ID: 1118820905

View in Genome Browser
Species Human (GRCh38)
Location 14:69345301-69345323
Sequence CTCCCAAAGGGAGTCTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118820899_1118820905 3 Left 1118820899 14:69345275-69345297 CCACCTCTGCTAGAGAGTTGCAA 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 231
1118820898_1118820905 14 Left 1118820898 14:69345264-69345286 CCAGCAGTTTGCCACCTCTGCTA 0: 1
1: 0
2: 2
3: 18
4: 166
Right 1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 231
1118820900_1118820905 0 Left 1118820900 14:69345278-69345300 CCTCTGCTAGAGAGTTGCAATGC 0: 1
1: 1
2: 1
3: 5
4: 99
Right 1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118820905 Original CRISPR CTCCCAAAGGGAGTCTGGAG AGG Intronic
902609306 1:17587991-17588013 CTCCCCAAGGCAGACAGGAGAGG - Intronic
904394289 1:30207938-30207960 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
906805846 1:48777897-48777919 TTGCCAAAGAGAGCCTGGAGGGG + Intronic
911193144 1:94967922-94967944 CTCCTATTAGGAGTCTGGAGTGG + Intergenic
911967468 1:104386230-104386252 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
917883441 1:179361794-179361816 CTCCCTAAAGGAATCTGCAGGGG - Intergenic
919310456 1:195900277-195900299 CTGCCAAAGAGAGTGTGGAATGG + Intergenic
920425766 1:205873854-205873876 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
920908587 1:210193364-210193386 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
922616309 1:226963140-226963162 CTCCCAAAGCATGTCTGGAAGGG + Intronic
922689966 1:227680470-227680492 CTTCAAAAGGGAGCCTGGACAGG + Intergenic
924946416 1:248849856-248849878 CTGTCAAAGTGAGTCTGGAAAGG + Intergenic
1066103054 10:32134864-32134886 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
1067224766 10:44368444-44368466 CTCACACAGGGAGTCTGGCATGG - Intergenic
1067544510 10:47183373-47183395 CTCACATAGGGAGTCTGGCCAGG + Intergenic
1067668531 10:48299492-48299514 ACCCCAAAGGGAGACTGGAAAGG - Intergenic
1067696212 10:48537397-48537419 CACCCATAGTGAGGCTGGAGAGG - Intronic
1068061470 10:52073011-52073033 CTTCCAAAGGGAGTGTGGCCTGG - Intronic
1068654035 10:59556096-59556118 CTCTCAAGGAGAGTGTGGAGCGG - Intergenic
1069547414 10:69338564-69338586 CTCCCAAATGGAGTGTGGGGAGG + Intronic
1070743073 10:78915158-78915180 CTTCCAAAGAGAGTCCGGTGTGG - Intergenic
1071550448 10:86562450-86562472 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
1071811135 10:89182411-89182433 CTCTCAAAGGGTCTTTGGAGGGG + Intergenic
1072493598 10:95933672-95933694 CAGGCAAAGGGGGTCTGGAGTGG - Intronic
1072613592 10:97035160-97035182 CCCCCAAAGACAGTCGGGAGCGG - Intronic
1072685454 10:97533950-97533972 CTCCCAAGGCGAGTCTGATGAGG - Intronic
1072689651 10:97563620-97563642 CTCCAAGAGGGAGTCAAGAGTGG + Intronic
1072884833 10:99263877-99263899 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
1073064470 10:100750027-100750049 ATCCCCAAAGGGGTCTGGAGAGG + Intronic
1073395310 10:103212437-103212459 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
1074668402 10:115758417-115758439 CAGGCAAAGAGAGTCTGGAGTGG - Intronic
1075670511 10:124261046-124261068 ATGGCAAAGTGAGTCTGGAGGGG + Intergenic
1076895734 10:133310469-133310491 CTGCCGAAGGGAGGCTGGAGGGG + Intronic
1076983868 11:221594-221616 CACCTAAAGGGGATCTGGAGTGG + Intronic
1077194942 11:1274782-1274804 CTCACAAGGGGAGGCTGCAGTGG - Exonic
1078987863 11:16612658-16612680 CTCCCAAAGGCAGCGTGGAGCGG + Intronic
1079316621 11:19412773-19412795 CTGGCAAAGAGGGTCTGGAGTGG + Intronic
1081811634 11:45917564-45917586 TTCCCAAAGGGCGTAGGGAGGGG - Intronic
1084772065 11:71349736-71349758 CTCCCACAGTGAGTCAGGACTGG + Intergenic
1084876879 11:72139641-72139663 TTCACAAAGGGCGGCTGGAGTGG - Exonic
1084907313 11:72358041-72358063 CTCCCAAGGAGAGGCAGGAGTGG + Intronic
1085192676 11:74641830-74641852 CTCCCTAAGAGAGGATGGAGAGG + Exonic
1085331029 11:75651254-75651276 CTCACAAATGCAGTCTGGACTGG + Intronic
1086007456 11:82054559-82054581 CTCCCAGAGGAATTCTGGATGGG - Intergenic
1089201148 11:116725523-116725545 CTCCCACACGGAGTGGGGAGGGG - Intergenic
1090383835 11:126345106-126345128 CTCCCAAAAGAAGTGGGGAGCGG - Intronic
1091585546 12:1814236-1814258 CTAACATGGGGAGTCTGGAGAGG + Intronic
1093925308 12:24903154-24903176 CTCCCCAAGGGATGCTGGAGGGG - Intronic
1099472176 12:83064376-83064398 TTTTCAAAGGCAGTCTGGAGTGG - Intronic
1099938983 12:89162533-89162555 CTTCCAAAGCGATTCTGGTGGGG + Intergenic
1100912507 12:99381492-99381514 CTCACAAAGGGAGACTGGAGAGG + Intronic
1101023341 12:100574799-100574821 TTCCCAAAGGGAATCTGAGGTGG - Intronic
1102188271 12:110966360-110966382 CTGCCAACGGGAGTGGGGAGGGG + Intergenic
1102688660 12:114743628-114743650 CTCCCAGAGGGAGGCTGCTGGGG + Intergenic
1105751559 13:23425782-23425804 CTCCCGCAGGGAGTCAGGCGGGG - Intronic
1106225035 13:27778908-27778930 CCCCTAAAGGGAGTATGGTGGGG + Intergenic
1108048709 13:46408358-46408380 CAGGCAAAGGGGGTCTGGAGTGG - Intronic
1108420410 13:50243428-50243450 ATCCCAAAGGAAGTCTTCAGGGG - Intronic
1109216135 13:59591499-59591521 CAGGCAAACGGAGTCTGGAGTGG + Intergenic
1109541242 13:63781703-63781725 CAGGCAAAGGGGGTCTGGAGTGG - Intergenic
1112194719 13:97213933-97213955 CTCCAACAGGGAGTATGGAATGG - Intergenic
1112461496 13:99606927-99606949 CTCCCAAAGGGAGGCGCGGGCGG - Intronic
1113484876 13:110646431-110646453 CTCACAAAGAGAGGCTGGGGAGG + Intronic
1115489682 14:33947227-33947249 CTCCAAAAGGGAGTAGCGAGCGG + Intronic
1115569395 14:34652655-34652677 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
1116889468 14:50254020-50254042 CTGCGAAAGGTAGTGTGGAGTGG + Intronic
1117174718 14:53134320-53134342 CTCCAAGAGGGAGTCAAGAGTGG - Intronic
1118673887 14:68161593-68161615 CCCCAAAAGGGATTCTGGACAGG + Intronic
1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG + Intronic
1120606920 14:86591062-86591084 TACCCAAAGAGGGTCTGGAGTGG - Intergenic
1121391366 14:93577905-93577927 CTCCGAAACGGACTCTGGAAAGG - Exonic
1121861586 14:97323963-97323985 CTACCACATGGAGTCTGGAGGGG - Intergenic
1122383723 14:101329697-101329719 CTCCCAATAGGAGTTTGCAGGGG - Intergenic
1124909572 15:33905705-33905727 GTCCCAGAGGGAGGCTGAAGTGG + Intronic
1125314554 15:38417261-38417283 CTGCCAAAGTGGGACTGGAGCGG + Intergenic
1126380289 15:48039540-48039562 GTCCCAAAGGGAGTTAGGAAGGG - Intergenic
1126458616 15:48891791-48891813 TTCCCAAAGGAAGTGGGGAGAGG + Intronic
1128338879 15:66806000-66806022 TTCCCAATGTCAGTCTGGAGGGG - Intergenic
1128678857 15:69631805-69631827 GTGTTAAAGGGAGTCTGGAGGGG + Intergenic
1129255762 15:74333151-74333173 CTCCAGAAGGGAGTTTTGAGAGG - Intronic
1131582230 15:93655476-93655498 CTCACAGAGGCAGTATGGAGTGG + Intergenic
1132070946 15:98776110-98776132 CTCCCGAAGGGAGGGTGGAAGGG + Intronic
1132462285 16:61509-61531 CTCCCAGAGCGGGTCGGGAGGGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1133647682 16:7779457-7779479 CTTCCCAAGAGAGGCTGGAGAGG - Intergenic
1135025064 16:18993262-18993284 CTCCAAGAGGGAGTCAAGAGTGG + Intronic
1135760173 16:25131384-25131406 CTCCCAAATGGTGTATGGTGAGG + Intronic
1136175284 16:28512394-28512416 GTCCCAAAGGTGGGCTGGAGGGG - Intergenic
1136293613 16:29289994-29290016 CTGCCACAGGGAGGCTGGTGTGG - Intergenic
1136530320 16:30863869-30863891 CTCCAAGAGGGAGTCAAGAGTGG - Intronic
1140406239 16:74713483-74713505 CTCCCCAAGGGAGGCTGAGGAGG - Exonic
1140767307 16:78172288-78172310 CTCGAAAAGGAAGTCTGGAACGG - Intronic
1141420704 16:83913470-83913492 TCCTCAAAGGGAGTCTGGAAGGG + Intronic
1142099495 16:88264000-88264022 CTGCCACAGGGAGGCTGGTGTGG - Intergenic
1142162056 16:88562710-88562732 CCCCCAAAGCCAGTCTGGACAGG + Intergenic
1142261353 16:89043931-89043953 CTCCCCAAGGGTCTCTGGTGTGG + Intergenic
1142662008 17:1437126-1437148 CTCCTATTCGGAGTCTGGAGGGG + Exonic
1143275733 17:5708411-5708433 CTCCCACAGATAGGCTGGAGTGG - Intergenic
1144629692 17:16864719-16864741 CTGCCCAAGGGAGCCAGGAGAGG + Intergenic
1144651736 17:17011398-17011420 CTGCCCAAGGGAGCCAGGAGAGG - Intergenic
1145080333 17:19889651-19889673 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
1147978474 17:44261018-44261040 GACCCAAAGGGATGCTGGAGAGG + Intronic
1148105176 17:45115025-45115047 CTCCTGAAGGGAGTCTGGAAAGG - Intronic
1149221064 17:54415600-54415622 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
1149320356 17:55475279-55475301 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
1149491945 17:57091442-57091464 CTGCCAAGGGGTGTGTGGAGGGG + Intronic
1151472458 17:74326625-74326647 CTCCCAATGGGAGGGTGGAAAGG - Intronic
1151503118 17:74505233-74505255 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
1151822682 17:76505565-76505587 ATCACAAAGTGAGTCTTGAGGGG - Intergenic
1152004853 17:77674045-77674067 CAACCAGATGGAGTCTGGAGAGG + Intergenic
1152603016 17:81274585-81274607 CTCCCAAGGGGAGGCAGGAGGGG + Intronic
1152778431 17:82215964-82215986 CTCCCATAGGGCTTTTGGAGGGG - Intergenic
1153767693 18:8389773-8389795 CTCCAAGAGGAAGACTGGAGTGG - Intronic
1153940138 18:9969965-9969987 CTCCCAAAGTCAGTGTGGTGTGG - Intergenic
1156299799 18:35826500-35826522 TTCACACAGGGAGTCTGAAGGGG + Intergenic
1161143074 19:2660305-2660327 CTCCCACAGGGAATCAGGATTGG - Intronic
1164923000 19:32103519-32103541 CTCCCAAGGGGAGACAGGAACGG + Intergenic
1166304619 19:41930598-41930620 CTCCCAAAGGGTGTCCTGTGTGG - Intergenic
1166633608 19:44429745-44429767 CTCCCACAGGGGCTCTGGGGTGG + Exonic
1166905210 19:46103521-46103543 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
1166976752 19:46609427-46609449 CTCCCCAAGGGGATCTGGGGAGG - Exonic
1167550742 19:50159127-50159149 CTGCCAAATGGAGTAAGGAGTGG + Intronic
1168110045 19:54187116-54187138 GGCCCACAGGGAGGCTGGAGGGG + Intronic
926057087 2:9780063-9780085 CTCTCAAAGGCAGGCTGGTGAGG + Intergenic
929426487 2:41849679-41849701 CTTCCAAAGCTAGACTGGAGAGG - Intergenic
934227378 2:90145959-90145981 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
934776477 2:96940971-96940993 CTCCCCACTGGTGTCTGGAGAGG - Intronic
935273854 2:101459506-101459528 CTGGCAAACGGGGTCTGGAGTGG - Intronic
936119141 2:109726478-109726500 TTCACAAAGGGATCCTGGAGGGG - Intergenic
937265442 2:120612215-120612237 CTGCGAAAGGGATCCTGGAGAGG - Intergenic
942261837 2:174172604-174172626 CTGCCAAAGGTAGTCTAGAGAGG + Intronic
942385646 2:175439742-175439764 CTCCTAGAGGTGGTCTGGAGAGG - Intergenic
943175386 2:184466629-184466651 CTACAAAAGAGAGTCTTGAGGGG + Intergenic
945597396 2:211812312-211812334 CAGCCAAACAGAGTCTGGAGTGG - Intronic
946540443 2:220678589-220678611 CTCAGAAAGGTAGTCTGGGGTGG + Intergenic
946819296 2:223613670-223613692 ACCCCAAAGGGAATCTGAAGGGG - Intergenic
947392417 2:229652888-229652910 CTGCAAAAGGGAGCATGGAGAGG + Intronic
947544688 2:231002544-231002566 CTCCTAAGAGGAGTTTGGAGAGG + Intronic
947598718 2:231431181-231431203 CTCCAAAAGGGAGTCAAGAGTGG + Intergenic
947769474 2:232659536-232659558 CTCCCAAGGTCAGGCTGGAGAGG - Intronic
947819343 2:233059622-233059644 CACACAAAGGGAGCTTGGAGGGG - Intergenic
948049081 2:234965933-234965955 CTCGCAAATGGGGTCTGGAAGGG + Intronic
1169316173 20:4592665-4592687 CTCCCCAAGGCAGCCTGGAGTGG + Intergenic
1169646168 20:7812449-7812471 CAGGCAAAGGGAGTCTGGAGTGG - Intergenic
1175296799 20:57914084-57914106 CTCCCTCAGAGAGTCTAGAGGGG - Intergenic
1180235778 21:46458735-46458757 CTCCCAATGGGAGCCCGGAGCGG + Intergenic
1181344012 22:22203837-22203859 CTACTAGAGGGAGGCTGGAGAGG + Intergenic
1183003835 22:34883791-34883813 CTCCCCAAGGGACCCTGGAGGGG - Intergenic
1184045794 22:41971597-41971619 CTCCTCCAGGGAGTCTCGAGGGG - Intergenic
1184549373 22:45196367-45196389 CTGCCAAAGGGTGTCTGATGTGG - Exonic
1184935795 22:47719461-47719483 CTCCGAAACCGAGTCTGGAAGGG - Intergenic
950213859 3:11143629-11143651 CTCTACAAGGGAGACTGGAGGGG - Intronic
950320525 3:12048423-12048445 CTCCCAAAGGCCTCCTGGAGTGG + Intronic
950521627 3:13501100-13501122 CTGGCAAAGGGAGTAGGGAGTGG + Intronic
952297454 3:32073832-32073854 CTCCAAGAGGGAGTCAAGAGTGG - Intronic
952485801 3:33808394-33808416 CCCCCAAAGGGACTATGCAGCGG - Intronic
952792196 3:37208717-37208739 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
953207871 3:40847986-40848008 CTGCAGCAGGGAGTCTGGAGGGG + Intergenic
953765408 3:45737035-45737057 CTCCAAAGGGGAGTCTATAGAGG + Intronic
953840808 3:46388904-46388926 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
953917222 3:46927748-46927770 CTCCAAGAGTGAGTCTGGGGAGG - Intronic
954752297 3:52820509-52820531 CTCCCAGGGGGAGTCTGTTGGGG + Intronic
955348187 3:58176212-58176234 CTCCCCAAGGCAGACTGGAAGGG + Intergenic
958531347 3:95335440-95335462 CTCCCAGAGGGAGGCTGAAGCGG - Intergenic
959896220 3:111609856-111609878 CTGCCAAAGGTCCTCTGGAGTGG - Intronic
960662787 3:120079187-120079209 CTCCCAGAGGGAGACTGAGGAGG - Intronic
961000794 3:123372515-123372537 CTCAGAAAGGCAGACTGGAGTGG + Intronic
961362310 3:126375815-126375837 CTCCCAAAGTCAGACTGGAGTGG - Intergenic
962021875 3:131510434-131510456 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
964310929 3:155391606-155391628 GTCCCAAAGCCAGGCTGGAGAGG + Intronic
967083980 3:186077711-186077733 GTCCCCATGGGAGTGTGGAGCGG - Intronic
968408543 4:364619-364641 CAGGCAAAGAGAGTCTGGAGTGG - Intronic
968440809 4:623626-623648 CTGCCCAAGGGAGCGTGGAGTGG - Intergenic
969307046 4:6331813-6331835 CCACAACAGGGAGTCTGGAGAGG - Intronic
974565359 4:63573849-63573871 CTCCCAATCTGAGTCTAGAGAGG + Intergenic
975152464 4:71036037-71036059 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
975727669 4:77307715-77307737 CTCCCAAAGGGAGTTGGAAACGG + Intronic
977154577 4:93555956-93555978 CAGGCAAACGGAGTCTGGAGTGG + Intronic
978310653 4:107381958-107381980 GTCCCAATGGGGGTCTTGAGTGG - Intergenic
978955697 4:114609812-114609834 CATCCAAAGGGAGACTGAAGGGG + Intronic
980004672 4:127528134-127528156 CTAGCAAAAGAAGTCTGGAGTGG - Intergenic
981482558 4:145253842-145253864 CTCCAAAAGGGAGTCAAGAGTGG + Intergenic
982794441 4:159629016-159629038 CTGGCAAAGAGGGTCTGGAGTGG - Intergenic
985779554 5:1863052-1863074 TCCCCAAAGGGAGCCTGCAGGGG - Intergenic
985828163 5:2208040-2208062 CTCTGAAAGGGAGTGGGGAGAGG - Intergenic
988866482 5:35340537-35340559 GTCTCAAAGGGAGGCTGGGGTGG + Intergenic
989968114 5:50489245-50489267 CAGGCAAAGAGAGTCTGGAGTGG - Intergenic
990564720 5:57017665-57017687 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
994721471 5:103385479-103385501 CAGACAAAGAGAGTCTGGAGTGG - Intergenic
996725243 5:126668603-126668625 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
998602492 5:143599400-143599422 CACCTAAAGGAGGTCTGGAGTGG + Intergenic
999238443 5:150113785-150113807 TGCCCATAGGGAGTGTGGAGTGG - Intergenic
1000607409 5:163339430-163339452 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
1001397068 5:171425050-171425072 CCCCCAAAGGGAGACTAGAGGGG + Intronic
1002361067 5:178671297-178671319 CTCCCACAGGGCATGTGGAGAGG + Intergenic
1003984040 6:11417466-11417488 CTCCTCAAGGGCGGCTGGAGTGG + Intergenic
1005785997 6:29246677-29246699 CTCCAAGAGGGAGTCGAGAGTGG + Intergenic
1007075219 6:39061940-39061962 CTCCCCAAGGGAGTGAGGTGAGG - Intronic
1007281168 6:40713535-40713557 CTACCAAAGGGCTGCTGGAGGGG + Intergenic
1008564311 6:52752083-52752105 CTGCCCAAGGGAGATTGGAGCGG - Intronic
1008568620 6:52793363-52793385 CTGCCCAAGGGAGATTGGAGAGG - Intronic
1008573074 6:52833365-52833387 CTGCCCAAGGGAGATTGGAGAGG - Intronic
1008580038 6:52898328-52898350 CTGCCCAAGGGAGATTGGAGAGG - Intronic
1014036157 6:116768963-116768985 CTCCCAAAGGAAGGCCTGAGCGG + Intergenic
1017922299 6:158883054-158883076 CTCCAAGAGGGAGTCAAGAGTGG + Intronic
1018818726 6:167356240-167356262 CTCCTGAAGGGAGTCTCGGGTGG - Intronic
1019379749 7:714609-714631 CTACCAGAGCCAGTCTGGAGAGG - Intronic
1019582665 7:1774042-1774064 ATCCCAAAGGGAGGCTGAGGTGG - Intergenic
1023551018 7:41369900-41369922 CTCACAAGGGGATTCTGGAGAGG - Intergenic
1024372820 7:48606508-48606530 CACCCAAACAGGGTCTGGAGCGG - Intronic
1024666982 7:51557431-51557453 CAGGCAAAGAGAGTCTGGAGTGG - Intergenic
1025790194 7:64681342-64681364 CACACAAGTGGAGTCTGGAGAGG - Intronic
1026945754 7:74314919-74314941 TTACAAAAGGGACTCTGGAGAGG - Intronic
1027393563 7:77729347-77729369 CTCCCAAGGTGAGTCAGTAGTGG - Intronic
1029161113 7:98552705-98552727 TTTCCAAAGGGAGGCTGGTGCGG + Intergenic
1029893585 7:103957987-103958009 CTGCCAAAGGGAGCCTGAAGGGG - Intronic
1033999724 7:147398322-147398344 CTCCCAAAGGAAGCCTACAGTGG + Intronic
1038054216 8:23843063-23843085 CTACCTAAGCGAGTTTGGAGTGG + Exonic
1038929962 8:32182568-32182590 GGCCCAAAGGAAGTCTGGTGTGG + Intronic
1039742936 8:40398558-40398580 CTCCCTGAGGCAGGCTGGAGAGG + Intergenic
1041584934 8:59505376-59505398 CTCCAAAAGGGAGGAAGGAGGGG + Intergenic
1044303429 8:90610833-90610855 CTCCCAGAAGGAGTCTAGAGTGG - Intergenic
1044514127 8:93118923-93118945 CTCCCAAAGAGAATTTGAAGTGG + Intergenic
1046075387 8:109306210-109306232 CTCCAAGAGGGAGTCAAGAGTGG - Intronic
1046210158 8:111061959-111061981 TTCCCACAGGGAGTTTGGATAGG + Intergenic
1046965024 8:120154523-120154545 ATCCCAAAGGGAGACTGAGGGGG - Intronic
1048065629 8:130965327-130965349 CTCCAAAAGGGAGGATGGAGGGG + Intronic
1048807042 8:138250648-138250670 GTCCCAAAGGGAGACTGGTGTGG - Intronic
1049353710 8:142177533-142177555 ACCCCAAGGGGGGTCTGGAGGGG + Intergenic
1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG + Intergenic
1052640422 9:31160210-31160232 CAGGCAAACGGAGTCTGGAGTGG - Intergenic
1052716779 9:32127326-32127348 CCCTCAAAGGGAGATTGGAGAGG + Intergenic
1053078132 9:35152382-35152404 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
1053127251 9:35592290-35592312 GTCCCAAAGGGAATGTGGGGAGG - Intergenic
1056176683 9:84043371-84043393 CAGGCAAAGAGAGTCTGGAGTGG - Intergenic
1056459306 9:86793900-86793922 CTCTCAAAGGGATTCTGAGGCGG + Intergenic
1056990185 9:91403415-91403437 CACCCACAGGGAGTCTGCATTGG + Intergenic
1057564565 9:96156378-96156400 CTCCCAGAGGGAGGAAGGAGGGG - Intergenic
1059753846 9:117274045-117274067 CTCCCAACAAAAGTCTGGAGTGG + Intronic
1061830667 9:133292027-133292049 TTCCCAAAAGGAGCCTAGAGAGG + Intergenic
1061950984 9:133935700-133935722 CTTCCAAATGGAGTCTGGCCTGG - Intronic
1062436397 9:136548325-136548347 CTCCCATTGGGTTTCTGGAGTGG - Intergenic
1062657583 9:137612284-137612306 CTCCCCCAGGGAGGCCGGAGAGG + Intronic
1062672111 9:137717061-137717083 CTCCCCAAGGGTGGCTGGTGGGG - Exonic
1186692725 X:11996333-11996355 GTTCAAAAGGGTGTCTGGAGAGG - Intergenic
1187020476 X:15376151-15376173 CTCCCTCAGAGAGTCAGGAGTGG - Intronic
1187103425 X:16218034-16218056 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
1191013856 X:55789524-55789546 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
1191187089 X:57624440-57624462 CAGGCAAAGAGAGTCTGGAGTGG + Intergenic
1192455340 X:71271181-71271203 CTCCAAGAGGGAGTCAAGAGTGG - Intergenic
1192935730 X:75857189-75857211 CTCCAAGAGGGAGTCAAGAGTGG + Intergenic
1195853050 X:109303961-109303983 CTCCTAGAGGCAGTCTGGATTGG + Intergenic
1196368968 X:114954073-114954095 TTCCCATAGGGAGTGTGGATTGG + Intergenic
1196811635 X:119633661-119633683 TGCCCACAGGGATTCTGGAGGGG + Intronic
1197136881 X:123071694-123071716 CTGCCAGAGGGAGTCTAGGGAGG + Intergenic
1197226418 X:123960492-123960514 CTCCCAACGGGAGCCGGGCGCGG + Intronic