ID: 1118825029

View in Genome Browser
Species Human (GRCh38)
Location 14:69372175-69372197
Sequence TTGTCTAGGCAGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118825021_1118825029 16 Left 1118825021 14:69372136-69372158 CCTGCAGTGAGGAGTTAGAGCCC No data
Right 1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG No data
1118825025_1118825029 -5 Left 1118825025 14:69372157-69372179 CCAAGTAGGAAGAGGAGCTTGTC No data
Right 1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG No data
1118825024_1118825029 -4 Left 1118825024 14:69372156-69372178 CCCAAGTAGGAAGAGGAGCTTGT No data
Right 1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118825029 Original CRISPR TTGTCTAGGCAGAAGGTGGC TGG Intergenic
No off target data available for this crispr