ID: 1118825015

View in Genome Browser
Species Human (GRCh38)
Location 14:69372094-69372116
Sequence ATGGATGAGCAGGATGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118825010_1118825015 5 Left 1118825010 14:69372066-69372088 CCGGTCACATAAATGTGGAGTTA No data
Right 1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118825015 Original CRISPR ATGGATGAGCAGGATGAGTA GGG Intergenic
No off target data available for this crispr