ID: 1118830483

View in Genome Browser
Species Human (GRCh38)
Location 14:69426682-69426704
Sequence ACCTGCCCCAAGGCAGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 1, 2: 4, 3: 17, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118830483_1118830489 -3 Left 1118830483 14:69426682-69426704 CCAAGTCCTGCCTTGGGGCAGGT 0: 1
1: 1
2: 4
3: 17
4: 260
Right 1118830489 14:69426702-69426724 GGTGAAAAGAGGGCAGGAGAAGG 0: 3
1: 26
2: 56
3: 249
4: 1461
1118830483_1118830488 -9 Left 1118830483 14:69426682-69426704 CCAAGTCCTGCCTTGGGGCAGGT 0: 1
1: 1
2: 4
3: 17
4: 260
Right 1118830488 14:69426696-69426718 GGGGCAGGTGAAAAGAGGGCAGG 0: 1
1: 29
2: 58
3: 156
4: 811
1118830483_1118830490 17 Left 1118830483 14:69426682-69426704 CCAAGTCCTGCCTTGGGGCAGGT 0: 1
1: 1
2: 4
3: 17
4: 260
Right 1118830490 14:69426722-69426744 AGGTCAGAAGCCTGCTGTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118830483 Original CRISPR ACCTGCCCCAAGGCAGGACT TGG (reversed) Intronic
900189813 1:1348632-1348654 ACACGGGCCAAGGCAGGACTCGG + Intronic
900435926 1:2631310-2631332 ACCCACCCACAGGCAGGACTGGG - Intronic
900679237 1:3907227-3907249 ACGTGGACCCAGGCAGGACTGGG + Intergenic
900756178 1:4436505-4436527 GCCTCCCCAAAGACAGGACTTGG - Intergenic
900956453 1:5889025-5889047 AACTGCCCCAGGGCTGGGCTAGG + Intronic
902329259 1:15723066-15723088 ACCTGGAGGAAGGCAGGACTTGG + Intronic
902399865 1:16151898-16151920 AGGTGCCCAATGGCAGGACTAGG - Intronic
902468030 1:16630256-16630278 TCCTGCCCCAGGGCAGGTCCAGG - Intergenic
902615788 1:17622921-17622943 ACCTGCCCTCATGCAGAACTCGG - Intronic
902801266 1:18831706-18831728 CCCTGCCTCAGGGCAGGCCTAGG - Intergenic
903519142 1:23934235-23934257 ATCTGCCCCAAGGCAGGACTTGG - Intergenic
904062806 1:27724973-27724995 AGCAGCTACAAGGCAGGACTTGG + Intergenic
905352254 1:37356067-37356089 AGCTGGGCCAAGGCAGGATTTGG - Intergenic
906685525 1:47760929-47760951 ACTTTCCCCACAGCAGGACTGGG + Exonic
907266652 1:53265840-53265862 ACCTGCCCCACTGCATGTCTGGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
912459546 1:109821730-109821752 GGGTGACCCAAGGCAGGACTGGG + Intergenic
914902119 1:151716491-151716513 ACCTGCCCCACATCAGGAGTGGG - Exonic
915484442 1:156210529-156210551 ACTTGGCCCAGGGCAGGGCTGGG - Exonic
920078496 1:203354615-203354637 TCCTGTTCCAAGGCAGGCCTGGG + Intergenic
920824915 1:209416145-209416167 ACGTTCCCAGAGGCAGGACTGGG + Intergenic
922416137 1:225425195-225425217 ACCTACCCCAAGGGAGTAGTGGG + Intronic
923545802 1:234922614-234922636 ACCCTCCCCAAGGCAGGGCAAGG + Intergenic
924709173 1:246519693-246519715 AGCTGCCCCAAGGCTGGACCAGG + Intergenic
1067943913 10:50678777-50678799 GCCTACCCCAGGGCAGTACTCGG - Intergenic
1069828366 10:71268041-71268063 TCCATTCCCAAGGCAGGACTGGG - Intronic
1070780800 10:79136370-79136392 ACCCTGCCCAAGGCAGGGCTGGG - Intronic
1071319166 10:84435836-84435858 AAATCCCCTAAGGCAGGACTTGG - Intronic
1071362404 10:84862535-84862557 ACCTGCTCCAAGGAAGGTCCAGG + Intergenic
1072468873 10:95693556-95693578 AGCTGCCACAAAGCAGGAGTGGG - Intronic
1072797851 10:98369994-98370016 ACCTGGTCCAAGGCAGGAGGTGG - Intergenic
1074999111 10:118782494-118782516 ACCTGCCCCACTGTATGACTTGG + Intergenic
1075370200 10:121928574-121928596 ACCGGCCCAAACGCAGGGCTTGG - Intronic
1075982140 10:126749281-126749303 ACCTGCCCCATGGAAGAACAAGG + Intergenic
1076358959 10:129873315-129873337 TCCTGCACCAAGGCAGGATGAGG - Intronic
1076364575 10:129913796-129913818 CCCTGCACACAGGCAGGACTCGG + Intronic
1076526953 10:131117948-131117970 ACCTGCCCCCAGGCAGGGCCAGG - Intronic
1076982264 11:210911-210933 ACCTGCCCCTAGGCTGGTCTGGG + Intronic
1077194703 11:1273571-1273593 AGCTGCACCAAGACAGCACTGGG + Intergenic
1078059424 11:8033651-8033673 ACCTGCCCCAACCCAGGGCCTGG + Intronic
1079077823 11:17394830-17394852 TCCTCCCCTAAGGCAGAACTGGG + Intronic
1080417513 11:32082743-32082765 CAATGCCCCAAGGCAGGACAAGG + Intronic
1080642511 11:34166038-34166060 CCCTGCCCCAAGGCAGAGCCAGG - Intronic
1081906651 11:46674569-46674591 CCCTGCCCCAGTGCAGGTCTGGG + Intronic
1083307795 11:61769991-61770013 TCCTGCCCCCAGGCTGGACCAGG - Intronic
1083713995 11:64565354-64565376 TCCCTCCCCAAGGCAGGGCTGGG + Intronic
1084374763 11:68768839-68768861 AGGGGCCCCATGGCAGGACTGGG - Intronic
1084890698 11:72235572-72235594 TCCTGCCCCAAGGCATAGCTGGG + Intronic
1085350530 11:75795502-75795524 ACCAGCCCCAGGGCAGGAGGTGG + Intronic
1085378241 11:76087956-76087978 ACCTGACCCCAGGGAGGTCTAGG - Intronic
1085509442 11:77080710-77080732 AGCTTCCCTAAGGCAGGCCTAGG + Intronic
1087923127 11:103889865-103889887 ACATGCCCCAAGTCAGGCTTTGG - Intergenic
1087931148 11:103979320-103979342 AGCTGACCCAAGGAAGGAGTGGG - Intronic
1089160205 11:116431611-116431633 ACCTGTTCCAAGGCAGAACCTGG - Intergenic
1089257282 11:117200540-117200562 ACTGGCTCGAAGGCAGGACTCGG + Intronic
1089581487 11:119484211-119484233 AGCAACACCAAGGCAGGACTGGG - Intergenic
1091320783 11:134647826-134647848 ACCTGCTGCAAGCCAGGACCAGG - Intergenic
1092778675 12:11965626-11965648 ACCTGGCATAAGGGAGGACTGGG - Intergenic
1094324378 12:29220949-29220971 GCCTGCCCCAAGGGAAGAATCGG - Intronic
1094484256 12:30911860-30911882 ATCTGCTCCCAGGCAGGCCTGGG + Intergenic
1095311194 12:40699004-40699026 ACCTGACCCAAGGCATGAAAAGG - Intronic
1095475772 12:42585976-42585998 AACTGCAACAATGCAGGACTTGG + Intronic
1096256443 12:50064892-50064914 AACTGCCCCAGCGCAGGACCTGG - Intronic
1096509775 12:52121390-52121412 CCCTGCCCCCAGGTAGGAGTGGG + Intergenic
1098572954 12:72009724-72009746 ACCTGCCCCAGGGCAGGACATGG + Intronic
1102232703 12:111274586-111274608 AACTGCCCCAAGAAAGGAGTGGG + Intronic
1102301596 12:111775421-111775443 AGCTCCCACAAGCCAGGACTTGG + Intronic
1104664362 12:130636938-130636960 ACCATCCCCAAGGCATTACTAGG - Intronic
1104978330 12:132561918-132561940 GCCTGGCCCAAGGGAGCACTTGG + Intronic
1108046637 13:46389618-46389640 AACTGCCATAAGGCAGGCCTAGG + Intronic
1113942275 13:114024576-114024598 ACCTGCCCCAAGGCTGTTCACGG + Intronic
1117197220 14:53352813-53352835 ACCTACCCCAAGGGAAGAATCGG + Intergenic
1118307155 14:64664504-64664526 TCCTGACCCTAGGCAGGCCTAGG - Intergenic
1118391778 14:65302014-65302036 ATCAGCCCCCAGTCAGGACTTGG + Intergenic
1118458356 14:65965448-65965470 AGCTGCTCCAAGGCAGCCCTGGG + Intronic
1118830483 14:69426682-69426704 ACCTGCCCCAAGGCAGGACTTGG - Intronic
1119200858 14:72751864-72751886 ACCTGCAACAAGGCAGGGGTTGG + Intronic
1120882311 14:89423114-89423136 ACCTGCCCTCAGGGAGGAGTAGG + Intronic
1121272606 14:92648255-92648277 CCCTGCCCCAAGACAGGCCTGGG - Intronic
1121933583 14:97995866-97995888 TCCTGTCCCAGTGCAGGACTGGG + Intergenic
1122029570 14:98902390-98902412 ACCTTCCCCAAGGCTGGGGTGGG + Intergenic
1122398758 14:101454467-101454489 CCCTGCACCAAGGCAGGTCCTGG - Intergenic
1202906478 14_GL000194v1_random:76496-76518 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1123437036 15:20262189-20262211 ACCTGCCTCCTGGCAGGGCTGGG - Intergenic
1124006343 15:25798322-25798344 ACCTTCCCCAAGCCAGTGCTGGG + Intronic
1125760523 15:42093100-42093122 ACCTGCCCCAGAGCGGGACCTGG - Intronic
1125920284 15:43521373-43521395 ACCTTCCCCTAAGCAGGACACGG - Exonic
1125967584 15:43886774-43886796 ACTAGGCCAAAGGCAGGACTAGG + Intronic
1128153035 15:65375396-65375418 CCCTTCCCCAATGCAGGTCTTGG - Exonic
1128498020 15:68209327-68209349 ACCGGCCCCAGGGCAACACTGGG + Intronic
1129408612 15:75336445-75336467 ACAAGCCCCACGGCAGGGCTGGG - Intronic
1129453552 15:75664057-75664079 ACCTGCCCCATGGCAGGCCTGGG + Intergenic
1129970699 15:79775472-79775494 ACCTCCCGCAAGCCAAGACTGGG - Intergenic
1131086378 15:89578962-89578984 ACGCTCCCCAAGGCAGGACCTGG - Intronic
1131426524 15:92349753-92349775 ATCTGCCCACAGGGAGGACTTGG - Intergenic
1132888170 16:2191542-2191564 GCCTGGCACAAGTCAGGACTCGG + Intronic
1132938194 16:2492767-2492789 ACCTTGCCCACAGCAGGACTAGG - Intronic
1133026916 16:2992555-2992577 ACCCGTCCCAAGCCAGGCCTCGG + Intergenic
1133211391 16:4265014-4265036 AGGTGGCCCAAGGCTGGACTTGG - Intronic
1133236115 16:4388172-4388194 ACCTGCCCCAGAGCAGGGCTTGG + Intronic
1134090913 16:11391247-11391269 ACCAGCCTCGTGGCAGGACTGGG - Intronic
1136517295 16:30775703-30775725 TCCTTCACCGAGGCAGGACTGGG + Exonic
1136847529 16:33588647-33588669 ACCTGCCTCCTGGCAGGGCTGGG + Intergenic
1137406500 16:48193379-48193401 ACCTGCCCTAGGACAGGACAGGG - Intronic
1137805689 16:51303298-51303320 TCCTCCCACAAGGAAGGACTAGG + Intergenic
1137815155 16:51391866-51391888 ACCTGCCGGATGGCAGGACTGGG - Intergenic
1139247072 16:65455492-65455514 AGCTCCACGAAGGCAGGACTGGG + Intergenic
1139472004 16:67183495-67183517 AACTCCCCGAAGGCAGGAATGGG + Exonic
1140443933 16:75008883-75008905 ACCTGCCCCAACCCAGAAATAGG - Intronic
1141824426 16:86468900-86468922 CCCTGGCCAAAGCCAGGACTAGG + Intergenic
1203109237 16_KI270728v1_random:1437302-1437324 ACCTGCCTCCTGGCAGGGCTGGG + Intergenic
1143665385 17:8355514-8355536 GCCTGCCCCATGGCTGGGCTCGG - Intergenic
1143837153 17:9701559-9701581 ACCAGCCCTGAGGCAGGACTGGG + Exonic
1144075673 17:11717124-11717146 ACCTGCCACAAGGCATGATGAGG - Intronic
1144886500 17:18466708-18466730 ACCTGCTCAAGGGGAGGACTGGG + Intergenic
1145395044 17:22487979-22488001 ACCTTCTCCAAGTCAGGACCAGG + Intergenic
1148563843 17:48621593-48621615 ACCCGCCCCAGGGCCGGGCTTGG - Exonic
1148830847 17:50430005-50430027 ACCTGCCCTAAAGCTGGCCTGGG + Intronic
1149646550 17:58245511-58245533 ACCTGCCCCAAGACAGGGTGGGG - Intronic
1149894899 17:60421919-60421941 ACCTGCCCCAGGGAAGGCCGCGG + Intronic
1151907797 17:77060415-77060437 AACGGCCCCAAGGCAGGGTTTGG + Intergenic
1152155531 17:78630200-78630222 ACCTGCCCCAGGTCAGGCCGAGG + Intergenic
1152383572 17:79955076-79955098 ACGTGCCTCCAGGCAGGAGTTGG + Intronic
1152540537 17:80972196-80972218 ACCAGCCCCAGGGCAGCACAGGG + Intergenic
1153696307 18:7646314-7646336 CCCTGCCCAAAGGCTGGACCTGG - Intronic
1153797267 18:8635379-8635401 ACCAGTTCCCAGGCAGGACTGGG - Intronic
1154218040 18:12429844-12429866 ACTTGCCCCAAGCCAGTACATGG + Intronic
1154958270 18:21281215-21281237 ACCTCCCCAAAGGCAGCACCAGG - Intronic
1155329473 18:24699946-24699968 TCCTGCCCCAAGCAAGGACATGG - Intergenic
1157180975 18:45497729-45497751 AACTGCCCCATGGCAGGATGTGG - Intronic
1158420183 18:57286352-57286374 ACACGCCCCAAGGCAGCACCAGG + Intergenic
1159894423 18:73982951-73982973 GGCTGCCCCAAGGCAGGGCTAGG - Intergenic
1160752983 19:743417-743439 CGCTGCCCCAAGACAGGAATTGG - Intronic
1161257899 19:3320081-3320103 AAAGGCCCCGAGGCAGGACTGGG + Intergenic
1161277492 19:3426756-3426778 AGCGGCCCTGAGGCAGGACTGGG - Intronic
1162430676 19:10626193-10626215 ACCTGAACCAAGACAGGGCTGGG - Intronic
1162514956 19:11142350-11142372 CCCTGCCCCTAGGGAGGGCTTGG + Intronic
1163126885 19:15249083-15249105 GCCTTCCCGAAGGCGGGACTAGG + Intronic
1163974303 19:20835086-20835108 ACCTACACCGAGGCTGGACTCGG + Intronic
1165067095 19:33235759-33235781 ACCTGCCTCGGGGCAGGGCTGGG + Intergenic
1166391144 19:42409607-42409629 CCCTGCACCAAGGCAGAGCTGGG + Intronic
1166391943 19:42413271-42413293 ATCTCCCCCAGGACAGGACTAGG + Intronic
1167738891 19:51312211-51312233 TCCTGCCCCCAGGCAGGGCTAGG - Intronic
925126586 2:1461478-1461500 ACCTGCCTCAGGGGAGGAATTGG + Intronic
926048155 2:9725243-9725265 TCCTGCAGCAAGGCAGGGCTCGG + Intergenic
926756975 2:16244299-16244321 AGGTGCCCCAGGGCAGGACTGGG + Intergenic
926940872 2:18135314-18135336 ACCTACCCCAAGACTAGACTGGG - Intronic
927109181 2:19852036-19852058 AGCTGCCCCAGTCCAGGACTTGG + Intergenic
928545808 2:32328206-32328228 ACTTGCCCCCAAGCAGCACTAGG - Intergenic
929594979 2:43170205-43170227 CCCTGCCCCAAGGCCTGCCTGGG - Intergenic
931808564 2:65831701-65831723 GTCTGCCCCAAGGTTGGACTTGG + Intergenic
933180237 2:79218214-79218236 CCCTGCCCAAAGGCAGGAAGTGG + Intronic
933270967 2:80232465-80232487 TCCTGGCCCAAGTCAGGACTGGG - Intronic
933789564 2:85873042-85873064 TCCTGCCCCAAGGTGGGGCTGGG + Intronic
934771826 2:96912339-96912361 ACTTGCCCCGATCCAGGACTGGG - Intronic
934783325 2:96986675-96986697 TCCTGCCCCCAGGCAGTCCTGGG + Intronic
935328544 2:101959961-101959983 AAATGCCCCAAGGCTGGACCGGG - Intergenic
938090663 2:128431838-128431860 ACCTGTCCAAAGGCAAGACAAGG - Intergenic
938262396 2:129905293-129905315 AAGTGCACAAAGGCAGGACTTGG + Intergenic
940918765 2:159286070-159286092 CCCTACCCCAAGGCAGGTCCTGG - Intronic
942152692 2:173092892-173092914 ACCTGCACGAAAGCAGGATTTGG - Intronic
945011199 2:205465753-205465775 ACCTGCCCCATTGAAGGAATGGG + Intronic
1169635746 20:7689627-7689649 ACATTCCCAAAGGCAGAACTAGG - Intergenic
1170982567 20:21228485-21228507 TCCTTCCCCATGGCAAGACTTGG + Intronic
1170999028 20:21395914-21395936 ACCTGCTCTATGGCAGGACGTGG - Exonic
1171317444 20:24207420-24207442 TCCTGCCCCAAAGAAGGGCTGGG - Intergenic
1172055213 20:32150062-32150084 ACCTGCCCAAAGTCAGTACCAGG + Intronic
1172326203 20:34037260-34037282 GCCTGCCCCAAATCAGCACTGGG + Intronic
1172363988 20:34334900-34334922 CCCTCCCCCAGGGCAGGCCTGGG - Intergenic
1172596112 20:36152415-36152437 CCCTGCCCCAGGGGAGGAGTGGG + Intronic
1172658298 20:36549927-36549949 CCCTGGCCCAGGGAAGGACTGGG + Exonic
1173024880 20:39298673-39298695 CCTAGCCCCAAGGCAGGACCAGG - Intergenic
1174057672 20:47809828-47809850 CCCTGCCCTGAGGCAGGACAAGG + Intergenic
1175203089 20:57291272-57291294 GCCTGCCTGAAGGCAGGGCTAGG - Intergenic
1175732018 20:61360617-61360639 ACATGTCCCCAGGCTGGACTGGG - Intronic
1176112292 20:63416144-63416166 CCCTGCCCTGGGGCAGGACTTGG - Intronic
1176132384 20:63501862-63501884 CCCTCCCCCAGGTCAGGACTTGG + Intergenic
1176417284 21:6484006-6484028 ACCTGCCACAAGTCAGTGCTGGG - Intergenic
1176625823 21:9091295-9091317 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1176661320 21:9637468-9637490 TCCTGCCACAAGCCAGCACTGGG - Intergenic
1176875607 21:14123988-14124010 ACCTGGACCAAGTCTGGACTGGG - Intronic
1179444827 21:41423930-41423952 ACCTCAGCCAGGGCAGGACTCGG - Intronic
1179606684 21:42520789-42520811 ACCTGGCCAATGCCAGGACTGGG + Intronic
1179692780 21:43092339-43092361 ACCTGCCACAAGTCAGTGCTGGG - Intergenic
1179876615 21:44272122-44272144 ACCTGCTCCAGGGCAGGCCCTGG + Intergenic
1179888951 21:44326312-44326334 ACCTGCCTCAGGGAAGGTCTGGG - Intronic
1180044804 21:45300377-45300399 ACTTTCACCAGGGCAGGACTCGG + Intergenic
1180637120 22:17270083-17270105 AACTGCTCCATGGCAGGGCTGGG + Intergenic
1181361981 22:22344556-22344578 AGCAGCCCCAAGGCAGGGCCTGG - Intergenic
1181747830 22:24968120-24968142 ATCTGCATCAAGGCAGGACTTGG - Intronic
1183241219 22:36659586-36659608 ACCTGGCCCCAGGAAGGAGTGGG + Intronic
1183745287 22:39688281-39688303 ACCTGCCCCCAGGGAGGACTGGG - Exonic
1183869830 22:40732869-40732891 TCCTGCCCCGAGGCAGGAACAGG - Intergenic
1184104420 22:42359310-42359332 ACCTTCCCCAAAGGAGGAATTGG + Intergenic
1184108840 22:42383704-42383726 CCCTGCCCCCAAGCAGCACTGGG - Exonic
1184287125 22:43478034-43478056 ACAAACCCCAAGGCAGGGCTAGG + Intronic
1184751407 22:46488502-46488524 ACCCACACCAAGGCTGGACTCGG + Intronic
1184818172 22:46888156-46888178 AGGTGGCCCAAGGCAGGAATAGG - Intronic
1184837446 22:47032297-47032319 ACCAGCACCAAGGCAGGCCATGG - Intronic
1184943805 22:47786992-47787014 ACCTGCCCCAAGGCTGAAGGAGG - Intergenic
1185153482 22:49179665-49179687 CCCTGCCCCGAGGCTGGACGTGG - Intergenic
950801061 3:15552149-15552171 CTCTGGCCCAGGGCAGGACTAGG + Intergenic
951909206 3:27731477-27731499 ATCTGACCTAAGGCAGCACTGGG - Intergenic
952284562 3:31955973-31955995 ACCAGCCCTAAGGCAGAAGTGGG + Intronic
953399612 3:42601096-42601118 CCCTTCGCCAAGGCAGGCCTCGG - Intronic
954036948 3:47855983-47856005 ACATGGACCAAGGCAGGCCTGGG + Intronic
954816604 3:53286945-53286967 GCCTGCTGCAGGGCAGGACTGGG + Exonic
954973490 3:54671645-54671667 AGCTGCTCCAGGGCAGGAATGGG + Intronic
955409239 3:58645195-58645217 ACCTGCCCAGTGGCAGGACCAGG - Intronic
955505760 3:59631716-59631738 ACCTGGCACAAGGCAAGGCTGGG + Intergenic
956170380 3:66429041-66429063 ACCTCTCCAAAGGCAGGACTGGG + Intronic
956745151 3:72305324-72305346 ACTTGCTCCAAGGCAGCACAAGG - Intergenic
956853926 3:73257420-73257442 CCCTGCCCCATGACAGGTCTTGG + Intergenic
958712027 3:97728718-97728740 ACTTGCCCAAAGGCAGAGCTTGG + Intronic
966857277 3:184203530-184203552 GCCTCCTCCAAGGCAGGGCTGGG - Intronic
969514187 4:7637406-7637428 AACTGCTCCAAAGCAGGACCAGG - Intronic
969549586 4:7855863-7855885 CCCTTCCCCCACGCAGGACTGGG + Intronic
969586916 4:8099274-8099296 ACCTGCCCCAAGACAGTAGCTGG + Intronic
969675780 4:8613643-8613665 ACCATCTCCAAGGCAGGCCTAGG - Intronic
971373785 4:26039779-26039801 AGCTGGCCCAAGGCAAAACTGGG - Intergenic
979337194 4:119476714-119476736 ACATGCATCAAGGCAGGCCTAGG - Intergenic
981351703 4:143737321-143737343 TCATGCCCCTAGGCAGAACTTGG - Intergenic
985722666 5:1497892-1497914 ACCTGGCCCAGCTCAGGACTTGG + Intronic
985722990 5:1500605-1500627 TCCTGTCCGAAGGCAGGGCTGGG + Intronic
987029057 5:13959457-13959479 ACCAGCCCCAAGTCAGAACCAGG + Intergenic
988900065 5:35722285-35722307 CCCTGCCCCATGCCAGGGCTGGG - Intronic
990182140 5:53173272-53173294 ACATGCTCCAAGGCAGGAGTGGG - Intergenic
992359758 5:76025014-76025036 AGCTTCCCGAAGGCAGCACTGGG - Intergenic
1002495084 5:179606333-179606355 ACCTGGCCCAACTCAGGGCTTGG - Intronic
1002691285 5:181052660-181052682 ACCCGCCCGCAGGCAGGACGTGG - Intronic
1004168407 6:13276479-13276501 ACCTGTCCCAAGGCCGGGCGCGG + Intronic
1005685774 6:28251980-28252002 TTCTGACCCAAGGCAGTACTCGG + Exonic
1005919195 6:30383741-30383763 ACCTGCCCAAAGGCTGTGCTGGG - Intergenic
1006401542 6:33820759-33820781 ACCTGCCCACAGGGAGGAGTGGG - Intergenic
1006472920 6:34238131-34238153 TCCTGCCCCAAGGCGGGCTTGGG + Intronic
1007371108 6:41427616-41427638 ACCTGCCCCGGGGCAGGCCGGGG - Intergenic
1007747051 6:44049633-44049655 ACCTGCTCCAAGCCAGGCCCTGG - Intergenic
1008956420 6:57221613-57221635 GCCTGCCCCAAGTCCCGACTGGG - Intronic
1012593010 6:101005830-101005852 ACCTGCCCCATGGCTCCACTGGG - Intergenic
1014823303 6:126018178-126018200 ATGTGCCCCAAAGTAGGACTTGG + Intronic
1019416909 7:932035-932057 CCCGGCCCCCAGGCAGGGCTGGG - Intronic
1019947005 7:4337990-4338012 ACCTCCTCCAAGGCTGGACTGGG + Intergenic
1020010949 7:4805538-4805560 CCCTGCCCCAGGGCAGGAGAGGG - Intronic
1020365923 7:7380443-7380465 ACCCACCACAAGGCAGGACAAGG + Intronic
1020427201 7:8081199-8081221 CCCTACCCCAAGGCAGTGCTTGG + Intronic
1021908245 7:25357937-25357959 ACGGGCCCCAAGGCAGTATTGGG - Intergenic
1021993550 7:26158742-26158764 GCCTGCCTCAAGTCAGGGCTTGG - Intronic
1022506041 7:30909101-30909123 TCCTGCCCCAATGCAGAACAAGG + Intergenic
1023881233 7:44322832-44322854 CCCTGCCCAAAGGAAGGGCTTGG - Intronic
1027263369 7:76480522-76480544 ACCTGCACCAGGGAAGGGCTTGG - Exonic
1027314747 7:76978629-76978651 ACCTGCACCAGGGAAGGGCTTGG - Intergenic
1031423352 7:121576117-121576139 ATCTGCACAAAGGAAGGACTTGG - Intergenic
1033207623 7:139436458-139436480 ACTAGTCCCAAGGAAGGACTGGG - Intergenic
1035187681 7:157139088-157139110 TCCCGCCCCAGGGCAGGGCTGGG + Exonic
1036433849 8:8714795-8714817 ACCTGGCCTGTGGCAGGACTGGG + Intergenic
1040728133 8:50408535-50408557 ATCTGCACCAAGGCAGGAGAGGG + Intronic
1042846886 8:73177366-73177388 CTCTTCCCCAAGACAGGACTAGG - Intergenic
1042857863 8:73285766-73285788 CCCTGCGACAAGGCTGGACTGGG - Intergenic
1043136250 8:76529705-76529727 AGTTGCACCCAGGCAGGACTAGG - Intergenic
1044540622 8:93404872-93404894 AGCTGCCCAGAGGCAGGCCTTGG - Intergenic
1044725457 8:95191022-95191044 ACCTGCCCGAGTGGAGGACTGGG + Intergenic
1047771113 8:128030887-128030909 ACCTGCTCTAGGGCAGGCCTGGG - Intergenic
1049021194 8:139958725-139958747 ACACGCCCCGAGGCAGGACAGGG + Intronic
1049708758 8:144054440-144054462 CCCAGCCTCAAGGCAGGCCTGGG + Intronic
1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG + Intronic
1051342164 9:16121495-16121517 AGCCTCCCCAAGGCCGGACTTGG + Intergenic
1052280625 9:26729374-26729396 AGCTGCCACATGGCAGGTCTGGG + Intergenic
1055847748 9:80587789-80587811 ACCTTCCCAAAGTTAGGACTGGG + Intergenic
1057044240 9:91872565-91872587 ACCAGCCCCAAGGTAGGACTTGG - Intronic
1060748416 9:126153149-126153171 ACCTGGGCCAAGCCAGGACTAGG - Intergenic
1062143196 9:134971537-134971559 ATCTGCCCCAAAGCAGCCCTTGG - Intergenic
1062178871 9:135179970-135179992 ACCTGCCCCATCCCAGCACTGGG + Intergenic
1062479406 9:136744461-136744483 CCCTGCCCAAAGTCAGGCCTGGG - Intronic
1062598692 9:137310621-137310643 CCCCGCTCCAAGTCAGGACTCGG - Intronic
1203748996 Un_GL000218v1:61716-61738 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1188964956 X:36539604-36539626 GCCTGCCCCAGAGCAGGAATTGG + Intergenic
1191864235 X:65690973-65690995 CCATGCCCCTAGGAAGGACTTGG - Intronic
1191867173 X:65713504-65713526 ACCTGTGCAAAGGCAGGAATGGG - Intronic
1197721704 X:129749607-129749629 GTCTACCCCTAGGCAGGACTAGG - Intronic
1200311916 X:155086659-155086681 AGCTTCCTCAAAGCAGGACTGGG + Intronic
1201055443 Y:9985515-9985537 ACCTTCCCGATGGCAGGACTGGG + Intergenic
1201162355 Y:11176730-11176752 ATTTGTCCCAAGGCAGGACAAGG + Intergenic
1201564210 Y:15348667-15348689 ACCTTCTCCACGGCAGGAGTGGG + Intergenic