ID: 1118826378

View in Genome Browser
Species Human (GRCh38)
Location 14:69386535-69386557
Sequence CTGTGTAAGTACGTATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118826378 Original CRISPR CTGTGTAAGTACGTATATTT TGG (reversed) Intronic
900024905 1:263506-263528 CTGTGTAATTATGTCTATATAGG + Intergenic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
906477733 1:46181161-46181183 CTTTGTAAGTACGGACATTGTGG + Exonic
907590873 1:55669819-55669841 CTGTTTAAGGCCGTATATTGTGG + Intergenic
912887544 1:113490837-113490859 GGGTGTATATACGTATATTTAGG - Intronic
912902350 1:113665590-113665612 GTGTGTATGTATATATATTTTGG + Intronic
917584323 1:176410603-176410625 CTGTGAATGTAAGTTTATTTGGG - Intergenic
918037061 1:180883943-180883965 CTGTGAAAGTGTTTATATTTGGG + Intronic
918472738 1:184891206-184891228 CTGTGTTAGTGGGTATATTCTGG - Intronic
918876017 1:190044679-190044701 GAATGTAAGTACATATATTTGGG + Intergenic
918896413 1:190353622-190353644 ATGTGTATGTATGTATATTTTGG + Intronic
921437760 1:215146579-215146601 CTGGGAAAGTATGTATATATAGG - Intronic
922644616 1:227274076-227274098 CTATGGAATTACATATATTTGGG + Intronic
923329141 1:232906556-232906578 CTTATTAAATACGTATATTTGGG + Intergenic
1063504871 10:6588389-6588411 CAGAGTAGGTACGTAAATTTAGG + Intergenic
1063901711 10:10739888-10739910 CTTTGGAAGTATGTCTATTTAGG + Intergenic
1066544625 10:36486239-36486261 ATGTGTAAGTGCATATAATTTGG - Intergenic
1068985320 10:63102844-63102866 CTCTGTAAGTACATAAAATTGGG - Intergenic
1069949051 10:72007010-72007032 GTGTTTAAGTAAGTTTATTTGGG - Intronic
1070127481 10:73633900-73633922 CTGTTGAAGGACTTATATTTGGG + Exonic
1078160668 11:8837224-8837246 CTGTCTGAGTAAGTGTATTTGGG + Intronic
1078289209 11:9990127-9990149 CTGTGTGAGTCTGTATACTTAGG + Intronic
1079519652 11:21311405-21311427 TTGTTTACATACGTATATTTGGG + Intronic
1079785099 11:24662160-24662182 TTGTTTAAGTATTTATATTTTGG - Intronic
1081004973 11:37725206-37725228 CTTTGTAAATATGTCTATTTAGG - Intergenic
1086130693 11:83399005-83399027 CTATGTAAAAAGGTATATTTAGG + Intergenic
1086279062 11:85164409-85164431 CTTTGTATGTATGTATATATGGG - Intronic
1094653185 12:32397803-32397825 CTTTGGGAGTACGTTTATTTGGG + Intergenic
1095380910 12:41590746-41590768 CTTTGTAATTACGTATTTTAGGG + Intergenic
1096322073 12:50623376-50623398 GTGTGTAGATACATATATTTTGG - Intronic
1103750470 12:123155634-123155656 CTGTGTAACTACTTAGTTTTTGG - Exonic
1103815719 12:123654129-123654151 GTGTGTATGTGTGTATATTTTGG + Intronic
1108753822 13:53476021-53476043 CTGTGTATTGAAGTATATTTAGG - Intergenic
1108905412 13:55465044-55465066 GTGTGTATGTATGTATTTTTCGG + Intergenic
1110905776 13:80887344-80887366 TTGTGTGTGTACGTATGTTTGGG - Intergenic
1111053713 13:82920332-82920354 ATGTGAAAGTCTGTATATTTTGG - Intergenic
1111316309 13:86565268-86565290 CTGTTTATATACATATATTTGGG + Intergenic
1111333271 13:86789413-86789435 CTGTTTATGCAGGTATATTTGGG - Intergenic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1118826378 14:69386535-69386557 CTGTGTAAGTACGTATATTTTGG - Intronic
1120416616 14:84227005-84227027 GTGTGTATGTATTTATATTTTGG - Intergenic
1121663329 14:95652384-95652406 CTGTGTAAGGAGGTATGTGTGGG + Intergenic
1122305146 14:100760632-100760654 TAGTGTAAGCACTTATATTTAGG - Intergenic
1123223906 14:106882015-106882037 CTGTGTAATTATGTCTATATAGG - Intergenic
1125192633 15:37011131-37011153 CTCTGTATGTAAGTATATTTTGG + Intronic
1125326491 15:38540845-38540867 ATGTTTCAGTACATATATTTTGG - Intronic
1126670656 15:51112579-51112601 CTGTGGAAGTAGGTAGAGTTGGG - Intergenic
1129840678 15:78741635-78741657 CTTTTTAAGTACATTTATTTAGG - Intergenic
1130725248 15:86432461-86432483 CTGTGTTAGTGTGTATTTTTGGG + Intronic
1134432241 16:14221315-14221337 ATATGAAAGTAAGTATATTTAGG - Intronic
1135263382 16:21000349-21000371 TTGGGTAGGTACGTATTTTTGGG + Exonic
1142456249 16:90225872-90225894 CTGTGTAATTATGTCTATATAGG - Intergenic
1144106069 17:11986504-11986526 CTGTGTAATTCAGTATATTGAGG - Intronic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1148424758 17:47584306-47584328 CTGCGTAATGAAGTATATTTAGG + Intronic
1149636181 17:58171681-58171703 CTGTGAAAATAAGTTTATTTGGG + Intergenic
1153381821 18:4448841-4448863 CTATGTAGGTACGTAGATGTGGG - Intronic
1154030081 18:10745907-10745929 CTGTTTGAGTTCCTATATTTGGG + Intronic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1157461571 18:47901381-47901403 CTTTCTAGGTACTTATATTTAGG + Intronic
1161363627 19:3866139-3866161 CTTTTAAAGTACGTATGTTTTGG - Intronic
1163109997 19:15154035-15154057 CAGTGGAAGTAAGTTTATTTGGG + Intergenic
1165261130 19:34619134-34619156 ATGTTTAAGTGCTTATATTTAGG + Intronic
925536526 2:4924039-4924061 CTGTGTAAACATGTACATTTAGG + Intergenic
927294876 2:21442305-21442327 GTGTGTAAATATGTATATGTGGG - Intergenic
927539289 2:23892945-23892967 CTATATTAGTATGTATATTTGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929205149 2:39283087-39283109 CTGTGTAAGTAGGTATATACAGG - Intronic
929387771 2:41431331-41431353 TTTAGTAAGTACGTATGTTTTGG + Intergenic
929985058 2:46721688-46721710 ATTTGTAACTACATATATTTTGG - Intronic
930338860 2:50085177-50085199 CTATGCATGTAAGTATATTTTGG + Intronic
931584987 2:63816372-63816394 CTGTGAATGTGCCTATATTTGGG + Intronic
931594010 2:63920884-63920906 TTGTTTAACTACATATATTTAGG + Intronic
931659668 2:64547525-64547547 CTTTGTAATTAAGTATATTGTGG + Intronic
933290440 2:80432564-80432586 CTAAGTAAGTAACTATATTTTGG - Intronic
936482009 2:112892846-112892868 CTGTGTAAGTATGTCTGTTGTGG - Intergenic
939470962 2:142619053-142619075 TTGTGTAATAACATATATTTTGG + Intergenic
940892851 2:159051933-159051955 CAGTTTAAGTCCGTGTATTTTGG + Intronic
941620281 2:167770074-167770096 CTGTGTTTGTATGTTTATTTAGG + Intergenic
943059885 2:183030911-183030933 CTGTGTTATGATGTATATTTTGG + Intronic
946756166 2:222949964-222949986 CTGTGTCAGTACATATATAATGG + Intergenic
946867309 2:224053608-224053630 GTGTGTCAGTACGTATAGCTTGG + Intergenic
1183876085 22:40783234-40783256 CTGTGACAGTACTAATATTTTGG + Intronic
1184971117 22:48020755-48020777 CTGTGTAATTACCTAAATTAAGG - Intergenic
951833614 3:26957973-26957995 TTCTTTAAGAACGTATATTTTGG + Intergenic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
953460328 3:43076764-43076786 TTGTGTATGTATGTATATATAGG + Intergenic
954251604 3:49371907-49371929 CTGTGGCAGTATGTATGTTTTGG - Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
959399271 3:105879579-105879601 ATGTCTAAGTACATAGATTTTGG - Intergenic
959594189 3:108111246-108111268 CTGTGTAACTAGTTATAATTTGG - Intergenic
963686881 3:148446799-148446821 CTTTTTAAGTATGAATATTTAGG + Intergenic
964174514 3:153809946-153809968 GTATATAAGTATGTATATTTTGG + Intergenic
964238394 3:154561853-154561875 CTATGTAAGTACATAAATTGTGG - Intergenic
966253118 3:177888897-177888919 CTGTGTGAGTGCGTATATCCTGG - Intergenic
970424170 4:15931109-15931131 ATGTGTAAGGACCTAGATTTAGG + Intergenic
971092071 4:23357225-23357247 TTTTGTAAGTAAATATATTTTGG + Intergenic
971835401 4:31756522-31756544 CTGTGTAAATAAGTATTATTGGG + Intergenic
974024469 4:56721238-56721260 GTGTGTATGTATGTATATGTTGG + Intergenic
975154189 4:71053080-71053102 CTGTGTAAGTACTTAGTTTAGGG - Intergenic
976672162 4:87665723-87665745 CTCTGAAAATATGTATATTTAGG + Intergenic
978136068 4:105262273-105262295 CATTGTAAGTATATATATTTCGG + Intronic
983061963 4:163170877-163170899 CTGTGGAAGTAGGTAAATTCAGG - Intergenic
983566953 4:169163465-169163487 CTTAGTAAATACCTATATTTAGG + Intronic
984073478 4:175146820-175146842 CTGTGTATGTAAGTATTTTGGGG - Intergenic
986153574 5:5150911-5150933 ATATGTTAGTATGTATATTTTGG + Intronic
987150962 5:15039345-15039367 CTTTGTTAGGACTTATATTTTGG + Intergenic
988175705 5:27721992-27722014 CTGTGTAAGAACAACTATTTGGG - Intergenic
988468799 5:31516512-31516534 GTGTGTAGGTATGTATACTTTGG + Intronic
989082081 5:37633826-37633848 CTGTGTAAGCATGTAGATTTAGG - Intronic
993057605 5:83000521-83000543 CTGTGTAAGTACTTACGCTTTGG + Intergenic
997740128 5:136245918-136245940 CTGTGTCAGGAAGTATATTCAGG + Intronic
1002952009 6:1823448-1823470 CTGTGTAAGAACATACAATTGGG - Intronic
1003439755 6:6128667-6128689 CTCAGTAAGTCCGTAGATTTTGG + Intergenic
1004123705 6:12851594-12851616 CTGTGTAATTACATATATGCCGG - Intronic
1009623826 6:66109997-66110019 AAATGTAAGTACGTATACTTAGG - Intergenic
1010426408 6:75733267-75733289 CTATATAAGTAGGTATTTTTTGG - Intergenic
1011140732 6:84153012-84153034 ATGTTTAAGAACGTCTATTTCGG + Exonic
1012255967 6:97032229-97032251 CTGTTTACGTAAGTATCTTTTGG - Intronic
1012333371 6:98022194-98022216 GTGTGTATGTATGTGTATTTAGG - Intergenic
1014481543 6:121944724-121944746 ATGTGTGTGTAGGTATATTTGGG - Intergenic
1020859986 7:13479854-13479876 CTGTTTAAATGCATATATTTTGG - Intergenic
1021407945 7:20295624-20295646 CTGTGTTGGTGGGTATATTTTGG + Intergenic
1028307445 7:89283760-89283782 CTGTATATGTATGTATATATAGG - Intronic
1028318161 7:89430143-89430165 CTGTGTGTGTGCGTATGTTTTGG - Intergenic
1028613871 7:92742583-92742605 TTGTGTGTGTATGTATATTTTGG - Intronic
1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG + Intergenic
1033646398 7:143308115-143308137 TTGTGTAAGTTGGGATATTTTGG + Intergenic
1035989369 8:4470917-4470939 ATGTGTAAATAAGTATTTTTGGG + Intronic
1038098711 8:24346858-24346880 CTGTTTAAGGATGTGTATTTAGG - Intronic
1040802373 8:51357429-51357451 CTGTATAATTACTTATCTTTGGG - Intronic
1044213197 8:89574863-89574885 TTGTGTATGTATGTATATATTGG + Intergenic
1047419019 8:124690767-124690789 ACGGGCAAGTACGTATATTTAGG - Intronic
1050003705 9:1105412-1105434 ATGTGTATATACGTATATATGGG - Intergenic
1050485487 9:6129977-6129999 TTGTTTAAGTACATTTATTTAGG - Intergenic
1051562324 9:18455765-18455787 ATGTGTATGTATGTACATTTTGG - Intergenic
1051983683 9:23056715-23056737 TTCTGTAAGTTTGTATATTTTGG + Intergenic
1052619080 9:30882252-30882274 CTGTGTACTTAAGTATGTTTTGG + Intergenic
1057726766 9:97573516-97573538 CTGTTTAAGTTGCTATATTTGGG - Intronic
1203579951 Un_KI270745v1:33614-33636 CTGTGTAATTATGTCTATATAGG - Intergenic
1188695160 X:33181067-33181089 ATATGTATGTATGTATATTTTGG + Intronic
1188920194 X:35965301-35965323 CTGTATAAGTAAGTATGTTGGGG + Intronic
1192133349 X:68573807-68573829 CTGGGACAGTACATATATTTGGG + Intergenic
1197136260 X:123063462-123063484 CTGTGTAAATAAATATATATGGG - Intergenic
1197886182 X:131220660-131220682 GTGTGTATGTAGGTATGTTTGGG + Intergenic
1197923239 X:131618734-131618756 CAATGTAAGTACCTCTATTTGGG + Intergenic
1198450857 X:136766422-136766444 CTCTGCAATTATGTATATTTTGG - Intronic
1199370201 X:147038538-147038560 CTGTGTAAGCAAAGATATTTGGG - Intergenic
1199682611 X:150237556-150237578 ATGTGTATGTACGTATATTTGGG - Intergenic
1201351674 Y:13050369-13050391 ATGTGTAAGAATGAATATTTAGG + Intergenic
1201888477 Y:18914907-18914929 GTGTGTGTGTATGTATATTTTGG + Intergenic