ID: 1118834998

View in Genome Browser
Species Human (GRCh38)
Location 14:69471399-69471421
Sequence AAGTGGGGATGAGCCAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118834998_1118835007 21 Left 1118834998 14:69471399-69471421 CCACGCCTGGCTCATCCCCACTT No data
Right 1118835007 14:69471443-69471465 CATCTCTGAAGCTGGAGCTCAGG No data
1118834998_1118835004 -4 Left 1118834998 14:69471399-69471421 CCACGCCTGGCTCATCCCCACTT No data
Right 1118835004 14:69471418-69471440 ACTTTCAAATGTGGAAACCAAGG No data
1118834998_1118835008 29 Left 1118834998 14:69471399-69471421 CCACGCCTGGCTCATCCCCACTT No data
Right 1118835008 14:69471451-69471473 AAGCTGGAGCTCAGGCATTCTGG No data
1118834998_1118835006 13 Left 1118834998 14:69471399-69471421 CCACGCCTGGCTCATCCCCACTT No data
Right 1118835006 14:69471435-69471457 CCAAGGCACATCTCTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118834998 Original CRISPR AAGTGGGGATGAGCCAGGCG TGG (reversed) Intergenic
No off target data available for this crispr