ID: 1118821468

View in Genome Browser
Species Human (GRCh38)
Location 14:69348935-69348957
Sequence CTGCTTGCACCGACTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118821468_1118821473 -7 Left 1118821468 14:69348935-69348957 CCTGCCTCAGTCGGTGCAAGCAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1118821473 14:69348951-69348973 CAAGCAGTGAGGAGGGTGCCTGG 0: 1
1: 0
2: 6
3: 37
4: 442
1118821468_1118821474 -6 Left 1118821468 14:69348935-69348957 CCTGCCTCAGTCGGTGCAAGCAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1118821474 14:69348952-69348974 AAGCAGTGAGGAGGGTGCCTGGG 0: 1
1: 0
2: 0
3: 46
4: 391
1118821468_1118821477 15 Left 1118821468 14:69348935-69348957 CCTGCCTCAGTCGGTGCAAGCAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1118821477 14:69348973-69348995 GGTCTCTGATTTGGCCTGCATGG 0: 1
1: 0
2: 1
3: 15
4: 144
1118821468_1118821475 6 Left 1118821468 14:69348935-69348957 CCTGCCTCAGTCGGTGCAAGCAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1118821475 14:69348964-69348986 GGGTGCCTGGGTCTCTGATTTGG 0: 1
1: 0
2: 1
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118821468 Original CRISPR CTGCTTGCACCGACTGAGGC AGG (reversed) Intronic
900335844 1:2163033-2163055 CTGGTTGCAGCGGCTGAGGTGGG - Intronic
900965258 1:5952916-5952938 CTGCAGGCCCCGGCTGAGGCTGG - Intronic
904630428 1:31837870-31837892 CTGCCTGCACCACCTCAGGCAGG - Intergenic
907735951 1:57112316-57112338 CTGCATGCACTGACTCAGGAAGG - Intronic
908809485 1:67965181-67965203 CTCCTTGCACCCACTTAGGTGGG + Intergenic
919962616 1:202486694-202486716 CTACTTGCAAAGGCTGAGGCGGG + Intronic
924803947 1:247347924-247347946 CTGCTTGCACTTACTGGGGATGG - Intergenic
1063987266 10:11518224-11518246 CTGATTTCACAGACTGAGGTGGG + Intronic
1071478795 10:86047307-86047329 CTGCTTACACAGACTGGAGCTGG + Intronic
1072461971 10:95627577-95627599 CTGCTTTCACCTAATGAGACAGG + Exonic
1078062326 11:8056063-8056085 CTGCTGGAGCCGCCTGAGGCTGG + Intronic
1082091909 11:48097148-48097170 CTGCGTGGACCCACTGAGGAAGG + Intronic
1083934934 11:65865216-65865238 CTTCTCGCACCGACTGGGCCTGG - Exonic
1084459010 11:69285934-69285956 CTGCTAGGCCAGACTGAGGCAGG - Intergenic
1085338731 11:75717724-75717746 CTCCTTGCCCCTGCTGAGGCAGG - Intergenic
1087656972 11:100936009-100936031 CTGCTTGTGGGGACTGAGGCAGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091646744 12:2277969-2277991 CTCTTAGCACAGACTGAGGCTGG + Intronic
1095889625 12:47223414-47223436 TTGCTTGCACTGACTGGGTCTGG - Intronic
1101491517 12:105214072-105214094 CTGCTTGGAAAGGCTGAGGCAGG + Intronic
1102568721 12:113814404-113814426 CTGCTTGAACCCAGAGAGGCAGG + Intergenic
1102953687 12:117046261-117046283 CTGTGAGCACTGACTGAGGCCGG + Intronic
1104730873 12:131104663-131104685 TTGCTGCCACCGACAGAGGCCGG - Intronic
1105769151 13:23591835-23591857 CTACTTGCAAGGGCTGAGGCAGG - Intronic
1108477834 13:50838853-50838875 CTGCTTGCACGCACTGCGGACGG + Intronic
1112243010 13:97701170-97701192 CTGCTTGTACCTTCTGAGTCTGG - Intergenic
1114007524 14:18331111-18331133 CTTCTTGCCCAGGCTGAGGCTGG - Intergenic
1114569342 14:23655262-23655284 CTGCTTGCACAGACATAGACTGG - Intergenic
1118821468 14:69348935-69348957 CTGCTTGCACCGACTGAGGCAGG - Intronic
1119772386 14:77228337-77228359 CCTCTTGCACTGCCTGAGGCGGG - Intronic
1120092019 14:80342889-80342911 CAGCTTGAACTGACTAAGGCAGG + Intronic
1122389011 14:101367768-101367790 CTGCTTTCATCCTCTGAGGCTGG - Intergenic
1122448980 14:101788243-101788265 CAGCATGCACTGGCTGAGGCGGG - Intronic
1122634601 14:103124049-103124071 CTGGTTGGGCCCACTGAGGCAGG - Intronic
1123032191 14:105457135-105457157 CTGCTTGCAGAGTCTGAGCCTGG + Intronic
1123391445 15:19877760-19877782 CTTCTTGCCCAGGCTGAGGCAGG - Intergenic
1127402453 15:58603280-58603302 CTGCTTTGACAGACTGAGGGTGG - Intronic
1127797786 15:62453461-62453483 CTGCTAGCAGGGACTGAGGGAGG + Intronic
1128122132 15:65158574-65158596 CTGCTTGGACCAACTGGGTCAGG - Exonic
1128242262 15:66109064-66109086 CTGCTGGCACTCACTGAGGGTGG + Intronic
1128556486 15:68635306-68635328 CTATTTGCAGCCACTGAGGCTGG - Intronic
1136566510 16:31073698-31073720 CTCCTCGCACCGACGGAGCCCGG + Intronic
1142622892 17:1176166-1176188 CTGTCTGAACCCACTGAGGCTGG - Intronic
1142713875 17:1737674-1737696 CTCCTGGCATAGACTGAGGCAGG + Exonic
1150157686 17:62868017-62868039 CTGGTTGCACAGCCTCAGGCAGG + Intergenic
1152299681 17:79487798-79487820 CTGCTTGGAGAGGCTGAGGCAGG + Intronic
1153526371 18:5998477-5998499 CTGCTTGCTCAGGCTGAGGGTGG + Intronic
1154529945 18:15332858-15332880 CTTCTTGCCCAGGCTGAGGCTGG + Intergenic
1157493541 18:48139711-48139733 CAGCTGGCACCGAGGGAGGCTGG - Intronic
1160009066 18:75089940-75089962 CTGCGTGCCCCGCCTGTGGCAGG - Intergenic
1160870649 19:1276256-1276278 CTGCTTCTACCCACTGAAGCTGG + Intronic
1162651550 19:12092524-12092546 CTGCTGGAACCGGCTGTGGCGGG + Intronic
1163536295 19:17878586-17878608 CTGCTCACACCTACTGAGGGCGG - Intronic
1163617838 19:18340398-18340420 CCGCTTGCACGCACTGAGCCAGG - Intergenic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1164479723 19:28602171-28602193 CTGCCTGCACCAAGTCAGGCTGG + Intergenic
1166084413 19:40465610-40465632 CTGCTTGCACCGCCTGCGCCAGG + Exonic
1167109804 19:47453376-47453398 CTGCCTGCTCAGACTGAGGCAGG + Intronic
925907605 2:8548508-8548530 CTGTTTGCACCTAGTGGGGCAGG - Intergenic
926166876 2:10526559-10526581 CTGCTAGCACCTCCCGAGGCTGG + Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
933553245 2:83802172-83802194 CTGCTTGGAGAGGCTGAGGCAGG - Intergenic
935528684 2:104205484-104205506 CTACTTGCTGAGACTGAGGCAGG - Intergenic
935797078 2:106653387-106653409 CTCTTTGCTACGACTGAGGCTGG - Intergenic
935944013 2:108269896-108269918 CAGCTTGAGCCGACTGAGGTGGG - Intergenic
938529044 2:132164318-132164340 CTTCTTGCCCAGGCTGAGGCTGG + Intronic
938560664 2:132469650-132469672 CTGATTGCACTGTCTGGGGCAGG - Intronic
948298805 2:236886433-236886455 CTGTTTGCACTGACTGTGGCTGG + Intergenic
948855273 2:240727407-240727429 CTCCTTACTCAGACTGAGGCTGG - Intronic
948902429 2:240963355-240963377 CGGCTTCCACGGGCTGAGGCAGG - Intronic
1171146469 20:22788186-22788208 CTGCTGGGAGAGACTGAGGCTGG - Intergenic
1175696755 20:61108449-61108471 CTGCTTGCACCAGCTCCGGCGGG - Intergenic
1176767466 21:13035616-13035638 CTTCTTGCCCAGGCTGAGGCTGG - Intergenic
1179461114 21:41536031-41536053 CTGCTGGCACCCACTCAGGGTGG - Intergenic
1179556305 21:42179426-42179448 CTGCTGGGACCTACTGAGGAGGG + Intergenic
1180432031 22:15261916-15261938 CTTCTTGCCCAGGCTGAGGCTGG - Intergenic
1180514595 22:16129845-16129867 CTTCTTGCCCAGGCTGAGGCAGG - Intergenic
1182399246 22:30061849-30061871 CTACTTGCGGGGACTGAGGCAGG + Intergenic
1182862243 22:33570195-33570217 TTGCTTGCCCCGCATGAGGCTGG - Intronic
1183349871 22:37329189-37329211 CTGCAGCCACCGACTGATGCTGG + Intergenic
1184978421 22:48079487-48079509 CTACTTGGAGAGACTGAGGCAGG + Intergenic
952774460 3:37031426-37031448 CTGATTCCATCGACTGAGGCTGG + Intronic
953613841 3:44471972-44471994 CTGCTGGCACGCACCGAGGCTGG - Intronic
953916958 3:46926490-46926512 CTGCCTGAAAAGACTGAGGCAGG - Intronic
959129810 3:102340459-102340481 ATGCTGGCCCAGACTGAGGCTGG + Intronic
960613290 3:119574279-119574301 CTTCTTGCACCTACAGAGGTAGG - Intergenic
961504832 3:127363039-127363061 CTGCTTGCACCTTCCGGGGCTGG - Intergenic
961677700 3:128577721-128577743 CTGCTTCCTCCTACTCAGGCAGG + Intergenic
966054002 3:175659896-175659918 CAGCCTGAACAGACTGAGGCAGG - Intronic
967767342 3:193295786-193295808 CAGCATGCAGCGAATGAGGCAGG - Intronic
969338591 4:6526845-6526867 CTGATTGCACTTAATGAGGCTGG - Intronic
982265966 4:153538615-153538637 CTGCTTGCCCTGAGGGAGGCGGG - Intronic
985747863 5:1657321-1657343 CTGCTGGCACTGCCAGAGGCTGG - Intergenic
986199887 5:5570843-5570865 CTCCAAGCACCCACTGAGGCAGG - Intergenic
998211507 5:140202546-140202568 TTGTTGGCACCTACTGAGGCTGG + Intronic
999601633 5:153272568-153272590 CTTTTTGCACTGACTGAGGCCGG + Intergenic
1002297424 5:178239294-178239316 CTGCTGGGCCCCACTGAGGCAGG + Intronic
1003881892 6:10486625-10486647 CTGCTAGCAGAGGCTGAGGCAGG + Intergenic
1004002400 6:11607266-11607288 CAGTTTGCACCGATTGGGGCAGG + Intergenic
1005581743 6:27241749-27241771 CTGCTTGCACACACAGAGGAGGG - Intergenic
1006097299 6:31664090-31664112 CTGCTGGAACCGCATGAGGCAGG - Exonic
1017024132 6:150166704-150166726 CTGCTTCCTCCTCCTGAGGCAGG - Intronic
1022095358 7:27137439-27137461 CTTCTGCCACCGGCTGAGGCTGG + Intronic
1022201949 7:28125762-28125784 ATGCTTGCACTGAGTGAGGGTGG - Intronic
1027751195 7:82149076-82149098 CTGAGTACACAGACTGAGGCAGG - Intronic
1029145065 7:98439921-98439943 CTGCTTGCATCCTCTGGGGCAGG - Intergenic
1032171501 7:129588192-129588214 CTACTTGCAGGGGCTGAGGCAGG + Intergenic
1048988839 8:139749746-139749768 CTGCTTGAACCGCCAGAGCCGGG + Intronic
1052636517 9:31113153-31113175 CTGCTTGCACAGATTGCTGCTGG - Intergenic
1053707639 9:40770613-40770635 CTTCTTGCCCAGGCTGAGGCTGG + Intergenic
1054417552 9:64891399-64891421 CTTCTTGCCCAGGCTGAGGCTGG + Intergenic
1062320026 9:135986320-135986342 CTGCTGGCACTGGCTGTGGCAGG - Intergenic
1188648015 X:32593103-32593125 CTCCTTGCACCCACTCAGCCTGG - Intronic
1189080338 X:37964357-37964379 CAGCTTGCACAGACTTAGGTAGG + Intronic
1189108967 X:38267174-38267196 CTGCTAGCACCCAGTGAGCCTGG - Intronic
1190881267 X:54494506-54494528 CTGCTTCCCCAAACTGAGGCTGG - Intronic
1192611835 X:72574582-72574604 CTACTTGGACAGGCTGAGGCAGG - Intergenic
1193151130 X:78125573-78125595 CTCCTGGCATCCACTGAGGCGGG + Intronic
1194685442 X:96908708-96908730 CTGCTTGGAGAGGCTGAGGCAGG - Intronic
1195873884 X:109517713-109517735 CTACTTGCAGGGGCTGAGGCAGG - Intergenic