132655 GCCAGGGCTTTTAATTCTTCTGG + Intronic
1105841092 13:24254196-24254218 GCCAGGACTGTGAACTCTGGAGG + Intronic
1107118032 13:36767976-36767998 GGCAGGGATTTGGACTTTCAAGG + Intergenic
1109030557 13:57183187-57183209 CCCAGGTATTTGAACTCTCCTGG - Intergenic
1110080609 13:71305676-71305698 GCTATGGCTTTGACCTCTCCAGG - Intergenic
1110305585 13:73983711-73983733 GCCAGGGCTTTGTGGCCTCAGGG - Intronic
1110850115 13:80235612-80235634 GTGAGGGTTTTGAAGTCTCAAGG + Intergenic
1112201370 13:97279218-97279240 GCAAGGGCTTTGAAATCAGAAGG + Intronic
1113925572 13:113939755-113939777 GCCAGGGCACTGACCTCTCTGGG + Intergenic
1118815988 14:69314372-69314394 GCCAGGGCTTTGAACTCTCATGG - Intronic
1118937617 14:70301483-70301505 GACAGGGGATTGATCTCTCAAGG + Intergenic
1122035866 14:98949070-98949092 TCCAGTGCTTTGAAATCTCCTGG + Intergenic
1122706327 14:103624357-103624379 CCCAGGGCTCTGTTCTCTCAGGG + Intronic
1124986510 15:34621655-34621677 GACAGGGATTAGAACTCTCTTGG + Intergenic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126531575 15:49716487-49716509 GTCAGGGCCTGGAATTCTCAAGG - Intergenic
1126666580 15:51080948-51080970 GCCCTGCCTTTGAATTCTCAAGG - Intronic
1127085107 15:55417213-55417235 GCCAGGGGTTAGATCTCTTAGGG - Intronic
1127854291 15:62941814-62941836 TCCAGGGCTGTGGACTGTCAGGG + Intergenic
1128233535 15:66051726-66051748 ACCAGGGCTTAGAACTCAGAGGG + Intronic
1129383161 15:75180573-75180595 GCCAGGGCTCTGAGAACTCAAGG + Intergenic
1129674735 15:77626408-77626430 GAGAGGGCTTTGAACTGCCAGGG - Intronic
1129704288 15:77785586-77785608 TCCAGGGCTGGGACCTCTCAGGG + Intronic
1131469444 15:92683595-92683617 GCCAGGCTTTTGAAGTCTGATGG - Intronic
1132154527 15:99486345-99486367 GCCAGGGATTTGCACGCTCGGGG - Intergenic
1133821958 16:9244907-9244929 TCCAAGTCTTTAAACTCTCAGGG + Intergenic
1134625723 16:15721193-15721215 GGCTGGGGTCTGAACTCTCAGGG - Intronic
1136743309 16:32559615-32559637 TTCAGGGCTTTCAACTCTGAAGG - Intergenic
1137412990 16:48244933-48244955 GCCAGTGCTTTTAACTTTCCAGG + Intronic
1137722391 16:50635111-50635133 CCCAGGGTTCTGCACTCTCATGG - Exonic
1138880780 16:61012511-61012533 GCCAGGGCTCTGCAATGTCAAGG - Intergenic
1139449234 16:67016807-67016829 GCCAGGTCTGGGAACTCACATGG + Intergenic
1141283138 16:82647040-82647062 GCCTGGGCTCTTAACTGTCATGG - Intronic
1203026290 16_KI270728v1_random:515614-515636 TTCAGGGCTTTCAACTCTGAAGG + Intergenic
1203045431 16_KI270728v1_random:818817-818839 TTCAGGGCTTTCAACTCTGAAGG - Intergenic
1143123440 17:4624688-4624710 GCCTGGCATTTGAATTCTCAAGG + Intergenic
1146239380 17:31202836-31202858 GCCAGGGCATTGTACCTTCAAGG + Intronic
1146611235 17:34306733-34306755 CCCACGGCTTTGAACTTGCATGG + Intergenic
1146689979 17:34866624-34866646 AACAGGGATTTGAAGTCTCAAGG + Intergenic
1147566725 17:41540939-41540961 GGCTGGGATTTGAACTCACAAGG + Intergenic
1147845940 17:43403892-43403914 GCCAGGTCTTTGTACTCCCAGGG + Intergenic
1152358526 17:79818623-79818645 GCCAGGTGTTTGACCTCCCAAGG + Intergenic
1152656672 17:81523139-81523161 GCCTCGCCTTGGAACTCTCAGGG - Intronic
1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG + Intronic
1153148948 18:2068028-2068050 GCCAGGGTTATGAACTCTGTGGG + Intergenic
1155872121 18:31042193-31042215 GTCTGTGCTTTGAGCTCTCAGGG + Intronic
1163075392 19:14886452-14886474 GCCAGTGCTTTGGAGACTCAAGG - Intergenic
1163703264 19:18797698-18797720 GCAAGGGCTGTGAACTTTCTGGG - Intergenic
1165026084 19:32962784-32962806 GCCAGGGCTGTGATGTCTCCAGG + Intronic
1167007079 19:46783039-46783061 GGCAGGGGTTTGACCTCACAGGG + Intronic
1168436558 19:56322437-56322459 GCGAGGGCTCTGAGCTCTGATGG - Intronic
1168480655 19:56717056-56717078 CCTATGGCTTTGAATTCTCATGG + Intergenic
926356465 2:12045221-12045243 GCCAGGGCTTTGGAATCTTCAGG + Intergenic
928601661 2:32909478-32909500 GCCAGGACTTTGATCTTCCAGGG - Intergenic
928750497 2:34465492-34465514 GCCTGGGCTTTGAAATCAAAGGG + Intergenic
929842284 2:45480421-45480443 GACAGTGATTTCAACTCTCATGG + Intronic
930253320 2:49060589-49060611 GCCAGGGCATTGACTTCCCAGGG - Intronic
931119728 2:59202943-59202965 GCCAGGGCACTGAACTCTTTGGG + Intergenic
932445166 2:71776318-71776340 GGCTGGGTTTTGAACTCTTACGG + Intergenic
937323811 2:120977023-120977045 TCCAGCGCTTTGAACTTCCAGGG - Intronic
940009289 2:149038095-149038117 ACCAGAGCTTTGAAAACTCAGGG - Intronic
940176359 2:150881503-150881525 CCCAGGGCAATCAACTCTCAAGG + Intergenic
942090011 2:172480567-172480589 ACCAGGTCTCTGACCTCTCAGGG - Intronic
943833261 2:192488274-192488296 GCCTGGACTTTAAACTCTCGAGG - Intergenic
946093281 2:217249536-217249558 GCAAAGGCTCTGTACTCTCAGGG - Intergenic
947092051 2:226522780-226522802 GCCAGGACTTTAAACTGTAAAGG - Intergenic
947586292 2:231358928-231358950 CCCAGGGCTATGAAGTCCCAAGG - Intronic
948117971 2:235507698-235507720 GGCAAGGCTTTAAACTCTCCAGG - Intronic
948393988 2:237631313-237631335 GGCAGGGCTTTGCACTCTTCTGG + Intronic
1168739118 20:173258-173280 GACAGGGGATTGATCTCTCAAGG - Intergenic
1169170029 20:3457499-3457521 CCCAGGCCTCTGGACTCTCAGGG - Intergenic
1171823624 20:29876240-29876262 GCCAGGGCTCTGGACTCTCCAGG - Intergenic
1173522648 20:43711120-43711142 GCCTGGGCTTTGAGCTGTCGGGG + Intronic
1173966715 20:47117988-47118010 GCCAGGCCTTTAAACTTCCAAGG - Intronic
1174917194 20:54665785-54665807 GTCAGAGCTTTAAAGTCTCAGGG - Intergenic
1175372818 20:58503942-58503964 TCCAGGACTTTGAACTTTAAGGG - Intronic
1175394050 20:58646479-58646501 GGCAGGGCTTTGAATGCCCAGGG + Intergenic
1176006066 20:62863083-62863105 GCAAGGACTTAAAACTCTCAAGG + Intergenic
1176026216 20:62986822-62986844 TCCAAGGCTCTGAACTCACAGGG - Intergenic
1176349643 21:5782308-5782330 GCCAGGGCTCAACACTCTCATGG + Intergenic
1176356457 21:5902892-5902914 GCCAGGGCTCAACACTCTCATGG + Intergenic
1176543964 21:8180378-8180400 GCCAGGGCTCAACACTCTCATGG + Intergenic
1176562915 21:8363423-8363445 GCCAGGGCTCAACACTCTCATGG + Intergenic
1183587311 22:38760451-38760473 GCCAGGGCCATGAATTTTCAGGG - Intronic
1184694706 22:46132976-46132998 GCCTGGCCTTTGGACTCTCAGGG - Intergenic
1184810630 22:46829234-46829256 GCCTGGGCTGTGAGCCCTCAGGG + Intronic
1184853277 22:47132896-47132918 ACCAGGGCCTTGAACTCCCTGGG + Intronic
1185066897 22:48636935-48636957 GCCAGGGCTCTGGACCCTCCTGG + Intronic
1203248833 22_KI270733v1_random:96600-96622 GCCAGGGCTCAACACTCTCATGG + Intergenic
955003968 3:54952293-54952315 CCCAGGGCTCTGATCTCTCTGGG + Intronic
956560704 3:70571135-70571157 GTCAGGGCATTAAACTCTCTAGG - Intergenic
956749165 3:72332596-72332618 GGCAGGGAATTGAACTCTCAGGG + Intergenic
956933483 3:74072748-74072770 GAGAGGGCTTTATACTCTCATGG + Intergenic
956933733 3:74075978-74076000 GAGAGGGCTTTATACTCTCATGG + Intergenic
957633881 3:82756937-82756959 GCCAGCGCTTTGCACTGTCTGGG - Intergenic
958711183 3:97718892-97718914 CCCAGGGCTTGGAAATTTCAAGG - Intronic
960991964 3:123317840-123317862 GCCAGGGGTCTGACCTCTCTGGG - Intronic
961323661 3:126096761-126096783 TTCAGGGCTTTCAGCTCTCAAGG + Intronic
961339682 3:126209728-126209750 GCAAGTGCTTTGATCTCTCTTGG - Intergenic
961811926 3:129527018-129527040 ATCAGGGCTTTGCACTCTCAGGG + Intergenic
962990197 3:140571034-140571056 TCCAAGGCTTTCAACTCTCGTGG - Exonic
965626646 3:170688751-170688773 GACAGGGGATTGATCTCTCAAGG + Intronic
966450381 3:180052333-180052355 CCCAGGGATTTGTACTCTGAGGG + Intergenic
966913833 3:184574181-184574203 GCCAGGGCTCTGGAGACTCATGG - Intronic
967201665 3:187077383-187077405 CCCAGGGCTCTGCACTCTCAAGG + Exonic
971155844 4:24082148-24082170 GCAAGGGCTTTGAACTGAAATGG - Intergenic
972631678 4:40847591-40847613 GCCAGGAGTTTGTACCCTCATGG - Intronic
972774511 4:42228860-42228882 GCCAGGGCTGTGACCTAGCAGGG + Intergenic
974994592 4:69139176-69139198 TCCAGGAGTTTGAAATCTCATGG + Intronic
980275583 4:130646256-130646278 GCCAGGGCTTGGTACAGTCAAGG - Intergenic
982283854 4:153714538-153714560 GCCAGAGCTTTGAACTAACTGGG + Intronic
982465016 4:155719493-155719515 GCCTGGGCTTTGAAGTCACATGG - Intronic
985445467 4:190019054-190019076 GCCAGGGCTCTGGACTCTCCAGG - Intergenic
988923023 5:35962209-35962231 CCCAGGTATTTGAACTCTCTTGG - Intronic
989055116 5:37359086-37359108 CCCAGGGTCTTGAACTCTCCTGG - Intronic
990410983 5:55541163-55541185 TTCAGGGCTTTGAAGTTTCAAGG - Intergenic
993940549 5:94052818-94052840 ACCAGGGAGTTGAACGCTCAAGG + Intronic
994249811 5:97522390-97522412 GCCACTGCTTGGAACTCTGAGGG + Intergenic
996575277 5:124971771-124971793 GACAGGGGATTGATCTCTCAAGG + Intergenic
998340524 5:141413723-141413745 GGCACGGCTCTGAACTCTTAGGG - Exonic
998681693 5:144474695-144474717 GCCAGGGCCTAGACCTCCCAAGG + Exonic
999900270 5:156079618-156079640 TCCCCGGTTTTGAACTCTCATGG - Intronic
1001122696 5:168993276-168993298 GTCAGGGCTCTGCACTCTCAGGG + Intronic
1001193803 5:169653769-169653791 GCCAGGGCCTTGTATTCTAATGG - Intronic
1002759573 6:191314-191336 GCCAGGGCTCTGAACCCGCAGGG + Intergenic
1002938789 6:1698167-1698189 GCCAGGGCTTTAATCTCCCCAGG - Intronic
1005930652 6:30481616-30481638 GCCAGGGTCCTGGACTCTCAGGG + Intergenic
1007353483 6:41292640-41292662 GCCATGGCTGTAAACTGTCATGG + Intergenic
1007740595 6:44007207-44007229 GCCAAGGCTGTGAAGTCTCTAGG - Intergenic
1009672845 6:66778721-66778743 GACAGGTCTTTGAACTCTAGGGG + Intergenic
1010810217 6:80291996-80292018 GCCATGGGTTTGTACCCTCAAGG + Intronic
1014748282 6:125225837-125225859 TCTAAGGCCTTGAACTCTCAGGG + Intronic
1017568010 6:155709454-155709476 GCCAGGGCGTTGAACACGCCAGG + Intergenic
1020017606 7:4840521-4840543 GCCAGGGCTTTGCAATTTTAGGG + Intronic
1028693775 7:93684288-93684310 GCCAGAACTTTCATCTCTCATGG + Intronic
1033667187 7:143452611-143452633 GTCAGGACTTAGATCTCTCAGGG + Intergenic
1033986005 7:147226442-147226464 GCCATGGCTTGGAAATATCATGG + Intronic
1034816985 7:154180984-154181006 GCCAGGGGATTGAACTGGCAGGG - Intronic
1035459270 7:159029310-159029332 GCCAGGGCTTGGCACACACATGG + Exonic
1035741561 8:1931687-1931709 GCCAGAGCTCTGAGCTTTCAAGG + Intronic
1035986078 8:4433449-4433471 GCCAGTGCGTTGACCTCGCAGGG - Intronic
1036222120 8:6929728-6929750 GACAGGGCGGTGCACTCTCAGGG - Intergenic
1036669211 8:10769497-10769519 GGCCTGGCTTTAAACTCTCAGGG - Intronic
1040008691 8:42642840-42642862 CCCAGGGCTCTGCTCTCTCATGG + Intergenic
1044826750 8:96205857-96205879 ATCAGGGCTTTGCACTCTCTGGG + Intergenic
1045125131 8:99080963-99080985 GCAAGAGCCTTGAACTGTCAAGG - Intronic
1045826174 8:106401429-106401451 GCCAGGGCTCTGAATTTTTAAGG + Intronic
1046672779 8:117075467-117075489 CCCAGTGCTTTGCAGTCTCAAGG + Intronic
1047856084 8:128914902-128914924 GACAGGGGTTTGATCTCCCAAGG - Intergenic
1049629908 8:143648214-143648236 GCCAGGGCTTTGAGGCGTCAGGG + Intronic
1052382805 9:27789639-27789661 GACAGGGTTTTGGACTTTCATGG + Intergenic
1053006423 9:34607879-34607901 GCCTTGGCCTTAAACTCTCAGGG - Intergenic
1053749100 9:41235418-41235440 GCCAGGGCTCTGGACTCTCCAGG + Intergenic
1054254536 9:62800271-62800293 GCCAGGGCTCTGGACTCTCCAGG + Intergenic
1054336765 9:63815331-63815353 GCCAGGGCTCTGGACTCTCCAGG - Intergenic
1056323515 9:85458807-85458829 GCCAGGGGATTGATCTCCCAAGG - Intergenic
1058917727 9:109583907-109583929 GCCAGGGCTATTATTTCTCAAGG + Intergenic
1059158563 9:112012132-112012154 GCCAGGACTTTGAGCTTTCAGGG - Intergenic
1060027204 9:120183355-120183377 CCCAGGGCTTTGAGCTCTGGTGG - Intergenic
1060911919 9:127358031-127358053 GCCAGGGGTGTAGACTCTCAGGG - Intronic
1203465233 Un_GL000220v1:79848-79870 GCCAGGGCTCAACACTCTCATGG + Intergenic
1203376692 Un_KI270442v1:382756-382778 GCCAGGGCTCTGGACTCTCCAGG - Intergenic
1196026801 X:111049992-111050014 CCTATTGCTTTGAACTCTCATGG - Intronic
1197705495 X:129631727-129631749 GCAAGGCCTTTGACCTCTCTGGG - Intergenic
1201065034 Y:10089179-10089201 GCCAGGGCTCTGGACTCCCCAGG + Intergenic
1201234479 Y:11896148-11896170 GACAGGGGTTTGACCTCCCAAGG + Intergenic