ID: 1118822684

View in Genome Browser
Species Human (GRCh38)
Location 14:69355389-69355411
Sequence GGTGGGCTGTGCTCCCTGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118822684_1118822687 -5 Left 1118822684 14:69355389-69355411 CCTCTCAGGGAGCACAGCCCACC 0: 1
1: 0
2: 3
3: 29
4: 263
Right 1118822687 14:69355407-69355429 CCACCACCCACCGCCTACTCAGG 0: 1
1: 0
2: 1
3: 22
4: 283
1118822684_1118822688 -4 Left 1118822684 14:69355389-69355411 CCTCTCAGGGAGCACAGCCCACC 0: 1
1: 0
2: 3
3: 29
4: 263
Right 1118822688 14:69355408-69355430 CACCACCCACCGCCTACTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 152
1118822684_1118822693 7 Left 1118822684 14:69355389-69355411 CCTCTCAGGGAGCACAGCCCACC 0: 1
1: 0
2: 3
3: 29
4: 263
Right 1118822693 14:69355419-69355441 GCCTACTCAGGGCTCCCTCCTGG 0: 1
1: 1
2: 2
3: 17
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118822684 Original CRISPR GGTGGGCTGTGCTCCCTGAG AGG (reversed) Exonic
900207498 1:1437891-1437913 GGTGCCCTGTGCTCTCTGGGGGG - Intronic
900238680 1:1604557-1604579 GGTGGCCTGGGCTTCCTCAGGGG - Intergenic
900884415 1:5404739-5404761 GGTGGAATGTGGTCCCTGGGTGG - Intergenic
900884466 1:5404907-5404929 GGTGGAATGTGGTCCCTGGGAGG - Intergenic
900884475 1:5404937-5404959 GGTGGAATGTGGTCCCTGGGAGG - Intergenic
900884484 1:5404967-5404989 GGTGGAATGTGGTCCCTGGGAGG - Intergenic
901079427 1:6575417-6575439 GATTGGCTGTTCTCCCTGACAGG - Intronic
901373237 1:8817961-8817983 GGTGGGCTGGGCTCCCGCCGCGG + Intergenic
903071809 1:20730495-20730517 GGTGGGCTGGGGCCCCTAAGAGG - Intronic
903072097 1:20731707-20731729 GGTGGGCCGAGGCCCCTGAGGGG + Intronic
903678322 1:25080539-25080561 GCTGGGCTGTGCTGACTCAGTGG + Intergenic
904327879 1:29739230-29739252 GGTGGGACCTGCTCCCTGATGGG + Intergenic
904908602 1:33917081-33917103 GCGGGGCTGTGCTCCAGGAGTGG - Intronic
905220011 1:36439033-36439055 GGTGAGATCAGCTCCCTGAGGGG + Intronic
905869424 1:41394689-41394711 GAGGGGCTGTGCTCCCAGCGAGG - Intergenic
906538244 1:46564289-46564311 GGAGAGCTGTTCTCCCTGACTGG - Intronic
906955687 1:50371691-50371713 GGCTGGCTGTGGTCCCTGAGTGG - Intergenic
909561702 1:77015479-77015501 GGTGGACTGTGAGCCCTGTGAGG - Intronic
909957053 1:81791105-81791127 GGAGGGCAGTGCTTCCTAAGAGG + Intronic
910374505 1:86553543-86553565 GGCGGGCGCTCCTCCCTGAGCGG - Intronic
911368612 1:96970510-96970532 AGAGGGCTGTGTTGCCTGAGGGG - Intergenic
911588035 1:99713865-99713887 GCAGGGCTGGGCTCTCTGAGAGG + Intronic
913125934 1:115790379-115790401 GGTGGGGTGTGCTCTGTGTGGGG - Intergenic
914668027 1:149848392-149848414 GGTTGGCTGAACTCCATGAGTGG + Intronic
919926537 1:202194474-202194496 GGTGGGTTCTGGACCCTGAGCGG + Intronic
920445533 1:206013351-206013373 GGTGGTCAGTGCTCCAAGAGAGG - Intronic
1062929745 10:1344995-1345017 GGGCAGCTGTGTTCCCTGAGGGG - Intronic
1063423527 10:5933529-5933551 GGTGGGCTGTCTGCCCTCAGGGG + Intronic
1069557568 10:69407919-69407941 GGAGGCCAGTGCTCCATGAGGGG + Intronic
1072797217 10:98365243-98365265 GGTGGCCTGTGAGCCCTCAGAGG - Intergenic
1073543906 10:104333511-104333533 GGGGGGATGTGCTCTCTGTGGGG + Intronic
1076514274 10:131034373-131034395 TGTGTGCTGTGCTCCCTACGTGG - Intergenic
1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG + Intronic
1077084584 11:742628-742650 AGTGGGCGGTGCTCCCTTTGTGG + Intergenic
1077230626 11:1456839-1456861 GAGGGGCTCTGCTCCCTGAGGGG - Intronic
1077488339 11:2849355-2849377 GGTGGGGCCTGCTCCCAGAGTGG - Intergenic
1078152595 11:8772093-8772115 GGAGGGTGGTGCACCCTGAGAGG + Intronic
1079255051 11:18820593-18820615 GGTGGTGTGTGCTCCCAGTGAGG + Intergenic
1081466133 11:43319551-43319573 GGTGGTCTGTGCTGCTTGGGAGG - Intronic
1084330714 11:68428433-68428455 GGAGGGCTGTGCTTCCTCTGGGG + Intronic
1084472050 11:69368233-69368255 GGGTGGCAGTGTTCCCTGAGGGG - Intergenic
1085210576 11:74773949-74773971 TGTGGTATGTGCTCCATGAGGGG - Intronic
1088720842 11:112590597-112590619 TGAGGGAGGTGCTCCCTGAGAGG + Intergenic
1088720885 11:112590767-112590789 TGAGGGAGGTGCTCCCTGAGGGG + Intergenic
1089796686 11:120986435-120986457 GGTGGACCCTGCTCCCTGACCGG - Exonic
1090185698 11:124737996-124738018 GAAGGGCTGTGCTGCCTGTGTGG + Intergenic
1091408934 12:226582-226604 GAGGGGCTGTGCTCCCAGACAGG - Intronic
1093164789 12:15791776-15791798 GGATGGCGGTGCTCCCAGAGAGG + Intronic
1094055830 12:26268859-26268881 GGAGGGCTGTCCACCCAGAGAGG - Intronic
1096193671 12:49635397-49635419 TCTGGGCTGTGGTCCCTGAGAGG + Exonic
1099684648 12:85869152-85869174 GATGGCCTATGCTACCTGAGTGG - Intergenic
1102953600 12:117045812-117045834 GGTGTCGTGTGTTCCCTGAGGGG - Intronic
1103730374 12:123023221-123023243 TGAGGGCTGTGCTCCCTGTGAGG + Intronic
1103987951 12:124779910-124779932 GGTGTCCTGTGCTGCCTCAGTGG - Intronic
1104916675 12:132269142-132269164 GGTGGGCTGTGCAGCCAGGGAGG + Intronic
1105866020 13:24460477-24460499 GGTGGGCTCTGCTGCATGGGTGG + Intronic
1105866024 13:24460495-24460517 GGTGGGCTCTGCTGCATGGGTGG + Intronic
1106565783 13:30883517-30883539 GGTGGGCTGCACCCACTGAGGGG - Intergenic
1106628044 13:31441374-31441396 GGCAGGCTGTGCTCCCAGAAAGG - Intergenic
1107416957 13:40209848-40209870 GGTGGGATGTGGTCATTGAGAGG + Intergenic
1112576724 13:100642815-100642837 GGTCTGCTCTGCTCCCTGTGTGG + Intronic
1113505068 13:110811086-110811108 GGTGTTCTGTGCTCCCTGCTGGG + Intergenic
1113768501 13:112894806-112894828 GGTGGGCAGAGCTCCCGGGGTGG - Intronic
1113778443 13:112962411-112962433 GGTGGGTTGCGGTCCCTGTGTGG + Intronic
1117040752 14:51766862-51766884 GGTCCACTGTCCTCCCTGAGTGG + Intergenic
1117160689 14:52986567-52986589 GGTGGGCTGTACTAACTGACAGG + Intergenic
1118822684 14:69355389-69355411 GGTGGGCTGTGCTCCCTGAGAGG - Exonic
1119519879 14:75277769-75277791 GGCGGGGTGTGCTTCCTGCGGGG - Intergenic
1119730269 14:76946963-76946985 GGTGGGATGTGTACCCCGAGAGG - Intergenic
1119901825 14:78267330-78267352 TGAGGGCTGGGCTCACTGAGAGG - Intronic
1122265491 14:100544794-100544816 GCTGCCCTGTGCTGCCTGAGTGG - Intronic
1122439061 14:101717811-101717833 GCAGGGCTGTGCTCCCTCTGAGG + Intergenic
1202899239 14_GL000194v1_random:26162-26184 GGTGGGCAGAAATCCCTGAGGGG - Intergenic
1202889915 14_KI270722v1_random:146531-146553 ATTGGGCTGTGTGCCCTGAGAGG - Intergenic
1123499371 15:20866418-20866440 GGTGGGCTGGGCTCCCTTGCTGG - Intergenic
1123556623 15:21440148-21440170 GGTGGGCTGGGCTCCCTTGCTGG - Exonic
1123592845 15:21877383-21877405 GGTGGGCTGGGCTCCCTTGCTGG - Intergenic
1123783049 15:23645778-23645800 GGAGGGCGGGGCTCCCTGAAAGG + Exonic
1123977900 15:25570207-25570229 CCAGGGCTGTGCTCCCTGATGGG - Intergenic
1126637755 15:50795568-50795590 GGAGGGTGCTGCTCCCTGAGGGG + Intergenic
1128568849 15:68718820-68718842 GCTGGGCTGGGCTCCAGGAGGGG + Intronic
1128673241 15:69590273-69590295 TGTGGGCTGAGGTCCCTCAGTGG - Intergenic
1129109545 15:73329513-73329535 GGTGGCCTGTGCTCCCTCTTGGG + Intronic
1130173759 15:81546343-81546365 TGTTGGCTTTGCTTCCTGAGAGG + Intergenic
1130872059 15:87979285-87979307 GGTAGGCTGGGCCCTCTGAGAGG - Intronic
1131078598 15:89515060-89515082 GGTGGGCTGGGCTGCCAGGGAGG + Intergenic
1131256017 15:90863008-90863030 AGTGGGCAGTGCTCTCTAAGGGG - Intergenic
1202964962 15_KI270727v1_random:167337-167359 GGTGGGCTGGGCTCCCTTGCTGG - Intergenic
1132517010 16:370498-370520 GGTGGGCTCTGAACCCTGAAAGG - Exonic
1132840142 16:1974882-1974904 GGTGAGCTGTGCAGCCTGGGTGG - Intronic
1133297802 16:4763627-4763649 GGCAGGCTGTGCTCCCCAAGGGG - Intronic
1133517576 16:6524689-6524711 GCTGGGCCATGCTCCCTGTGAGG + Intronic
1134031648 16:10996735-10996757 GGTGGACTGTGGGCTCTGAGAGG + Intronic
1134031654 16:10996758-10996780 GGTGGACTGTGGGCTCTGAGAGG + Intronic
1134126791 16:11621634-11621656 CGTGGGTTGTGCTTCCTGAGGGG - Intronic
1134426741 16:14156111-14156133 GCAGGGCTGTGGCCCCTGAGAGG - Intronic
1134602046 16:15541268-15541290 GGAGGGCAGTGCACCCAGAGAGG - Intronic
1136498024 16:30655671-30655693 GCTGGACTGTGCTCCCTGAGGGG - Intronic
1137476666 16:48815163-48815185 GCTTGGCTGTGCTCCCTGGGTGG + Intergenic
1138385425 16:56632899-56632921 GGAGGGCAGTGCTCTCAGAGGGG - Intronic
1138520912 16:57570410-57570432 GGAGGGCTGGGGCCCCTGAGGGG - Exonic
1138815030 16:60194058-60194080 GGAGGGCAGTGCTCCCTGAGAGG - Intergenic
1139561855 16:67748152-67748174 GGTGGGCTGTGATCGTTGACTGG + Intronic
1141575378 16:84959985-84960007 GTGGGGCTGTGCTCCCTCTGGGG - Intergenic
1141841132 16:86574816-86574838 CGTGGGCTGTGGTCCCTGTGCGG + Intergenic
1141886359 16:86895085-86895107 GCAGGGCTGTGCTCCCTCTGAGG - Intergenic
1142049781 16:87950935-87950957 GGTGGGCTGTGCGCCCCCAGCGG - Intronic
1142228494 16:88888614-88888636 GGTGGGGGCTGCTCCCTGGGTGG + Intronic
1142469626 17:156084-156106 GGGGCGCTGTGTTCCCTGATGGG - Intronic
1142877088 17:2857730-2857752 GGGGAGCTTGGCTCCCTGAGGGG + Intronic
1142986156 17:3696329-3696351 GGGGGGCTGCGCTCCCAGACCGG - Exonic
1143639670 17:8188970-8188992 GGTGGGAAGTGCCCACTGAGGGG - Exonic
1144202250 17:12952179-12952201 CATGGGCTGAGCTCCCTGACTGG + Intronic
1144263673 17:13547547-13547569 GGGAGGCTGTGCACCCAGAGAGG + Intronic
1144501147 17:15787234-15787256 GGGGGGCTGGCCTCCCAGAGTGG + Intergenic
1145238771 17:21227303-21227325 GGAGGGCCGTGTTCCCTGAGAGG + Intergenic
1145813982 17:27782328-27782350 GGTTGCCTGTGCTCCCCTAGAGG - Intronic
1147580616 17:41625388-41625410 GGTGGGCTGTGCCAACTGAGAGG + Intergenic
1147850348 17:43437586-43437608 GGTGGCCTGTGCTACTTGGGAGG - Intergenic
1147925033 17:43940938-43940960 AGCGGGCTGAGCTCCCTGTGAGG + Exonic
1148454302 17:47802701-47802723 GGTGGGCTGGGCTCTGGGAGGGG - Intergenic
1150447892 17:65241751-65241773 GCAGGGCTGTGCTCCCTCTGAGG - Intergenic
1151447966 17:74179530-74179552 GAAGGGCTGTGCTCCCTCTGAGG - Intergenic
1151482649 17:74379519-74379541 GGTGGCCTGAGCTCCCTGGCGGG + Intergenic
1151577601 17:74960508-74960530 CGTGGGCTCTGCTCCCTGAGGGG - Intronic
1152092733 17:78256144-78256166 GGGTGCCTGTGCTCCCTGTGTGG - Intergenic
1152394365 17:80023555-80023577 AGTGGGCTGTGCGCTCTAAGTGG - Intronic
1152685579 17:81692247-81692269 TGTGGGCCGTGCTCCCTGCTTGG + Intronic
1152918086 17:83052210-83052232 TGTGGGCTGTGCTACTTGACCGG + Intergenic
1153677298 18:7467236-7467258 GGTGGCCTGTCTTCCCTCAGTGG - Intergenic
1153771527 18:8420776-8420798 GCTGAGCTCTGCTCCCTGACAGG - Intergenic
1156759320 18:40568481-40568503 TGAGGGCTTTGCTCCATGAGTGG + Intergenic
1157479161 18:48042051-48042073 TGTGAGCTGTGCTTCCTGAAAGG - Intronic
1157543530 18:48530917-48530939 GGGCTGCTGTGCTCCCTGTGGGG - Intergenic
1158598634 18:58838318-58838340 GATGGGCTTTGGTCCCAGAGGGG + Intergenic
1159935448 18:74363230-74363252 GATGAGCTGTGGTCCATGAGAGG - Intergenic
1160291734 18:77600929-77600951 TGTGGGCTGTGCTCTCTAACAGG + Intergenic
1160401617 18:78614547-78614569 GGTGGGATGTACTCCCTCACTGG + Intergenic
1160401639 18:78614631-78614653 GGTGGGATGTACTCCCTCACTGG + Intergenic
1160829040 19:1094337-1094359 GGAGGGCTTTGCTCCCTGCCAGG - Intronic
1161343381 19:3754461-3754483 AGTGGGCTGTGCTTCCTGGCTGG - Intronic
1161430439 19:4229326-4229348 GGTGGCCTGTGCTCCCCAGGGGG + Intergenic
1161694350 19:5757758-5757780 GGTGTGCTGGGCTCACTGTGGGG + Intronic
1162223345 19:9198458-9198480 GGTCCGCTGTCCTCCCTGCGTGG - Intergenic
1162228767 19:9247452-9247474 GGTCCGCTGTCCTCCCTGTGTGG - Intergenic
1164883809 19:31760232-31760254 GGTGGGCTGGCCTTCCTGTGGGG - Intergenic
1165233815 19:34404641-34404663 GGTGGGCAGAGCATCCTGAGGGG - Exonic
1165658013 19:37550533-37550555 GGTGGGTTGTGATCCCGGTGTGG + Intergenic
1166217511 19:41345164-41345186 TGTGGGCTGTCCACGCTGAGTGG - Intronic
1166313603 19:41976394-41976416 GGTGGGCTGCGCTCCCGCAGAGG - Exonic
1167512574 19:49903535-49903557 TGAGGGCTTTGCTCCCTGGGAGG + Intronic
1202665328 1_KI270708v1_random:113354-113376 ATTGGGCTGTGTGCCCTGAGAGG - Intergenic
926097815 2:10093874-10093896 GGTGTGCTGGGCACCCTGTGAGG + Intergenic
926924252 2:17970926-17970948 GGTCTGCTCTGCTCTCTGAGAGG - Intronic
928603968 2:32927161-32927183 TGTGGGCTGTGCTCTCAGGGAGG + Intergenic
929580756 2:43080570-43080592 GGCGGGCTTTGCTCTCTGAGGGG + Intergenic
929961287 2:46498130-46498152 TGAGGGCTGACCTCCCTGAGGGG - Intronic
930530493 2:52582483-52582505 AGTGGTCTGTGCTCCCTGCTTGG - Intergenic
932330954 2:70898032-70898054 GCTGGGCAGTGCTCCCTGCAAGG + Intergenic
932733750 2:74239636-74239658 GGGGGGCTGGGGTCCCTCAGAGG - Intronic
932779282 2:74549774-74549796 GATGTGCTGTGCTCCCAGAGAGG + Intronic
933937667 2:87219427-87219449 GCAGAGCTGTGGTCCCTGAGAGG + Intergenic
934495255 2:94790228-94790250 GCTGGCCTGTGCTTCCTCAGTGG + Intergenic
936355472 2:111746346-111746368 GCAGAGCTGTGGTCCCTGAGAGG - Intergenic
936519722 2:113204147-113204169 GCTGAGCTGTGCTCCCTGAAAGG + Intronic
936813779 2:116434293-116434315 GGTGGGATGTACTCACTGGGAGG - Intergenic
937329297 2:121015888-121015910 TCTGGGCTGTGCTCCCTGCAGGG + Intergenic
937891564 2:126943006-126943028 GGTGGGACGGGCTCCCTCAGGGG + Intergenic
937908335 2:127063532-127063554 GGTGGGGTGTGGCCCCTCAGAGG + Intronic
943980170 2:194539568-194539590 TGTGGGCTGGGCTCCCAGAATGG - Intergenic
946538643 2:220659295-220659317 GGTTGGCTGTGGTCCCTGGATGG - Intergenic
946664794 2:222037313-222037335 CTTTTGCTGTGCTCCCTGAGAGG - Intergenic
948024677 2:234767506-234767528 GCTGGGCTTTCCTCCCTGAGGGG + Intergenic
948612563 2:239179168-239179190 GGATGCCTGTGCTCCATGAGTGG + Intronic
948629791 2:239294723-239294745 GGTGGGCTGTGCTGCCTCCGAGG - Intronic
1169206133 20:3741250-3741272 GGTGGGCTGTGGTCCACAAGAGG - Intronic
1170538933 20:17369038-17369060 GGTGGGCTGCACTGCCAGAGCGG - Intronic
1172890434 20:38260439-38260461 GGAGGGCTGTGCCCACTGAAAGG + Intronic
1173320316 20:41981784-41981806 TGTGCTCTGGGCTCCCTGAGAGG + Intergenic
1175416562 20:58805121-58805143 GAGGGGCTGGGCTCCCTCAGGGG - Intergenic
1175888887 20:62307370-62307392 GGTGGGCTGGGGGCCCTGACTGG + Exonic
1176098143 20:63353517-63353539 GGGGGGCTGTGGTCCTAGAGGGG + Intronic
1176123459 20:63464577-63464599 CCTGTGCTGTGCTCCCTGTGGGG - Intronic
1176389090 21:6154522-6154544 GGAGGGCTGGGCTCCCTGCCCGG + Intergenic
1176618624 21:9040932-9040954 GGTGGGCAGAAATCCCTGAGGGG - Intergenic
1176816727 21:13610070-13610092 GGTGGGCTGGGCTCCCTTGCTGG + Intronic
1178441641 21:32603330-32603352 GCTGGGCTCTGCCCCCTGGGTGG - Intronic
1178890838 21:36520052-36520074 GCAGGGCTGTGCTCCCTCTGAGG + Intronic
1179190086 21:39116067-39116089 GGTGGGCTGTTGTGCGTGAGGGG - Intergenic
1179425482 21:41274995-41275017 TGTGGGTTGTGCTTCCTCAGTGG - Intronic
1179734382 21:43383726-43383748 GGAGGGCTGGGCTCCCTGCCCGG - Intergenic
1180206559 21:46264776-46264798 GGGTGGCTGTGCCCCCTGATAGG - Intronic
1180332040 22:11490274-11490296 ATTGGGCTGTGTGCCCTGAGAGG - Intergenic
1180986056 22:19904482-19904504 GGTGCACTGTGATGCCTGAGTGG + Intronic
1181428172 22:22857281-22857303 TGTGTGTTGTGGTCCCTGAGTGG + Intronic
1183260347 22:36790801-36790823 TGTGGGCTGCTCTGCCTGAGTGG - Intergenic
1183648089 22:39138400-39138422 GGTGGGCGGTGCCACCTGGGAGG - Intronic
1184370212 22:44077193-44077215 GCTGGGCTGTGCTCCCTCCAGGG + Intronic
1184464929 22:44663346-44663368 GTGGGGCTGTGCTCCTTCAGGGG + Intergenic
1184606531 22:45577648-45577670 GATGGGCTGTGCACACAGAGTGG - Intronic
1184796714 22:46737482-46737504 TGTGGGGTGTGCTCCCTGCTCGG - Intronic
1184944847 22:47795827-47795849 GCTGGACTGTGCTGCCTGGGAGG - Intergenic
1185125629 22:49009177-49009199 GGTGGGCTGCACTCCCTGCAGGG + Intergenic
949533689 3:4979466-4979488 GGCGGTGTGTGCTCCCTGCGCGG - Exonic
949615528 3:5749855-5749877 GGTGTGCTGTGCCCTCTGATTGG + Intergenic
950541626 3:13616630-13616652 TGTGGGCTCTGCTGCCTGGGTGG + Intronic
955352065 3:58200935-58200957 GGCAGGCTCTGGTCCCTGAGTGG - Intronic
957090597 3:75726225-75726247 ATTGGGCTGTGTGCCCTGAGAGG + Intronic
957920625 3:86743505-86743527 GCTGAGCTGAGCTCCCTGACTGG - Intergenic
961450184 3:126999147-126999169 GGTGGGCTCTGCACCCTGTGGGG + Intronic
961821993 3:129579871-129579893 TTTGGGCTGGGGTCCCTGAGGGG - Intronic
968663942 4:1810594-1810616 GGTGGGAGGTGCTCCCTCATGGG - Intergenic
968669961 4:1843928-1843950 GGTGGGCTCACCTCCCTGTGTGG + Intronic
969312354 4:6361180-6361202 GCTGGGTTCTGCTCCCTGAGAGG - Intronic
975694460 4:76998015-76998037 AGTGGGGTGTGCTGGCTGAGGGG + Intronic
978342859 4:107736302-107736324 GCTGGACTGTGCTCCCTCAAGGG + Intergenic
980721873 4:136708154-136708176 GGTATGCTTTGCTCCCTGATTGG - Intergenic
982233290 4:153228952-153228974 GGTGGTTTGTGGTCTCTGAGTGG - Intronic
984761533 4:183366704-183366726 GGTGAGCAGTGCTCCCACAGAGG + Intergenic
985103108 4:186477291-186477313 GGAGAGCTGTGATCACTGAGTGG - Intronic
986170183 5:5308524-5308546 GGTGTGAGGTGCTCCCTGGGAGG - Intronic
988684687 5:33515434-33515456 AGTGGGCCGCGCTCCTTGAGAGG + Intergenic
993889375 5:93454842-93454864 GGAGGGTGGTGCACCCTGAGAGG + Intergenic
993928337 5:93901085-93901107 ACTGGGCTGTGCTCATTGAGAGG + Intronic
997362990 5:133306839-133306861 GGGAGCCTGTGGTCCCTGAGGGG + Intronic
997518067 5:134504843-134504865 GATGGGCTGTGCTCCTGGGGTGG + Intergenic
998584061 5:143407178-143407200 AGTGGGCTGTGTTCCAGGAGTGG - Intronic
1000936535 5:167308588-167308610 GCTGGGCAGTGCGGCCTGAGGGG - Intronic
1001953170 5:175830223-175830245 GCTGGGCTGTGCTCCCCCGGGGG - Intronic
1002442808 5:179273136-179273158 GGTGGGAGGTACTCCCTGAGGGG - Intronic
1004303191 6:14476778-14476800 GGAGGGCTCTGCTCCCTCAGTGG + Intergenic
1005391233 6:25335717-25335739 GGTGAGCTGTGCTCACTGTGGGG + Intronic
1006810916 6:36819995-36820017 GGTGGGATGTGCTTGCTGAGCGG - Intronic
1006835910 6:36998776-36998798 TCTGGGCTGTGCTCTCAGAGCGG + Intergenic
1007749878 6:44065364-44065386 GGTGGGGAGTGGTGCCTGAGAGG - Intergenic
1007784566 6:44272307-44272329 AGGGGGCTGGGGTCCCTGAGCGG - Intronic
1009447403 6:63758888-63758910 GGTGGGCAGACCTGCCTGAGGGG + Intronic
1010059660 6:71607973-71607995 GCAGGGCTGTACTCCCTCAGGGG + Intergenic
1013584633 6:111567225-111567247 GGTGTGCTGTGCAGCCTGCGAGG + Intronic
1017747443 6:157459666-157459688 GGTGGCCTGTGCGCCCCAAGTGG + Intronic
1017818517 6:158032119-158032141 CGCGGGCTGTGCTCCCTGTGGGG + Intronic
1017818529 6:158032177-158032199 CGCGGGCTGTGCTCCCTGTGGGG + Intronic
1018085758 6:160300171-160300193 GGTGTACTCTGCTCCCTGACAGG - Intergenic
1018625768 6:165777329-165777351 AGTGGGCTGAGCGCTCTGAGGGG + Intronic
1018901008 6:168051730-168051752 GGTGCCCTGGGCTCCCAGAGAGG - Intergenic
1020098034 7:5379464-5379486 GGTGGCCTTGGCCCCCTGAGTGG + Intronic
1024085434 7:45888540-45888562 GGTGGCCAGTGCTCTCTGGGAGG - Exonic
1026419661 7:70221011-70221033 GCTGGGCTCTGCCTCCTGAGTGG + Intronic
1026642623 7:72140565-72140587 GTTGGGGTGTAATCCCTGAGGGG - Intronic
1026740751 7:72976718-72976740 CGGGGGCTGTCCTCCCAGAGCGG + Intergenic
1026930898 7:74222446-74222468 GGTGGGCAGTGCCTGCTGAGAGG + Intronic
1027102982 7:75388353-75388375 CGGGGGCTGTCCTCCCAGAGCGG - Intergenic
1029501559 7:100933873-100933895 GGTGGGCAGGGCTTCTTGAGTGG - Intergenic
1029675298 7:102064553-102064575 GATGGGCTGAGCTCCCTGCAGGG + Intronic
1030549290 7:110937960-110937982 AGTGGCCTCTGTTCCCTGAGTGG + Intronic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1034029522 7:147744804-147744826 GGTGGGGCATGCTCCCTGATAGG - Intronic
1035251104 7:157597756-157597778 TGTGGGCTGTGCAGACTGAGTGG + Intronic
1035320497 7:158026331-158026353 GGTGGGCTGGGCTCGCTGGGGGG + Intronic
1036608477 8:10329281-10329303 GCTGGGCTCTGCTCCCCCAGGGG + Intronic
1036762807 8:11522464-11522486 AGTGGGCTATGTTCCCTCAGTGG - Intronic
1038533831 8:28339614-28339636 GGTGGGCTGGACTCCTTGCGGGG - Intronic
1039492642 8:37959411-37959433 GCAGGGCTGTGCTCCCTGTGAGG - Intergenic
1039878733 8:41609995-41610017 GGTGGGCTGTGCACCACGTGGGG - Intronic
1040569142 8:48592564-48592586 GCTGGCCAGTCCTCCCTGAGGGG - Intergenic
1043851681 8:85223507-85223529 GGCTGGCTGTGTTCCCTTAGAGG - Intronic
1044509668 8:93059955-93059977 ACTGGGCTGTGCTGCCTGAGAGG - Intergenic
1047543830 8:125796789-125796811 GGAGGTCTGGGCTCCCTGAAGGG + Intergenic
1048112836 8:131487106-131487128 GGTGGGCTGTGCACTCCTAGCGG + Intergenic
1048484330 8:134832632-134832654 GGCGGGCTCGGCTCCCGGAGTGG + Intergenic
1051986055 9:23089033-23089055 GGTGGGGTGTGCTCCATGCAGGG + Intergenic
1052262592 9:26535177-26535199 GCTGGGTTGTGCTCCAGGAGAGG + Intergenic
1056567157 9:87783679-87783701 GGTGACCTGTTCTCCCTGAGTGG - Intergenic
1060229216 9:121814588-121814610 GGTGGGGTCTGAGCCCTGAGGGG + Intergenic
1061163554 9:128909810-128909832 GGTGGCCAGTGCTGGCTGAGGGG + Intronic
1061446422 9:130640714-130640736 GGTGGTCTCTGCACCCTGGGAGG + Intergenic
1061499733 9:130994944-130994966 GCTGGGATGAGCTCCATGAGGGG - Intergenic
1061912441 9:133732306-133732328 GGTAGGGTGGGCTCCCTGTGAGG - Intronic
1062030836 9:134361286-134361308 GCAGGGCTGTGCTTCCTGGGAGG - Intronic
1062225490 9:135447262-135447284 GGTGGGCTGTGCAGTCGGAGGGG + Intergenic
1062528514 9:136988844-136988866 GCCGGGCTGTGCTCCCTCCGAGG + Intergenic
1062711483 9:137977582-137977604 AGTGTCCTGTGCTCCCTGCGGGG - Intronic
1203530634 Un_GL000213v1:139424-139446 GGTGGGCTGGGCTCCCTTGCTGG - Intergenic
1203487018 Un_GL000224v1:65762-65784 ATTGGGCTGTGTGCCCTGAGAGG - Intergenic
1203499639 Un_KI270741v1:7662-7684 ATTGGGCTGTGTGCCCTGAGAGG - Intergenic
1185855787 X:3533730-3533752 GGTGAAATGTGCTCCCTGTGGGG + Intergenic
1185873441 X:3683085-3683107 GCAGGGCTGTGCTCCCTCTGCGG - Intronic
1187397470 X:18930983-18931005 GATGGGCTGTCGTTCCTGAGAGG - Intronic
1195379041 X:104254252-104254274 TGGGGGCTGTGGTCCCTCAGCGG + Exonic
1197706297 X:129636982-129637004 GGGAGGGTTTGCTCCCTGAGAGG + Intergenic
1199677481 X:150200304-150200326 TGAGGGCTGTGTTCCCAGAGGGG - Intergenic
1200119072 X:153781920-153781942 GCAGGGCGGGGCTCCCTGAGGGG + Intronic
1200134951 X:153870316-153870338 GGTGGTCTGAGCTCCCTGCTAGG + Intronic
1200790863 Y:7298020-7298042 GCAGGGCTGTGCTCCCTCTGCGG + Intergenic
1201059843 Y:10036111-10036133 GGTGGGCTGTGGGCCCTGCGGGG + Intergenic
1202197238 Y:22308006-22308028 GGCGAGCTGTGGGCCCTGAGGGG - Intergenic