ID: 1118820791

View in Genome Browser
Species Human (GRCh38)
Location 14:69344464-69344486
Sequence ATAGAAGAGACCCATAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118820791 Original CRISPR ATAGAAGAGACCCATAGAGA AGG Intronic
900772851 1:4559478-4559500 ATATGAGGGACCCATAGGGAGGG + Intergenic
902467397 1:16626562-16626584 CAAGAAGAGACCCAGAGAGATGG + Intergenic
902507183 1:16946174-16946196 CAAGAAGAGACCCAGAGAGATGG - Intronic
905027750 1:34862852-34862874 CCAGAAGGGACCCATAGAGTTGG - Intergenic
906258800 1:44370574-44370596 AGAGTACAGGCCCATAGAGAAGG - Intergenic
907338430 1:53715975-53715997 ATAGGAGTGACCCCTGGAGAGGG + Intronic
907660359 1:56386664-56386686 ATATAAGAGAACCGTAGAGATGG + Intergenic
907751433 1:57267147-57267169 TCATAAGAGACACATAGAGAAGG + Intronic
908062417 1:60366235-60366257 ATAAATGAGACTCATAAAGAAGG + Intergenic
908763324 1:67532114-67532136 AGAGGAGAGACCCAGAGAGAAGG + Intergenic
908896711 1:68909507-68909529 AGAGAAGAGACAGACAGAGAGGG - Intergenic
908947650 1:69519066-69519088 GTAGAAAAGACCCATACAAATGG - Intergenic
909017776 1:70398335-70398357 ACAGAAGAGAGTCCTAGAGAAGG + Intergenic
911510770 1:98805785-98805807 AGAGTAGAGACACAGAGAGAAGG + Intergenic
914731382 1:150373895-150373917 ATAGAAGAGGTCCAGAGAGAAGG + Intronic
916846273 1:168653779-168653801 AAAGAAAAGACCCAAAGAGCTGG + Intergenic
916885981 1:169068820-169068842 ATGGAAGAGATGCATAGAGCAGG + Intergenic
920213088 1:204342865-204342887 AAAGAAAAGACCCATGGGGAGGG + Intronic
920986966 1:210899968-210899990 ATAGAAAAGACCCATCGTGAGGG + Intronic
922536922 1:226387983-226388005 ATAGAAGAGACACAAGCAGATGG + Intronic
922595097 1:226807417-226807439 ATACAAGAGACCAATAAAGCTGG + Intergenic
922930605 1:229386203-229386225 ATATGACAGCCCCATAGAGAAGG + Intergenic
924785062 1:247187885-247187907 ATAAAAAATACCGATAGAGATGG + Intergenic
1064849784 10:19697719-19697741 ATAGAAGAGAGCAAGAGAGGTGG - Intronic
1068558325 10:58482812-58482834 ATAGAAGAAAACTGTAGAGAAGG - Intergenic
1068764175 10:60745137-60745159 AAAGAAGAGAAATATAGAGAAGG + Intergenic
1068928678 10:62566052-62566074 ATAGAAGAGAAACAGAGAGCTGG - Intronic
1070762022 10:79029859-79029881 GCAGAAGAGAGCCCTAGAGAGGG + Intergenic
1072009155 10:91288331-91288353 AGAGAAGAGACCAATAGAGGAGG - Intergenic
1072598544 10:96900417-96900439 ATAGAATAAACCCAAAGAAATGG + Intronic
1074018868 10:109563525-109563547 AGAGTAGAGACACAGAGAGAAGG - Intergenic
1074063949 10:109995466-109995488 AAAGAAGAGACTCAGAGACATGG + Intergenic
1074202231 10:111247884-111247906 ATAAAAGAGACGCACGGAGAGGG + Intergenic
1074235333 10:111579150-111579172 ATAGATGATACAGATAGAGATGG - Intergenic
1074757325 10:116634134-116634156 AGAGGAGAGAGACATAGAGAGGG - Intronic
1074970315 10:118531203-118531225 TTTGAAGAGTCCCACAGAGAAGG + Intergenic
1075382440 10:122030314-122030336 TTAGCAGAGACTCATAGAAATGG + Intronic
1075590378 10:123686919-123686941 ATAGAAAAGACCCACAGAGCTGG - Intronic
1075600520 10:123764772-123764794 ACAGAAGAAACCCAAAGAAAGGG - Intronic
1075829158 10:125390413-125390435 AAAGGAGAGAGCCACAGAGAAGG - Intergenic
1075929274 10:126281572-126281594 AAAGGAGAAACCAATAGAGAGGG + Intronic
1077523956 11:3053175-3053197 ATAGGAAAGAGCCAGAGAGAGGG - Intronic
1077728268 11:4699448-4699470 AAAGTAGAGAACCAGAGAGATGG + Intergenic
1078605829 11:12774844-12774866 ATAGATGAGAGCAATAGACACGG + Intronic
1080446362 11:32341405-32341427 ATAGAGGAGAACAATGGAGATGG - Intergenic
1082130359 11:48481331-48481353 TTATAAGAGGCCCTTAGAGAAGG + Intergenic
1082246755 11:49932326-49932348 TTATAAGAGGCCCTTAGAGAAGG - Intergenic
1082563876 11:54652240-54652262 TTATAAGAGGCCCTTAGAGAAGG + Intergenic
1083534192 11:63453672-63453694 AGAGTAGAGACACAGAGAGAAGG - Intergenic
1084245745 11:67855930-67855952 AGAGTAGAGACACAAAGAGAAGG + Intergenic
1084826940 11:71738648-71738670 AGAGTAGAGACACAAAGAGAAGG - Intergenic
1085062544 11:73460849-73460871 ATAGAAGAAACTCAGAGAGGTGG + Intronic
1086446231 11:86873822-86873844 ATAAAAGAGAACCAGAGAGAGGG + Intronic
1088433458 11:109783884-109783906 AAAGAAAAGCCCCATAGAAAGGG + Intergenic
1089300302 11:117494761-117494783 CGAGAAGAGACCCACATAGAGGG + Intronic
1093950917 12:25164347-25164369 AGAGTAGAGACACAGAGAGAAGG - Intronic
1093968618 12:25353565-25353587 ATAGAAGAAACACCTTGAGAAGG + Intergenic
1094400511 12:30057164-30057186 AGAGTAGAGACACAGAGAGAAGG - Intergenic
1096782046 12:53997197-53997219 ATAGCAGAGGCCCATAGGGGAGG + Intronic
1097480254 12:60115343-60115365 AAAGAAGAGAATCAAAGAGATGG - Intergenic
1099127797 12:78787642-78787664 ACAGTATAGACCCAGAGAGAAGG + Intergenic
1099257544 12:80332485-80332507 TTAGGAGTGACCCATAGAAAAGG - Intronic
1100728233 12:97433418-97433440 ATAGGACTGACCCATAGACAGGG + Intergenic
1102814135 12:115849271-115849293 AGAGAAAGGACCCAGAGAGAAGG + Intergenic
1103676536 12:122660421-122660443 ACAGAGGAGACACACAGAGAAGG - Intergenic
1105051415 12:133055237-133055259 ATAGAAAATACTGATAGAGATGG + Intronic
1106995948 13:35479489-35479511 ATGGAAATGACCTATAGAGAGGG + Intronic
1107623249 13:42255856-42255878 AAAAAAGAGACTGATAGAGAAGG + Intronic
1108454488 13:50599219-50599241 ATAGAACAGAGCCTTAGAAATGG + Intronic
1109720490 13:66269411-66269433 CTACCAGAGGCCCATAGAGAAGG + Intergenic
1110218684 13:73050676-73050698 AGAGAAGAAACCAACAGAGAGGG + Intergenic
1110725919 13:78823490-78823512 ACAGAGGAGACACACAGAGAAGG - Intergenic
1112285966 13:98104660-98104682 CGAGAAGAGCCCCATAGAGGAGG + Intergenic
1112491714 13:99871644-99871666 ATAGCAGAAACCCACAGAGCAGG - Intronic
1112557528 13:100482346-100482368 AGAGAAGGGGCCAATAGAGAGGG + Intronic
1112608539 13:100931919-100931941 ATGGAAGAGACGCATAGGCAAGG - Intergenic
1114572726 14:23685002-23685024 TTTGAAGAGAACCAAAGAGAAGG + Intergenic
1114810975 14:25899063-25899085 AAAGAAGAGACTAACAGAGAGGG - Intergenic
1116343274 14:43753882-43753904 ACAGAAGTGACATATAGAGACGG + Intergenic
1116346535 14:43802097-43802119 ATAGAGGAGTCCCAGAGAAATGG - Intergenic
1116578926 14:46613043-46613065 ATAGCAGGGAACCATAGAAAGGG + Intergenic
1118820791 14:69344464-69344486 ATAGAAGAGACCCATAGAGAAGG + Intronic
1119902525 14:78273544-78273566 ATAGATGAGACCCTCAGAAATGG - Intronic
1120270949 14:82311909-82311931 ATAGAAAAGACAAAAAGAGAGGG - Intergenic
1120359230 14:83475939-83475961 CAAGAAGAAAGCCATAGAGAAGG + Intergenic
1120438203 14:84504707-84504729 ATAGTAGAGACTCAGAGGGAAGG + Intergenic
1120652064 14:87146478-87146500 ATAGAAGAGAGCCAGAGCAAAGG - Intergenic
1121533282 14:94673509-94673531 ATAGAAGAGACAAAGAGAGAGGG + Intergenic
1121576890 14:94995977-94995999 ATAGCAAAAACCCTTAGAGAGGG + Intergenic
1122876713 14:104669890-104669912 AAAGGAGAGCGCCATAGAGAGGG + Intergenic
1125283153 15:38064880-38064902 AGAGAATAGGCCCACAGAGAAGG + Intergenic
1126225932 15:46269105-46269127 AAAGAAAAGAGCCCTAGAGAAGG + Intergenic
1126990548 15:54370731-54370753 ATGAAAGAGACCCTTAGTGAAGG - Intronic
1127148183 15:56047523-56047545 ATAAAAGGTAACCATAGAGAAGG + Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127986337 15:64074692-64074714 ATAAAAGAGAGCTATAGAGAGGG - Intronic
1128541899 15:68541850-68541872 AGAGAAGAGAGCCACACAGACGG - Intergenic
1131371021 15:91881930-91881952 GTAAAAGAGACCCGAAGAGAGGG - Intronic
1131858769 15:96628674-96628696 ATAGAAGAGACAAAAAGAGGGGG - Intergenic
1135074020 16:19377770-19377792 ATAGAAAAGACACATTGAGCAGG + Intergenic
1137936025 16:52636384-52636406 GCAGAAGAGAACCAGAGAGATGG - Intergenic
1138759920 16:59531071-59531093 ACAGAAGAGAGCCAGAAAGATGG - Intergenic
1138928841 16:61627288-61627310 ATAGAAGAGAACCATATATGTGG + Intergenic
1139191266 16:64866136-64866158 ATGGAAGAGCCCTATGGAGAGGG + Intergenic
1139478945 16:67217703-67217725 TTACCAGAGACACATAGAGAGGG - Intronic
1139510123 16:67422878-67422900 ATCAAGGAGACCCAGAGAGAAGG - Intergenic
1140440237 16:74982486-74982508 ATTGAAGAGACCTGCAGAGAGGG - Intronic
1140951462 16:79822500-79822522 ATAGAAGAGGGCCATCCAGAAGG + Intergenic
1147755946 17:42767923-42767945 ATAGAAAAGAGCCATTGAGGAGG + Intergenic
1149185552 17:53992999-53993021 ATGGAAGAGACCCACAGGCAAGG + Intergenic
1151152461 17:72099596-72099618 ATAGAAGAAACCCTATGAGAAGG - Intergenic
1154343526 18:13523877-13523899 ATGCTAGAGACCCAGAGAGATGG - Intronic
1155540742 18:26865483-26865505 TCAGAAGAGAGGCATAGAGAAGG - Intronic
1156924207 18:42557013-42557035 AGAGTAGAGACACAGAGAGAAGG + Intergenic
1157590275 18:48832457-48832479 AAAGAAGAAACACATAGAAAGGG + Intronic
1159081748 18:63743016-63743038 AAAGAAAACACACATAGAGAGGG - Intergenic
1159447596 18:68559435-68559457 ATAGAAGAAGAGCATAGAGATGG + Intergenic
1159837923 18:73362954-73362976 ATAGAGAATACCAATAGAGACGG - Intergenic
1161829596 19:6592677-6592699 AGAAAAGAGGCTCATAGAGAAGG + Intronic
1164465209 19:28481962-28481984 GTAGAAGAGACACAAAGATAGGG - Intergenic
1165445455 19:35854719-35854741 ATAACAGAGACATATAGAGATGG - Intronic
1166938496 19:46349352-46349374 AGAGTAGAGTCCAATAGAGATGG + Intronic
1167269735 19:48500022-48500044 GTAACAGAGACCCAGAGAGAGGG + Intronic
1167348956 19:48963230-48963252 GGAAAAGAGACCCAGAGAGAGGG - Intergenic
1167427742 19:49438118-49438140 ATGACAGAGACCCAGAGAGAGGG + Intronic
1167428271 19:49440799-49440821 AGAGGAGAGACCCAGAAAGAGGG + Intronic
926273429 2:11385469-11385491 TTAGGAGAGACACATACAGAGGG - Intergenic
928068108 2:28187266-28187288 CTCCTAGAGACCCATAGAGAAGG + Intronic
928115159 2:28540860-28540882 ACAGAAGAGACCCCAAGAGAGGG + Intronic
928273030 2:29874210-29874232 AGAGAAGAAAGCCATAGAGAAGG - Intronic
929439311 2:41952840-41952862 AGAGAAGATACCCAAAGAGCAGG + Intronic
929877002 2:45805211-45805233 AGAAAACAGAGCCATAGAGAGGG + Intronic
930261619 2:49153697-49153719 ATAGGAAAGACACAGAGAGAGGG - Intronic
931036182 2:58245571-58245593 ATAGAAGAGACCTATTTACAGGG + Intergenic
931917010 2:66967292-66967314 AGAGAAGGGACCCACAGATATGG - Intergenic
931968364 2:67558841-67558863 ATAAGAGAGAACAATAGAGAGGG + Intergenic
932078518 2:68689547-68689569 AGAGAAGAGGCCCATTCAGATGG + Intronic
934602181 2:95666160-95666182 ATAGCATAGACCCATAGAAGAGG + Intergenic
938099383 2:128487888-128487910 AGAGAAGAGACCCATGGGGTTGG - Intergenic
938129871 2:128705354-128705376 AAAGAAGAGACACATAGGGCTGG - Intergenic
939009731 2:136831877-136831899 ATAGAAAAGGCCCATACAGAAGG - Intronic
939121876 2:138126916-138126938 ATGGAAGAGAACCAAAGAGATGG + Intergenic
939500690 2:142979836-142979858 ATCCAAGAGACCCCAAGAGAGGG + Intronic
941870940 2:170385085-170385107 ATAGAAGAGACACATGGGGCAGG + Intronic
942554752 2:177160313-177160335 AAAGAAAAGACCCATAAAGCTGG + Intergenic
943473750 2:188329128-188329150 AAAAAAGAGTCCAATAGAGAGGG - Intronic
944145496 2:196503363-196503385 ATAGAAGAGGGCCAGAGAAAGGG + Intronic
946647028 2:221848912-221848934 ATAGAACAGACACACAGAAAAGG + Intergenic
948317811 2:237042650-237042672 ATAGAGGAGACACATGGACAAGG - Intergenic
948524995 2:238566113-238566135 CTAGCCGAGACCCAGAGAGATGG - Intergenic
1170444513 20:16412122-16412144 AGAGAAGAGACCATGAGAGAGGG + Intronic
1172274315 20:33671501-33671523 TTTGAAGAGACCCAAGGAGAAGG + Intronic
1173324689 20:42021918-42021940 AAAGAAGAGACCCAAAGAGAAGG - Intergenic
1174193898 20:48759174-48759196 ATAGATGAGGCCCAGAGAGATGG - Intronic
1174710818 20:52703107-52703129 TTAGGGGACACCCATAGAGATGG - Intergenic
1175027250 20:55915290-55915312 TTAGAAAAGACACATAGGGATGG + Intergenic
1175311102 20:58012081-58012103 AGAGGAGAGACACACAGAGAAGG + Intergenic
1176787131 21:13270484-13270506 TTAGTAGAGACACAGAGAGATGG + Intergenic
1177008881 21:15707536-15707558 GTAGAAGAGAGACAGAGAGAAGG - Intergenic
1178042515 21:28655205-28655227 ATAGAATAGACAAATAGAGGAGG - Intergenic
1178350138 21:31866987-31867009 AGAGAAAAGGCCCACAGAGAAGG + Intergenic
1182558982 22:31144163-31144185 ATAAAAGAGACAGAGAGAGATGG + Intergenic
1183505805 22:38208269-38208291 AAAGTGGAGACCCAGAGAGATGG + Intronic
1183621947 22:38979021-38979043 AAAGAAAAGAGCCATGGAGAAGG + Intronic
1183666119 22:39246828-39246850 TTTGAAGAGCCCCATTGAGAAGG + Intergenic
1183751455 22:39723371-39723393 AGAGAAGAGATGCAGAGAGAAGG - Intergenic
1184447885 22:44562267-44562289 ATAGATGAGACAAATAGAGGGGG + Intergenic
949489539 3:4575268-4575290 ATAGAGGAAAACCAGAGAGAAGG + Intronic
950180257 3:10907438-10907460 AAAGAAGAGACCCAAAGCAATGG + Intronic
951439361 3:22705651-22705673 CTAGAAGAGAACAATTGAGATGG - Intergenic
951762958 3:26164903-26164925 AGAGTAGAGACACAGAGAGAAGG + Intergenic
953975252 3:47377333-47377355 ACAGAGAAGACCTATAGAGATGG - Intergenic
956015749 3:64880942-64880964 TTAGAACAGACTCATACAGATGG - Intergenic
956397407 3:68840668-68840690 ATAGAATATAGCCATGGAGAAGG + Intronic
957060048 3:75474549-75474571 AGAGTAGAGACACAGAGAGAAGG + Intergenic
959789913 3:110347375-110347397 ATATAAGAGACAAAGAGAGATGG + Intergenic
960713750 3:120556246-120556268 CTGGAAGAGACCCAGAGATAAGG + Intergenic
961293349 3:125864899-125864921 AGAGTAGAGACACAGAGAGAAGG - Intergenic
961671325 3:128533584-128533606 ATAGAAGGGACACCCAGAGATGG - Intergenic
961893870 3:130151659-130151681 AGAGTAGAGACACAAAGAGAAGG + Intergenic
961968446 3:130931845-130931867 CCAGAAGTGACACATAGAGAGGG - Intronic
962081759 3:132146756-132146778 ATATAAAAGACCTTTAGAGAAGG - Intronic
962682024 3:137810248-137810270 GGAGAAGAGCCCCCTAGAGAGGG - Intergenic
962704135 3:138027025-138027047 GGAGAAGAGACCCACAGAAACGG + Intronic
963388819 3:144631862-144631884 AAAGAAGAGAGCCAGAGAAATGG + Intergenic
963404849 3:144850649-144850671 GTACAAGAGACTCAAAGAGAAGG + Intergenic
965707759 3:171526164-171526186 TTAGAAGAGACACGTAGAGAAGG + Intergenic
965728970 3:171749774-171749796 AAAGGAGAGAGCCACAGAGAGGG + Intronic
966171348 3:177084637-177084659 GAAGAAGATACCCATAGAGGTGG - Intronic
966279141 3:178208729-178208751 AGAGTAGAGACACAGAGAGAAGG - Intergenic
966738077 3:183206087-183206109 GTAGAGGAGACCCATGGGGAAGG + Intronic
971870985 4:32238177-32238199 ATAGAAGGGACCCAGAGATCAGG + Intergenic
973615133 4:52670619-52670641 GTGGAAGTGACCCATAGTGAGGG - Intergenic
974075010 4:57160568-57160590 ATAGATGAGAGGCAGAGAGAGGG - Intergenic
978108134 4:104929980-104930002 ATAAAAGAGACCAATGGAGCTGG + Intergenic
978702149 4:111660434-111660456 ATATAAGAGGCCCTTAGAAATGG + Intergenic
982306298 4:153934604-153934626 AGAGAAAAGAGCCATGGAGAAGG - Intergenic
985613291 5:902883-902905 AGAGAAGAGAAACAGAGAGACGG + Intronic
986069571 5:4268954-4268976 GTAGAAGAGCCCTACAGAGATGG + Intergenic
986179095 5:5376683-5376705 ATAGAACAGCCCCATAAAGATGG + Intergenic
986256421 5:6104582-6104604 TTTGAAGAGACACACAGAGAAGG + Intergenic
988630352 5:32923641-32923663 ACAGAAGAGACCCATATGAAGGG + Intergenic
989989147 5:50740478-50740500 AAAGATGAGACGCATAGATAGGG + Intronic
991603373 5:68375718-68375740 ATATCTGGGACCCATAGAGAAGG + Intergenic
993267221 5:85741248-85741270 ATAGGAGAGAGCAAGAGAGATGG + Intergenic
995492553 5:112707972-112707994 AGAGAAGAGAGCCACAGAGTCGG - Intronic
998120879 5:139576405-139576427 AGAGAAGACACACACAGAGAAGG - Intronic
998546540 5:143032860-143032882 AAAGAAGAGACAAAGAGAGATGG + Intronic
998650604 5:144117310-144117332 TTAGCAGAGTCCCAAAGAGATGG - Intergenic
1003208193 6:4034401-4034423 ATAGAATAGACTCATAGAAGTGG + Intronic
1004118081 6:12790753-12790775 ATGGAAGGGACCTACAGAGATGG - Intronic
1004591857 6:17059647-17059669 TTACAAGAGACCCTGAGAGATGG - Intergenic
1005021947 6:21426773-21426795 ATTGAATATAGCCATAGAGAGGG + Intergenic
1006947339 6:37793514-37793536 TTAGAAGTGTCTCATAGAGATGG + Intergenic
1009436216 6:63621248-63621270 ATAGAAGAGATGCACAGGGAGGG + Intergenic
1010547920 6:77181487-77181509 AGAGAAATGACACATAGAGAAGG + Intergenic
1010781140 6:79947311-79947333 AAAGCGGAGACCCAGAGAGAGGG + Exonic
1011554958 6:88564303-88564325 ATAGAAAAAACCCACAGAGCAGG - Intergenic
1011725991 6:90211307-90211329 ATGGAAGAGACCCAGAGATTTGG + Intronic
1011816722 6:91200037-91200059 ACAGAAGAGAACCAAAGGGATGG + Intergenic
1012672517 6:102073236-102073258 AAAGAAAAGACCCAAAGATAGGG - Intergenic
1013829114 6:114251767-114251789 ATGGAGGAGACCCACAGAAATGG + Intronic
1014462845 6:121718714-121718736 ATAGCACAGACCCATACAAATGG + Intergenic
1014639279 6:123889616-123889638 ATAAAAGAGACTCAGAGAAAAGG + Intronic
1016075386 6:139789079-139789101 CTAGAAGAGGCCAACAGAGAGGG + Intergenic
1016580111 6:145619883-145619905 CAAGAAGAGACACATAGAAAAGG + Intronic
1017410617 6:154163856-154163878 ATAGAAGATAGACATATAGATGG + Intronic
1017810197 6:157978985-157979007 AAAGAAGAGACACAGAGGGAAGG - Intergenic
1018077437 6:160229657-160229679 AGAGTAGAGACACAGAGAGAAGG - Intronic
1018098303 6:160412879-160412901 ATAGAAGAAACAAATATAGAAGG + Intronic
1018495562 6:164343251-164343273 AGAGTAGAGACACAGAGAGAAGG + Intergenic
1018640358 6:165898927-165898949 TGAGAAGAGACCCAAAGAAATGG - Intronic
1020538089 7:9426646-9426668 ATATCACAGAACCATAGAGAGGG + Intergenic
1021076076 7:16306088-16306110 ATAGAAGAGACACAGATACAGGG - Intronic
1023424363 7:40019809-40019831 TGAGAAGAGACCCAGAGATAAGG + Intronic
1025939287 7:66062308-66062330 ACAGAGGAGACCCAGGGAGAAGG + Intergenic
1026241170 7:68576717-68576739 AGAGAAGAGACACATGCAGAAGG - Intergenic
1028150617 7:87367236-87367258 AAAGGAGAGAACCAAAGAGATGG + Intronic
1028597605 7:92563159-92563181 AAAGAAGAGACCTATAAGGATGG + Intronic
1031183899 7:118451625-118451647 ATAGAAGAGTCTCTTATAGAGGG + Intergenic
1032392166 7:131562404-131562426 AGAGAAGGGACCCATAGAAACGG + Intergenic
1033069946 7:138192828-138192850 ATAGGACACACCCATACAGATGG - Intergenic
1033181020 7:139178362-139178384 AGATAAGATACCCTTAGAGATGG + Intronic
1034674505 7:152882871-152882893 AGAGAAGAGACACAGAGAGAAGG - Intergenic
1035240348 7:157524997-157525019 AGAGAAGAGACAGACAGAGAGGG + Intergenic
1035819662 8:2578091-2578113 TGAGAAGAGACCTAAAGAGAGGG - Intergenic
1039035860 8:33358713-33358735 ATAAAAGAGACCCAGAGTGCTGG + Intergenic
1041211480 8:55555856-55555878 ATTAATGAGACACATAGAGAGGG + Intergenic
1041567333 8:59293908-59293930 ATGGAAGACAGCCATAAAGATGG - Intergenic
1041648258 8:60275846-60275868 AGAGAAGAGACACATAGAGGGGG + Intronic
1042173622 8:66017056-66017078 AGAGAAGAGCCACATAGAAAGGG + Intergenic
1042288002 8:67135954-67135976 AAAAGAGAGACCCAAAGAGAGGG + Intronic
1042359770 8:67869365-67869387 AAAGAAGAAACACACAGAGAAGG + Intergenic
1044152278 8:88796185-88796207 AAAGAAGAAACCAATAAAGAAGG + Intergenic
1044580830 8:93824688-93824710 AAAAAAGAGACTCATAGAGGTGG - Intergenic
1045466007 8:102470437-102470459 ACATAAGAAACCCAGAGAGATGG + Intergenic
1046144236 8:110136510-110136532 ATGGAATAGAACCACAGAGATGG - Intergenic
1046224869 8:111264726-111264748 CCAGAAGAGAGGCATAGAGATGG + Intergenic
1049062512 8:140286971-140286993 ACAAAAGAGACCCAAACAGAAGG + Intronic
1051078691 9:13271559-13271581 AAAGAAGAGACCCAAAGAAGAGG - Intronic
1052524796 9:29602201-29602223 ATAGAATTGAGCCATTGAGATGG + Intergenic
1052525944 9:29620462-29620484 ATAAAACAGACCCATATTGAAGG + Intergenic
1052841493 9:33295107-33295129 AGAGAAGATACCCACAGAAAAGG + Exonic
1053156658 9:35785627-35785649 ACTGGAGAGACCCAGAGAGAAGG + Intergenic
1055347880 9:75356303-75356325 AGAGTAGAGACACAGAGAGAAGG + Intergenic
1055896800 9:81186789-81186811 ATGGAAGAGGCCAAAAGAGATGG - Intergenic
1056945397 9:90991076-90991098 ATAGAAGAGAGACATATTGAAGG - Intergenic
1057370827 9:94471528-94471550 AAAGAATAGGCCCAAAGAGAGGG - Intergenic
1058254205 9:102740793-102740815 ATAGCAGAGTCCTAGAGAGAAGG - Intergenic
1059168830 9:112105094-112105116 CTAGATGAGACCCAAAGAAAAGG + Intronic
1060605954 9:124914101-124914123 TAATAAGAGACCCATAAAGATGG - Intronic
1203791933 EBV:156268-156290 ATAGAAGAGTCCCCCAGACATGG + Intergenic
1186262568 X:7795326-7795348 AAGAAGGAGACCCATAGAGATGG + Intergenic
1186923158 X:14303842-14303864 AAAGAAGAAACCCATGGAGCTGG + Intergenic
1187028780 X:15463715-15463737 ATAGAAGAGACCCATTTGTATGG + Intronic
1187063487 X:15810574-15810596 AAAGGAGAGAACCATAGAGAAGG - Intronic
1187380993 X:18802020-18802042 ATAGATGAGAGCCACAAAGACGG + Intronic
1189136748 X:38558545-38558567 AAAGAAGAGACACAGGGAGAGGG - Intronic
1189438883 X:41016961-41016983 AAAGAAGGAACCCATAAAGAAGG + Intergenic
1189860021 X:45262461-45262483 AGAGAAGAGAGCAAGAGAGAGGG + Intergenic
1190554111 X:51616522-51616544 ATAGAATAGATCCAGAGGGATGG - Intergenic
1192773575 X:74218532-74218554 GTAGACGAGAGCCATAGACACGG + Intergenic
1194475904 X:94359927-94359949 ATAGCAGAGGCCCACAGAAAAGG + Intergenic
1194819782 X:98491262-98491284 ATAGAAGAGATGCATAGATGAGG - Intergenic
1195560910 X:106282688-106282710 ATAGAAGATACCCCTAAAAATGG + Intergenic
1195652581 X:107300606-107300628 ATATGAGAGAGCCATAGGGATGG - Intergenic
1197673211 X:129301687-129301709 ATAGAAGAGATCCAGAGAATAGG - Intergenic
1198639614 X:138742249-138742271 ATAGATGAAATCAATAGAGAAGG + Intronic
1201462047 Y:14237091-14237113 ATTAAAGAGACCCATAGCAATGG + Intergenic