ID: 1118837238

View in Genome Browser
Species Human (GRCh38)
Location 14:69485606-69485628
Sequence CTCAGGCTAAGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1171
Summary {0: 1, 1: 0, 2: 8, 3: 97, 4: 1065}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118837230_1118837238 -5 Left 1118837230 14:69485588-69485610 CCTGGCCCTTCTGAAAGGCTCAG 0: 1
1: 0
2: 2
3: 26
4: 241
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837221_1118837238 21 Left 1118837221 14:69485562-69485584 CCACCCACCCTTAAGACGGAGAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837217_1118837238 29 Left 1118837217 14:69485554-69485576 CCCGCCAACCACCCACCCTTAAG 0: 1
1: 0
2: 1
3: 22
4: 222
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837225_1118837238 17 Left 1118837225 14:69485566-69485588 CCACCCTTAAGACGGAGAGGGAC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837218_1118837238 28 Left 1118837218 14:69485555-69485577 CCGCCAACCACCCACCCTTAAGA 0: 1
1: 0
2: 1
3: 41
4: 360
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837219_1118837238 25 Left 1118837219 14:69485558-69485580 CCAACCACCCACCCTTAAGACGG 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837227_1118837238 13 Left 1118837227 14:69485570-69485592 CCTTAAGACGGAGAGGGACCTGG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837232_1118837238 -10 Left 1118837232 14:69485593-69485615 CCCTTCTGAAAGGCTCAGGCTAA 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837224_1118837238 18 Left 1118837224 14:69485565-69485587 CCCACCCTTAAGACGGAGAGGGA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065
1118837226_1118837238 14 Left 1118837226 14:69485569-69485591 CCCTTAAGACGGAGAGGGACCTG 0: 1
1: 0
2: 1
3: 4
4: 70
Right 1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG 0: 1
1: 0
2: 8
3: 97
4: 1065

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118837238 Original CRISPR CTCAGGCTAAGGAGGGAGGA AGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900386526 1:2413301-2413323 CTCAGGCCAGGCAGGGTGGAGGG - Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
901406713 1:9052776-9052798 CAGAGGCCAAGGTGGGAGGATGG + Intronic
901681318 1:10914454-10914476 CCCAGGCACAGGTGGGAGGAGGG + Intergenic
901694664 1:10997882-10997904 CCCAGGCTGAGGAGGGTGGTGGG + Intergenic
901737541 1:11321994-11322016 CTCAGCAGAAGGATGGAGGATGG - Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902328287 1:15717011-15717033 GGGAGGCTGAGGAGGGAGGATGG + Intronic
902774935 1:18668597-18668619 AGGAGGCTAAGGTGGGAGGATGG + Intronic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
902821789 1:18947887-18947909 CTCAGGGTGAGGAGGCAGGCAGG - Intronic
903023989 1:20413897-20413919 CTCAGGCTAAGGCCAGAGAAGGG + Intergenic
903071830 1:20730579-20730601 CTCAGGCTTAGGAAGGAGGGAGG - Intronic
903130899 1:21279068-21279090 CTGAGGCTAAGGAGGGAGCCAGG - Intronic
903186141 1:21630371-21630393 GGGAGGCTGAGGAGGGAGGATGG - Intronic
903563064 1:24243462-24243484 GCCAGGCTAAGTGGGGAGGATGG + Intergenic
904232410 1:29087047-29087069 CTCAGGCTGAGGCAGGAGAATGG - Intronic
904628193 1:31820571-31820593 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904881946 1:33706984-33707006 GTCAGGGTAAGAAAGGAGGAGGG - Intronic
905642130 1:39597456-39597478 GCGAGGCTAAGGTGGGAGGATGG - Intergenic
905690042 1:39936413-39936435 CTCAGGCAGAGGTGGGAGGAAGG + Intergenic
905946011 1:41902025-41902047 GTCTGGCTAAGAAGTGAGGAGGG + Intronic
905972555 1:42153084-42153106 GTGAGGCTCAGGAGGGAGGGTGG - Intergenic
906113861 1:43342446-43342468 GGGAGGCTAAGGTGGGAGGATGG + Intronic
906154708 1:43607081-43607103 CTCAGGCTCAGCAGGAAGGCAGG + Intronic
906215947 1:44039285-44039307 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
906276967 1:44523826-44523848 CTCAGGCTCGGGATGGACGAGGG - Intronic
906495032 1:46299473-46299495 GGGAGGCTAAGGTGGGAGGATGG + Intronic
906628809 1:47347312-47347334 ATGAGGCTGAGGTGGGAGGATGG - Intronic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
906717091 1:47978412-47978434 CTAAGGCCAAGGAGCGATGATGG + Intronic
907101628 1:51842957-51842979 CAGAGGCTGAGGTGGGAGGATGG + Intronic
907358083 1:53892806-53892828 CTCTGGCTGAGGTGAGAGGATGG + Intronic
907358574 1:53896320-53896342 AGGAGGCTAAGGTGGGAGGATGG - Intronic
907645715 1:56241166-56241188 CTCAGGGGACGGAGGCAGGAGGG + Intergenic
908028775 1:59977865-59977887 CTGAGGCTAAAGAAGGGGGAAGG - Intergenic
908263155 1:62354240-62354262 CACAGGATTAGGAGGCAGGAAGG + Intergenic
908379967 1:63588374-63588396 TTCAGGGGTAGGAGGGAGGAGGG + Intronic
908999471 1:70201061-70201083 GACAGGCTGAGGAGGGAAGATGG + Intronic
909206089 1:72759523-72759545 CTCAGGATAGGGAGGGTGGCAGG - Intergenic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
909543164 1:76813619-76813641 CTCATGCTGAGGAGTGAGGGTGG - Intergenic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
910185841 1:84538902-84538924 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
910197001 1:84652316-84652338 TGGAGGCTGAGGAGGGAGGATGG + Intronic
910491900 1:87781910-87781932 CAAATGCTAAGGAGGGAGGAAGG - Intergenic
910525374 1:88172127-88172149 GGCAGGCTGAGGCGGGAGGATGG + Intergenic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
912369752 1:109164776-109164798 CTCAGGCTGGGCAGGGAGGATGG + Intronic
912697909 1:111855299-111855321 CTCATACTCAGGAGGGAGGCTGG - Intronic
912875584 1:113355359-113355381 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913163891 1:116168186-116168208 GAGAAGCTAAGGAGGGAGGATGG + Intergenic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
913214501 1:116609349-116609371 CGGAGGCTGAGGTGGGAGGATGG - Intronic
913549587 1:119904213-119904235 CTCAGGAAAAGAAGGGAGGGAGG + Intergenic
915021714 1:152786097-152786119 CTCAGCCTGGGGAGGGAGGCAGG + Intronic
915150704 1:153828963-153828985 CAGAGGCTGAGGTGGGAGGATGG + Intronic
915241311 1:154524269-154524291 GGGAGGCTAAGGTGGGAGGATGG - Intronic
915243792 1:154542330-154542352 TGGAGGCTGAGGAGGGAGGATGG - Intronic
915304625 1:154970374-154970396 CCCAGGCAGAGGAGGCAGGATGG + Exonic
915580108 1:156808496-156808518 CTCAGGCTGAGCAGGGAGCCTGG + Intronic
915692124 1:157700162-157700184 CTGAGGCTTAAGAGGGAGGGTGG + Intronic
915777125 1:158502005-158502027 CTCTGGCTGAGGCGGGAGAATGG - Intergenic
916444617 1:164860845-164860867 CTCAGACAAGAGAGGGAGGAAGG + Intronic
917135755 1:171786769-171786791 CAAAGGCTGAGGTGGGAGGATGG - Intronic
917322387 1:173796792-173796814 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
918424962 1:184399465-184399487 GACAGGCTGAGGTGGGAGGATGG - Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918743216 1:188163600-188163622 CTCAGGACAAGGATGGAGTATGG - Intergenic
919074295 1:192795210-192795232 CACAGGCTAAGGTGGGAGGATGG + Intergenic
919697314 1:200590919-200590941 GGGAGGCTAAGGTGGGAGGATGG + Intronic
919843586 1:201626864-201626886 CTCAGGCTGAGAAGTGAGGGCGG + Intronic
919955843 1:202414885-202414907 GGGAGGCTAAGGTGGGAGGATGG - Intronic
920465334 1:206179258-206179280 GGGAGGCTAAGGTGGGAGGAAGG - Intergenic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920820239 1:209373711-209373733 ATCAGGCTCAGGAAGGAAGAAGG + Intergenic
921168399 1:212524276-212524298 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
921193847 1:212733325-212733347 GGGAGGCTAAGGTGGGAGGATGG + Intronic
921293870 1:213683841-213683863 CCCAGGGTGAGGAGGGAGGGAGG - Intergenic
921366981 1:214383523-214383545 CTCTGGCCATGGCGGGAGGAAGG + Exonic
921385462 1:214564396-214564418 AGCAGGCTGAGGTGGGAGGATGG - Intergenic
921559890 1:216644531-216644553 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921694038 1:218186335-218186357 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
921703196 1:218290570-218290592 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921939476 1:220825152-220825174 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
922322443 1:224500566-224500588 GGGAGGCTGAGGAGGGAGGATGG + Intronic
923023915 1:230189205-230189227 CTGAGGCTTAGGAGAGACGAGGG + Intronic
923344908 1:233042330-233042352 TTCAGGCAAAGGAAAGAGGAGGG - Intronic
924191529 1:241557721-241557743 GGTAGGCTGAGGAGGGAGGATGG + Intronic
924243752 1:242062342-242062364 CACAGGCCCAGGAGGGAGCAGGG + Intergenic
924286921 1:242496953-242496975 CTCAGCCAGAGGATGGAGGAAGG - Intronic
1062779487 10:188486-188508 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1062809248 10:449541-449563 TCCAGGCTAAGGAGTGAGTAAGG + Intronic
1062878066 10:957899-957921 AGGAGGCTGAGGAGGGAGGAGGG - Intergenic
1063243418 10:4194139-4194161 GGGAGGCCAAGGAGGGAGGACGG - Intergenic
1063411493 10:5840041-5840063 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1063448885 10:6138034-6138056 GGAAGGCTGAGGAGGGAGGATGG - Intergenic
1064419394 10:15177849-15177871 GGAAGGCTAAGGTGGGAGGATGG - Intergenic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1064695678 10:17963054-17963076 AGGAGGCTAAGGTGGGAGGATGG + Intronic
1064740866 10:18432729-18432751 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1064777290 10:18792978-18793000 GGGAGGCTAAGGAGGGAGAATGG - Intergenic
1064814576 10:19244463-19244485 CCAAGGCTGAGGTGGGAGGATGG + Intronic
1064898651 10:20269483-20269505 TTCTGGCTAAGCAGAGAGGAAGG + Intronic
1064977162 10:21129349-21129371 AAAAGGCTAAGGTGGGAGGATGG - Intronic
1065013268 10:21438778-21438800 GAGAGGCTAAGGTGGGAGGATGG - Intergenic
1065286792 10:24194424-24194446 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1065356105 10:24843220-24843242 GAGAGGCTAAGGTGGGAGGATGG + Intergenic
1065901837 10:30214912-30214934 CCCAGAGTAAGGAGGGAGGAGGG - Intergenic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1066265071 10:33768804-33768826 CAGAGGCTAAGGTGAGAGGATGG + Intergenic
1066277734 10:33885409-33885431 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1067060121 10:43073982-43074004 CACAGGGAAGGGAGGGAGGAGGG - Intergenic
1067743575 10:48915304-48915326 CTGAGGCTCAGAAGTGAGGAAGG + Intronic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068032853 10:51724799-51724821 CTCAGGCTGAGGCAGGAGGACGG - Intronic
1068218228 10:54010447-54010469 CTCAGGCTCAGGAGGGAATGTGG + Intronic
1068571141 10:58630531-58630553 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1068677898 10:59786916-59786938 CTGAGGCTAAGGCAGGACGAAGG + Intergenic
1068709807 10:60121585-60121607 GGAAGGCTGAGGAGGGAGGATGG + Intronic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1069425728 10:68287157-68287179 CTCAGGCAAACCAGGCAGGATGG - Intronic
1069442560 10:68442028-68442050 CCCAGGATGAGGTGGGAGGATGG - Intronic
1069690918 10:70351433-70351455 CTCATTCTATGGAAGGAGGAGGG - Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1069917399 10:71796001-71796023 CCCAGGCTGGGGAGCGAGGATGG - Exonic
1069985285 10:72278734-72278756 CTCAGGCTACGAGGAGAGGAGGG + Intergenic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070124658 10:73611407-73611429 GGAAGGCTAAGGTGGGAGGATGG + Intronic
1070269376 10:74938048-74938070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1070331044 10:75417570-75417592 CTCAGAGTGAGGAGGGAGGAAGG - Intergenic
1070753690 10:78978492-78978514 ATCAGCCTCAGGTGGGAGGAGGG - Intergenic
1070769945 10:79076386-79076408 CTCAGGGTGAGGACGAAGGATGG + Intronic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1072167399 10:92827367-92827389 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
1072449764 10:95530716-95530738 CTCTGGCTAAGCTGGGAGGAGGG - Intronic
1072620675 10:97077024-97077046 GGCAGGCTGAGGTGGGAGGATGG + Intronic
1072699582 10:97630953-97630975 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1072702733 10:97655677-97655699 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1073018595 10:100421845-100421867 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1073070507 10:100790525-100790547 CACAGGCTATGGAAGCAGGAAGG + Intronic
1073108334 10:101046216-101046238 CAGAGGCCAAGGTGGGAGGATGG + Intergenic
1073172929 10:101527647-101527669 AGGAGGCTAAGGTGGGAGGATGG + Intronic
1073232422 10:101983384-101983406 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1073293881 10:102426734-102426756 CGGAGGCTAAGGCAGGAGGATGG - Intronic
1073296098 10:102439745-102439767 CTGAGGCTAAGGCAGGAGAATGG + Intergenic
1073357391 10:102868199-102868221 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1073394021 10:103203457-103203479 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1073396323 10:103221099-103221121 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1073632171 10:105159995-105160017 CCCAGGCTGAGGAGAGATGAAGG + Intronic
1074129727 10:110563346-110563368 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074847178 10:117408604-117408626 CAGAGGCTTAGGAGGGAGCATGG + Intergenic
1075087364 10:119422574-119422596 GGAAGGCTCAGGAGGGAGGAGGG - Intronic
1075155658 10:119974261-119974283 TTCTCGCTAAGGAGGGAGGGGGG - Intergenic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075808782 10:125209229-125209251 CTCAGGCCAGAGAGGGAGAAAGG + Intergenic
1076149950 10:128153771-128153793 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
1076298080 10:129403059-129403081 CTCAAGCCCAGGAGGCAGGAGGG - Intergenic
1076657745 10:132036141-132036163 TTCAGGGTAAAGCGGGAGGAAGG - Intergenic
1076675125 10:132143730-132143752 CTCAGGATAAGGAAGGGGGCAGG + Intronic
1076722558 10:132399056-132399078 CTCAGGCTCAGGGGAGATGAGGG - Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1077276991 11:1716439-1716461 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
1077279673 11:1736994-1737016 TTCAGGGTAAGGAAGGAGGCAGG + Intronic
1077884181 11:6373877-6373899 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1078052462 11:7978706-7978728 CACAGGCTGAGGTGGAAGGAGGG - Intronic
1078148344 11:8737850-8737872 ATGAGGCTAAGGTGGGAAGATGG - Intronic
1079061990 11:17257062-17257084 CAAAGGCTAAGATGGGAGGATGG + Intronic
1079221311 11:18563484-18563506 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1079376795 11:19900206-19900228 TTGAGGCTAAGTAGGCAGGATGG + Intronic
1080321971 11:31020674-31020696 GGGAGGCCAAGGAGGGAGGATGG - Intronic
1080925265 11:36749687-36749709 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1082631008 11:55541952-55541974 GGGAGGCAAAGGAGGGAGGATGG + Intergenic
1082797549 11:57388972-57388994 CTGAGGCTGAGGTGGGAGCATGG - Intronic
1082845521 11:57722098-57722120 GACAGGCTCAGGTGGGAGGATGG - Intronic
1083336499 11:61924762-61924784 CTCAGACGAAGAAGGGAGGAAGG + Intergenic
1083422033 11:62559059-62559081 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
1083563642 11:63694575-63694597 CGGAGGCTGAGGTGGGAGGACGG - Intronic
1083704100 11:64501285-64501307 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083941162 11:65896705-65896727 CACAGGCTTAGGAGGGGGTAAGG - Intronic
1084628623 11:70329984-70330006 GGGAGGCTAAGGCGGGAGGATGG - Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085193669 11:74651774-74651796 ATCAGGCTAGAGAGGGAGGCTGG + Intronic
1085216701 11:74839255-74839277 TCTAGGTTAAGGAGGGAGGAGGG + Exonic
1085304219 11:75476087-75476109 CTGAGGCTAAGGTGAGAAGAAGG - Intronic
1085535036 11:77212515-77212537 CTCAGGCTGCGGGTGGAGGAGGG + Intronic
1085880834 11:80464382-80464404 CTCAGACTAACGAAGGAGTAAGG + Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1086678131 11:89635034-89635056 GGCAGGCTGAGGTGGGAGGATGG + Intergenic
1087037244 11:93767842-93767864 TGGAGGCTAAGGTGGGAGGATGG - Intronic
1087471302 11:98578591-98578613 GAAAGGCTGAGGAGGGAGGATGG - Intergenic
1087585184 11:100110080-100110102 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1087855888 11:103091736-103091758 GTCCAGCAAAGGAGGGAGGAGGG + Intronic
1088269833 11:108022675-108022697 CCCAGACCAAGGAGGGAGGGTGG - Intronic
1088295606 11:108290524-108290546 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088579269 11:111299759-111299781 CGGGGGCGAAGGAGGGAGGAGGG + Intronic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1089489731 11:118874956-118874978 GTGAGGCCAAGGTGGGAGGATGG + Intergenic
1089536537 11:119163753-119163775 CTCAGGCCCAGGAGAGAAGAGGG - Intergenic
1089775396 11:120832072-120832094 CTCAAGGCAAGGAGGGGGGAGGG - Intronic
1090016898 11:123094209-123094231 ATGAGGCTAAGGTGGGAGAATGG - Intronic
1090634627 11:128683321-128683343 CTCAGGAAAAGAAGGAAGGAAGG + Intergenic
1090849186 11:130556805-130556827 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1091552463 12:1546871-1546893 CTCAGGTTCAGGATGTAGGAGGG + Intronic
1091661262 12:2385524-2385546 CTAAGGCTACAGAGGGAGGGAGG - Intronic
1092264872 12:6973270-6973292 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093097255 12:14985583-14985605 CACAGGCTACGGAGGGAGGGTGG - Intergenic
1093886486 12:24467456-24467478 GTCAGGCCAAGAAAGGAGGAAGG + Intergenic
1094687424 12:32731762-32731784 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1095951051 12:47782153-47782175 CCCAGCCTAAGCAGAGAGGAAGG - Exonic
1095954231 12:47797336-47797358 TTCAGGCAAAGGAAGGGGGAAGG - Intronic
1096138325 12:49221285-49221307 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1096335582 12:50753286-50753308 TTCAGGCCAAGGTAGGAGGATGG + Intergenic
1096336328 12:50759388-50759410 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1096411505 12:51379922-51379944 CACAGGGTAAGGAGGGAGTCGGG + Intronic
1096428601 12:51524679-51524701 CTCAGGCTAAGGAGACAGGAAGG - Intergenic
1096575982 12:52553097-52553119 CTCAGATGCAGGAGGGAGGAAGG + Exonic
1096624959 12:52889084-52889106 CTCAGGCACAGGATGGAGGAGGG - Intergenic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1097214981 12:57403705-57403727 GTGAGGCTGAGGTGGGAGGAGGG + Intronic
1097240035 12:57568866-57568888 CTCAGTCCACGGAGGAAGGAAGG - Intronic
1097903019 12:64891909-64891931 CTCACATTGAGGAGGGAGGAGGG + Intergenic
1098125928 12:67292847-67292869 TTCTGGCCAAGGAGGGAGGGAGG + Intronic
1098311779 12:69156057-69156079 CAGAGGCTGAGGCGGGAGGATGG + Intergenic
1098355497 12:69609257-69609279 GGCAGGCTGAGGCGGGAGGAAGG + Exonic
1098572231 12:72001280-72001302 CTAAGGGTAATGAGGGAGTAAGG + Intronic
1098622525 12:72620416-72620438 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1098641097 12:72839185-72839207 CTCAGGCTGGGGAAGGAGCAAGG + Intergenic
1098660171 12:73083139-73083161 GGCAGGCTGAGGTGGGAGGACGG + Intergenic
1098663572 12:73131243-73131265 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1099021768 12:77414545-77414567 AGAAGGCTAAGGCGGGAGGATGG + Intergenic
1099532631 12:83803534-83803556 CTCAGGCTGAGGCAGGAGAATGG + Intergenic
1100195750 12:92242446-92242468 GACAGGCTGAGGTGGGAGGATGG - Intergenic
1100197207 12:92260476-92260498 CCCAGGTGAAGGAGGGAGGGAGG - Intergenic
1100403499 12:94252324-94252346 GGGAGGCCAAGGAGGGAGGACGG + Intronic
1100409573 12:94301942-94301964 ATAAGGCTAAGGAAGGAGGAGGG - Intronic
1100581599 12:95944519-95944541 GTCAAGCTGAGGTGGGAGGATGG - Intronic
1100588230 12:95999266-95999288 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1100595478 12:96068237-96068259 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1101002187 12:100367790-100367812 GGCAGGCTGAGGTGGGAGGATGG - Intronic
1101207276 12:102501197-102501219 CGGAGGCTGAGGCGGGAGGATGG + Intergenic
1101432062 12:104634931-104634953 ATCAAGGGAAGGAGGGAGGAAGG + Intronic
1101850885 12:108401280-108401302 GGGAGGCTAAGGAGGGAGGCTGG - Intergenic
1101962832 12:109262723-109262745 CTCAGGCTGAGATGGGAGGATGG - Intronic
1102050629 12:109859157-109859179 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1102188514 12:110968158-110968180 CTCATGCTAAGGATGAAAGAAGG - Intergenic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102603182 12:114048652-114048674 CTCAAGCTAAGGAAGGTGGGAGG - Intergenic
1102871954 12:116420584-116420606 CCCAGGCTGAGTAGGCAGGAAGG + Intergenic
1103119083 12:118365493-118365515 GGGAGGCTAATGAGGGAGGAGGG - Intronic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1103326217 12:120122785-120122807 GGAAGGCTGAGGAGGGAGGATGG + Intergenic
1103497961 12:121377499-121377521 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1103589403 12:121980585-121980607 GGGAGGCTAAGGAGGGTGGATGG - Intronic
1103662562 12:122532968-122532990 CTCAGGCTGAGGCAGGAGAATGG + Intronic
1103714521 12:122936524-122936546 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1103881808 12:124172124-124172146 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1104607118 12:130198325-130198347 CTCATGCTCTGCAGGGAGGAGGG - Intergenic
1104698256 12:130880825-130880847 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104772727 12:131373881-131373903 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1105218230 13:18302821-18302843 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1105320044 13:19310727-19310749 GGCAGGCTGAGGTGGGAGGATGG + Intergenic
1105323617 13:19350440-19350462 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1105870329 13:24499057-24499079 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1106027378 13:25968108-25968130 TTCACGCTAAAGAGGGAGGGAGG + Intronic
1106094200 13:26628559-26628581 TTCATGCAAAGGAGGCAGGAAGG - Intronic
1106125791 13:26899042-26899064 CTGAGACTAAGGATGGAGCATGG + Intergenic
1106174543 13:27318784-27318806 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
1106679139 13:31992427-31992449 GGGAGGCTAAAGAGGGAGGATGG - Intergenic
1106961514 13:35003930-35003952 GTCAGGGTAGGGTGGGAGGAGGG - Intronic
1107164125 13:37265479-37265501 CACAGGCTGTGGAGGGAGCATGG - Intergenic
1107515608 13:41125824-41125846 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
1107584239 13:41826767-41826789 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1107619298 13:42209105-42209127 CTTGGGCTAAGGAGGGTTGAAGG + Intronic
1107710688 13:43147532-43147554 GGGAGGCCAAGGAGGGAGGACGG + Intergenic
1107821196 13:44287135-44287157 CTCAGGGTATTGAGGGTGGATGG + Intergenic
1108688222 13:52839168-52839190 TTGAGGCTGAGGAGGGAGGCAGG + Intergenic
1109214489 13:59572427-59572449 CAGAGACTAAGGAGGGAGGGTGG + Intergenic
1109774414 13:67021538-67021560 CTCAGGCTCATGAAGGATGATGG + Intronic
1110061804 13:71050202-71050224 CTCAGTCTAATGAGGCAGGTAGG + Intergenic
1110451558 13:75642363-75642385 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1110473356 13:75885538-75885560 CAGAGGCCAAGGAGGGTGGACGG - Intergenic
1110756505 13:79181034-79181056 TGGAGGCTAAGGTGGGAGGATGG - Intergenic
1111600303 13:90464795-90464817 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1112005374 13:95249114-95249136 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1113531654 13:111031950-111031972 CTCAGCTTGAGGATGGAGGAAGG + Intergenic
1113740959 13:112712130-112712152 CTCAGGGTGGGGAGGGAGAACGG - Intronic
1113759552 13:112837897-112837919 AGCAGCCTCAGGAGGGAGGAGGG + Intronic
1113896201 13:113766057-113766079 CTCAGGCTCAGGAGGGCGTCAGG - Intronic
1114199625 14:20507850-20507872 GGCAGGCTGAGGTGGGAGGATGG - Intronic
1114441002 14:22747528-22747550 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1114492740 14:23113570-23113592 CTCATGCTGAGTCGGGAGGAGGG + Intergenic
1114560887 14:23589638-23589660 AATGGGCTAAGGAGGGAGGAGGG - Intergenic
1114646404 14:24258885-24258907 CTAAGGGAAAGGAGGGAGAAGGG - Intronic
1115241477 14:31254559-31254581 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1115512056 14:34147398-34147420 CTCCGGATAAGGAGGAGGGAAGG + Intronic
1115662142 14:35507115-35507137 ATCAGACAGAGGAGGGAGGAAGG + Intergenic
1115805740 14:37049330-37049352 GGCAGGCCAAGGTGGGAGGATGG + Intronic
1116897921 14:50335189-50335211 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1117180887 14:53190550-53190572 CAAGGGCTAAGGTGGGAGGATGG - Intergenic
1117554597 14:56871247-56871269 CTAAGGCTAAGGCAGGAGAATGG - Intergenic
1117693871 14:58339067-58339089 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1118192102 14:63590135-63590157 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1118313106 14:64707144-64707166 CTTCTGCTGAGGAGGGAGGATGG - Intronic
1118405277 14:65416886-65416908 CAGAGGCTAAGGCGGGAGAATGG - Intronic
1118470987 14:66075181-66075203 CTCAGGCTGCAGAGGGAGGCAGG - Intergenic
1118613760 14:67561457-67561479 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1118634137 14:67732331-67732353 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1118638308 14:67768190-67768212 CTAGGGGTAAGGAGGGAGCATGG + Intronic
1118824811 14:69370352-69370374 CTCAGGCTGAGGGGAGAGGGTGG + Intergenic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118971480 14:70641849-70641871 CGCAGGTTGCGGAGGGAGGAGGG + Exonic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1119289669 14:73485505-73485527 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1119386340 14:74260074-74260096 CTCTGGCCAAGGGGAGAGGAGGG - Intronic
1119456106 14:74756836-74756858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1119500488 14:75122901-75122923 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1119634650 14:76264124-76264146 GACAGGCAGAGGAGGGAGGATGG + Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1120963152 14:90143310-90143332 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121597851 14:95179522-95179544 CCCAGGCTGCGGATGGAGGAAGG + Intergenic
1121655257 14:95590541-95590563 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122117604 14:99535590-99535612 GTCGGGCCCAGGAGGGAGGAGGG + Intronic
1122284320 14:100641853-100641875 GTCAGGCTGGGGAGGGAGCAGGG - Intergenic
1122307444 14:100774701-100774723 GTGAGGCTGAGGCGGGAGGATGG - Intergenic
1122312032 14:100803566-100803588 GACAGGCCAAGGTGGGAGGATGG + Intergenic
1122462998 14:101911168-101911190 CTCGGGCTGAGGCAGGAGGATGG + Intronic
1122495469 14:102151498-102151520 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1122565823 14:102655048-102655070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1122855440 14:104557772-104557794 CTCAGGCTCAGCTGGGATGATGG + Intronic
1124230919 15:27945514-27945536 GGCAGGCTCAGGAAGGAGGAAGG - Intronic
1124612138 15:31215985-31216007 CTCGGGCTGAGGAGGCAGGAGGG - Intergenic
1124776383 15:32593531-32593553 CGCAGGGTGGGGAGGGAGGAAGG - Exonic
1124954510 15:34351306-34351328 TAGAGGCTAAGGTGGGAGGATGG + Intronic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1125550511 15:40541163-40541185 CTCACGCAGAGGAGAGAGGAGGG - Intronic
1125594446 15:40875304-40875326 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1125624847 15:41099675-41099697 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1125668576 15:41452627-41452649 CAGAGGCTAAAGTGGGAGGATGG + Intronic
1126036985 15:44555959-44555981 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1126751053 15:51876956-51876978 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1127286960 15:57540976-57540998 CTCTGCCTAAGGATGGAGGCAGG + Intronic
1127456513 15:59160512-59160534 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1128252673 15:66173956-66173978 CTCAGGCTATAGAGGAAGGCAGG - Intronic
1128516381 15:68344511-68344533 CACAGGCTGAAGAGGCAGGAGGG + Intronic
1128585993 15:68850730-68850752 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1128655735 15:69460659-69460681 CAGAGGCTAAGGTGGGAAGATGG - Intergenic
1129005486 15:72369640-72369662 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1129102177 15:73275548-73275570 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1129171341 15:73810018-73810040 CTCAGGAGAGGGAGGAAGGAAGG + Intergenic
1129525692 15:76212677-76212699 CTCAGGCTCTGGAGGCAGCAGGG + Intronic
1129793167 15:78355415-78355437 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130091534 15:80825057-80825079 CACCAGCTAAAGAGGGAGGAAGG + Intronic
1130094680 15:80847151-80847173 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1131009719 15:89006993-89007015 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1131069776 15:89458867-89458889 CTCAGGCAAAGGATTGGGGATGG - Intergenic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131468058 15:92671389-92671411 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132569625 16:638440-638462 CACAGGCCAGGGAGGCAGGACGG - Intronic
1132745563 16:1434794-1434816 CTCCGGCTGTGGAGTGAGGAGGG - Exonic
1132751237 16:1458628-1458650 CTCAGGCTAAGGAACGATGGCGG + Intronic
1132754483 16:1475919-1475941 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1132977976 16:2719975-2719997 CTCAGGGGCAGGAGGGATGATGG + Intronic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133742170 16:8659963-8659985 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1133748976 16:8709909-8709931 CTCAGGCGGCGGAGGGAGGATGG - Intronic
1133954867 16:10433412-10433434 GGGAGGCTAAGGAGGGAGGGTGG - Intronic
1134073673 16:11276035-11276057 CCCAGGCACAGGAGGGAGGCGGG - Intronic
1134081330 16:11327081-11327103 CTCAGGCCAAGGGAGGAGGAAGG + Intronic
1134501898 16:14775872-14775894 CAGAGGCCAAGGAGGGTGGATGG - Intronic
1134578663 16:15353022-15353044 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1134604642 16:15560686-15560708 TGGAGGCTGAGGAGGGAGGATGG + Intronic
1134723925 16:16404523-16404545 CAGAGGCCAAGGAGGGTGGATGG - Intergenic
1134901080 16:17938632-17938654 CACAGATTAAGGAGGGAGGTTGG - Intergenic
1134943505 16:18307347-18307369 CAGAGGCCAAGGAGGGTGGATGG + Intergenic
1135019530 16:18951807-18951829 GGTAGGCCAAGGAGGGAGGATGG + Intergenic
1135033843 16:19060307-19060329 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1135122729 16:19780408-19780430 GAGAGGCCAAGGAGGGAGGATGG - Intronic
1135277781 16:21128307-21128329 TGGAGGCTAAGGAGAGAGGATGG + Intronic
1135283921 16:21176793-21176815 AAGAGGCTGAGGAGGGAGGATGG + Intronic
1135583866 16:23652251-23652273 GTCAGGCTAGGGAGGTAGGTGGG - Intronic
1135686305 16:24500893-24500915 GAGAGGCTAAGGTGGGAGGATGG - Intergenic
1135729935 16:24885541-24885563 GACAGGCTGAGGTGGGAGGATGG + Intronic
1135767170 16:25187806-25187828 CACAGGCCAAGGAGAGAGGCTGG - Intergenic
1135980033 16:27140263-27140285 CTCAGTCTAAGGAAGGCGGTGGG + Intergenic
1136007112 16:27338456-27338478 GGGAGGCTAAGGAGGGAGGATGG - Intronic
1136471108 16:30480890-30480912 CGGAGGCTGACGAGGGAGGATGG + Intronic
1136495534 16:30641239-30641261 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1137012225 16:35333282-35333304 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137016583 16:35382067-35382089 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137018958 16:35403720-35403742 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137026046 16:35475899-35475921 ATGAGGCTAAGGCAGGAGGATGG + Intergenic
1137600820 16:49755047-49755069 CTCCTGCTGAGGAGGGAGGCAGG - Intronic
1137738955 16:50746140-50746162 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1137878098 16:52016974-52016996 GGGAGGCTAAGGAGGCAGGATGG - Intronic
1137901140 16:52270810-52270832 CACAGGCTAAGGCGGAGGGAAGG - Intergenic
1137977926 16:53046578-53046600 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1138143607 16:54588988-54589010 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1138923079 16:61556270-61556292 CTCAGGCTCAGCAGGGAGCGCGG + Intergenic
1138969896 16:62131714-62131736 GTCAGGCAAAGGAGAGAGGAAGG - Intergenic
1139378796 16:66517278-66517300 CACAGGCAAAGGCGGGAGGAAGG + Intronic
1139517930 16:67462721-67462743 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1139586618 16:67908046-67908068 CCCAGGCAGAGGAGTGAGGAGGG + Intronic
1139677340 16:68533278-68533300 CTCAGGCTGAGGCAGGAGAATGG - Intronic
1139782604 16:69364298-69364320 CTCAGGGAAGGGAGGGAGGGAGG - Intronic
1140088859 16:71820490-71820512 CGGAGGCTAACGTGGGAGGATGG - Intergenic
1140142028 16:72267223-72267245 CTCAGGTGAAGGAGGCAAGAAGG - Intergenic
1140662413 16:77199970-77199992 GACAGGCAAAGGAGGGTGGAGGG + Exonic
1141087036 16:81103198-81103220 CTGGGTCTAAGGTGGGAGGATGG + Intergenic
1141338156 16:83176874-83176896 CTCAGGCTGATGGGAGAGGAAGG - Intronic
1141540241 16:84714421-84714443 GGGAGGCTAAAGAGGGAGGATGG - Intronic
1141552605 16:84816243-84816265 GGCAGGCTGAGGTGGGAGGACGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141834510 16:86529842-86529864 TGGAGGCTGAGGAGGGAGGATGG + Intergenic
1142620815 17:1164769-1164791 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1142632242 17:1232551-1232573 CGCAGGCTGAGGAGGGAGGATGG - Intergenic
1142681694 17:1553479-1553501 GGCAGGCCAAGGTGGGAGGATGG - Intronic
1143023640 17:3929089-3929111 CCCAGGCTGGGGTGGGAGGAAGG - Intronic
1143057439 17:4172962-4172984 CTCAGGCTGAGGCAGGAGAATGG - Intronic
1143139559 17:4733681-4733703 CACCTGCTAAGGAGGGAGGGTGG + Exonic
1143310314 17:5982345-5982367 CCCTGGCCCAGGAGGGAGGAAGG + Intronic
1143310441 17:5983576-5983598 CCCTGGCCCAGGAGGGAGGAAGG - Intronic
1143673752 17:8415281-8415303 GGCAGGCTGAGGTGGGAGGATGG - Intronic
1144285293 17:13768738-13768760 CCCAGGCCAAGGAAGGAGTAAGG - Intergenic
1145080807 17:19892885-19892907 CACAGGCTAAGGGAGGAGAAGGG + Intergenic
1145188089 17:20813789-20813811 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1145242372 17:21247530-21247552 CCGAGGCCCAGGAGGGAGGAAGG + Intronic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1145747932 17:27333746-27333768 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1145770899 17:27492300-27492322 GTCAGACTTGGGAGGGAGGAAGG + Intronic
1146003108 17:29143335-29143357 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1146327457 17:31899190-31899212 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1146475272 17:33157669-33157691 CTCAGACCAAGGTGGGAGCAGGG - Intronic
1146519700 17:33516797-33516819 CCCAGGCATGGGAGGGAGGAGGG - Intronic
1146798237 17:35798062-35798084 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1147004134 17:37388058-37388080 AGGAGGCTAAGGTGGGAGGATGG + Intronic
1147138099 17:38446117-38446139 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1147166812 17:38597909-38597931 ATCAGGTTAAGGAGAGAGGTGGG + Intronic
1147266394 17:39237307-39237329 GTCAGGCAGAGGAGGGAGGGAGG + Intergenic
1147309432 17:39586104-39586126 AGGAGGCTAAGGCGGGAGGATGG - Intergenic
1147323143 17:39657947-39657969 CCCAGGGGAGGGAGGGAGGAAGG - Intronic
1147504635 17:41003640-41003662 CTCAGGCTGAGGCAGGAGAATGG - Intergenic
1147615569 17:41825379-41825401 CTCAGGGAAAGGAGGACGGAGGG + Intronic
1147713350 17:42486468-42486490 CCAAGACTAAGGTGGGAGGAAGG - Intronic
1147786468 17:42981719-42981741 CTGAGGCTGAGGCGGGAGGATGG - Intronic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148503001 17:48106188-48106210 CAAGGGCTGAGGAGGGAGGATGG + Intronic
1148658854 17:49310795-49310817 GGTAGGCTAAGGTGGGAGGATGG + Intronic
1148692146 17:49535168-49535190 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1148813110 17:50307472-50307494 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1148885525 17:50769439-50769461 CTTATGCTAAGGTGGGAGGATGG + Intergenic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149758035 17:59204289-59204311 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1150078820 17:62217875-62217897 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1150152714 17:62823725-62823747 AAGAGGCTAAGGTGGGAGGATGG - Intergenic
1150203738 17:63384309-63384331 GGGAGGCCAAGGAGGGAGGACGG - Intronic
1150245523 17:63671905-63671927 AGGAGGCTAAGGTGGGAGGATGG + Intronic
1150376886 17:64688798-64688820 TGCAGGCCAAGGAGCGAGGATGG + Intergenic
1150385383 17:64755288-64755310 GGGAGGCTCAGGAGGGAGGATGG + Intergenic
1150637462 17:66924231-66924253 TTCAGGCAATAGAGGGAGGATGG + Intergenic
1150770951 17:68040332-68040354 GGGAGGCTCAGGAGGGAGGATGG - Intronic
1151214355 17:72567667-72567689 CTCAGTCGAAGGAGACAGGAAGG - Intergenic
1151511963 17:74566252-74566274 CACAGGCTTAGGAGCAAGGAAGG + Intergenic
1151683690 17:75634836-75634858 CTCAGGCTCAGGTGGGCAGAAGG + Intronic
1152005122 17:77675814-77675836 CTCAGATGGAGGAGGGAGGAAGG - Intergenic
1152107537 17:78339853-78339875 AGGAGGCTAAGGCGGGAGGATGG + Intergenic
1152113533 17:78370720-78370742 GGAAGGCTAAGGTGGGAGGATGG + Intergenic
1152174507 17:78778712-78778734 CAGAGGCCAAGGCGGGAGGATGG + Intronic
1152217237 17:79040797-79040819 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1152747276 17:82047012-82047034 CGCAGGCTTAGGAGGGAGGGAGG + Intergenic
1152787668 17:82258100-82258122 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1152895148 17:82906752-82906774 CTCAGGCTTGGGCGGGAGGTGGG - Intronic
1153012697 18:554078-554100 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1153236467 18:2993038-2993060 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1153253896 18:3151080-3151102 GAGAGGCTAAGGTGGGAGGATGG - Intronic
1153280378 18:3409166-3409188 ATCAGGCTTAGGTGGGAAGATGG + Intergenic
1153596300 18:6729066-6729088 CTCAGGCTGAGGAGAGAGGCCGG - Intergenic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1154274924 18:12950136-12950158 GAGAGGCTAAGGTGGGAGGATGG - Intronic
1155259496 18:24027662-24027684 AGGAGGCTAAGGCGGGAGGATGG - Intronic
1155787156 18:29915210-29915232 TTCAGGCAAAGGATGGAGGGTGG - Intergenic
1155980059 18:32170700-32170722 CTCAAGCAAAGGAGGTAGCAAGG - Intronic
1156161555 18:34365153-34365175 GTCAGAATCAGGAGGGAGGAGGG + Intergenic
1156565458 18:38184096-38184118 CTCAGGCTGAGGCAGGAGAATGG - Intergenic
1156620370 18:38844557-38844579 TTCAAGCTAAGGAGAGAGGGAGG + Intergenic
1156921033 18:42522583-42522605 CTCAGAAGAAGGAGGCAGGAAGG + Intergenic
1157216581 18:45788431-45788453 AAGAGGCTAAGGTGGGAGGATGG + Intergenic
1157353450 18:46912075-46912097 CAAAGGCTAGGAAGGGAGGAGGG + Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1157547943 18:48560673-48560695 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1157608239 18:48939662-48939684 CTCAGTTTAGGGTGGGAGGAAGG - Intronic
1157949958 18:52025013-52025035 ATGGGGCTAAGGTGGGAGGAAGG + Intergenic
1158599603 18:58846076-58846098 CTCAGACAAAGGGAGGAGGAAGG + Intergenic
1159116255 18:64116024-64116046 CTAAGACTAGGGATGGAGGAGGG - Intergenic
1160667112 19:336057-336079 AGCAGGGGAAGGAGGGAGGAAGG + Intronic
1160905934 19:1451804-1451826 CTCAGTCGCAGGTGGGAGGATGG - Exonic
1160950233 19:1663347-1663369 GGGAGGCTAAGGATGGAGGATGG - Intergenic
1161323950 19:3654104-3654126 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1161413275 19:4129309-4129331 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1161458511 19:4382137-4382159 CTCTGACAATGGAGGGAGGAGGG - Intronic
1161532551 19:4798802-4798824 CTCAGGATGCGGAGGCAGGATGG - Exonic
1161697468 19:5777493-5777515 CTCTGGCTAGAGAGGGCGGAAGG - Intronic
1161795206 19:6382249-6382271 GGCAGGCTGAGGCGGGAGGATGG + Intronic
1161833897 19:6631717-6631739 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1162048830 19:8019679-8019701 CTCAGGCTGAGGCAGGAGAATGG + Intronic
1162164144 19:8740836-8740858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162165215 19:8748305-8748327 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162166280 19:8755759-8755781 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162167346 19:8763215-8763237 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162168287 19:8769515-8769537 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169354 19:8776968-8776990 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162170034 19:8782280-8782302 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171119 19:8789933-8789955 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162202104 19:9028029-9028051 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1162338337 19:10075574-10075596 TGCAGGCTGAGGTGGGAGGATGG + Intergenic
1162376193 19:10306708-10306730 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1162535980 19:11262845-11262867 CTGAGCCTGAGGAGGGAGGGAGG + Intergenic
1162536020 19:11262960-11262982 CTGAAGCTCAGGAGGGAGGGAGG + Intergenic
1162687432 19:12399746-12399768 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162691745 19:12439589-12439611 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162716141 19:12635574-12635596 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1162864321 19:13532817-13532839 CTCAGACTCATGTGGGAGGAGGG - Intronic
1162897422 19:13773522-13773544 CTCAGGCTGAAGTGGGAGGATGG + Intronic
1163078878 19:14921275-14921297 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1163243242 19:16076877-16076899 CCCAGGCCCAGGAAGGAGGACGG - Intronic
1163299292 19:16433582-16433604 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163436524 19:17299168-17299190 GGGAGGCCAAGGAGGGAGGATGG + Intronic
1163492928 19:17627592-17627614 ATCCAGCTAAGGAGGGAGAAGGG + Exonic
1163559437 19:18010125-18010147 CCCAGGCATAGGAGGGAGGTGGG + Intronic
1163703296 19:18797877-18797899 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
1163724265 19:18913587-18913609 CCCAGGCCAGGGAGGGAGGCTGG + Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164670614 19:30070151-30070173 CTGAGGCCAAGCTGGGAGGAGGG - Intergenic
1164758683 19:30710433-30710455 TGGAGGCTAAGGCGGGAGGATGG + Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165546025 19:36536818-36536840 GGGAGGCTAAGGCGGGAGGATGG + Intronic
1165880027 19:39035885-39035907 CAGAGGCTAAGGCAGGAGGATGG - Intergenic
1165988945 19:39794951-39794973 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1166000787 19:39876252-39876274 CGGAGGCCAAGGCGGGAGGATGG + Intronic
1166146337 19:40838916-40838938 GGAAGGCTAAGGTGGGAGGATGG - Intronic
1166150384 19:40869540-40869562 GGAAGGCTAAGGTGGGAGGATGG - Intronic
1166215427 19:41331505-41331527 CGGAGGCTGAGGCGGGAGGATGG - Intronic
1166325872 19:42050870-42050892 CTCAGGAGAGGGAGGGAGGGAGG + Intronic
1166516264 19:43449295-43449317 CCAAGGCTGAGGAGGGAGGATGG + Intergenic
1166529100 19:43532131-43532153 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1166715107 19:44961925-44961947 GCCAGGGTAAGGAGGGAGAATGG - Intronic
1167474202 19:49690778-49690800 TTCACGCCAGGGAGGGAGGAGGG - Intergenic
1167477282 19:49708395-49708417 CGGAGGCTAAGGCAGGAGGATGG + Intronic
1167507489 19:49878476-49878498 CCTAGGGTAAGGAGGGAGGCGGG - Exonic
1167824124 19:51956554-51956576 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1167836545 19:52076538-52076560 GGAAGGCTAAGGTGGGAGGATGG + Intronic
1167923993 19:52808707-52808729 GGAAGGCTAAGGAGGGAGGATGG + Intronic
1168247985 19:55123790-55123812 CACAGGCTAAGGGAGAAGGAGGG - Intergenic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925093429 2:1173670-1173692 CCCAGGCTTCTGAGGGAGGAGGG - Intronic
926108094 2:10165054-10165076 AGGAGGCTAAGGTGGGAGGATGG - Intronic
926110878 2:10183064-10183086 GGGAGGCTAAGGCGGGAGGATGG + Intronic
926148572 2:10411828-10411850 CTCAGGGCAAGGAGGTAGGCTGG + Intronic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926733894 2:16058073-16058095 CTCATGCTAAGGAAGGAGCCAGG - Intergenic
927264436 2:21129039-21129061 AGGAGGCTAAGGTGGGAGGATGG - Intronic
927538240 2:23882118-23882140 AGGAGGCTAAGGCGGGAGGATGG + Intronic
927628307 2:24747566-24747588 GGGAGGCTAAGGTGGGAGGATGG - Intronic
927830979 2:26349866-26349888 CGGAGGCTGAGGTGGGAGGATGG + Intronic
928034971 2:27814114-27814136 AGGAGGCTAAGGTGGGAGGATGG + Intronic
928128170 2:28630270-28630292 CACAGGCTTGGGAAGGAGGAAGG + Intronic
928148556 2:28805546-28805568 CGCAGGCTAAGGTGGAAGGATGG - Intronic
928401018 2:30978884-30978906 CTCAGGGTAAGCATAGAGGATGG + Intronic
929342139 2:40833271-40833293 GTGAGGCTAAGGTGGCAGGACGG - Intergenic
929599706 2:43197487-43197509 CTCAGGCAAAGCAGAGAGGAGGG + Intergenic
929621949 2:43364117-43364139 GGGAGGCTGAGGAGGGAGGATGG + Intronic
929826007 2:45310242-45310264 CTCAGGATACTGAGAGAGGATGG - Intergenic
929826133 2:45310753-45310775 CTCAGGATACGCAGAGAGGATGG - Intergenic
929881065 2:45837767-45837789 GTGAGGCTGAGGTGGGAGGAAGG + Intronic
929915518 2:46132422-46132444 CCCAGGCTTTGGAGGGAGGCAGG - Intronic
929957249 2:46467522-46467544 ATCAGACTGAGGAGGGAGAAGGG - Intronic
930004004 2:46881746-46881768 TTCAGCCTCAGGTGGGAGGAGGG + Intergenic
930672956 2:54170827-54170849 CACAGTCAAAGGTGGGAGGAGGG + Intronic
930763282 2:55059456-55059478 CGGAGGCTGAGGTGGGAGGATGG - Intronic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
930889900 2:56372603-56372625 CTAAGTCTGGGGAGGGAGGATGG + Intronic
931308860 2:61059337-61059359 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
931369802 2:61651440-61651462 CTCAGGCTGAGGCAGGAGAATGG + Intergenic
931521872 2:63106575-63106597 CCCAGGCCAAGGAGGGAGAGGGG - Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
932008523 2:67952367-67952389 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
932035756 2:68245255-68245277 GGGAGGCTGAGGAGGGAGGATGG + Intronic
932176415 2:69606959-69606981 GGCAGGCTGAGGTGGGAGGATGG + Intronic
932199296 2:69811586-69811608 CTCAAGCTCAGGAAGGAGGCCGG - Intronic
932238516 2:70140003-70140025 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
932418754 2:71589067-71589089 CTCAGGCTGAGGACAGAGGTGGG - Intronic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
932692979 2:73929211-73929233 AAGAGGCTAAGGTGGGAGGATGG - Intronic
933707671 2:85304023-85304045 CTCAGCGCAAGGAGGGAGCAGGG - Intronic
933911534 2:86944810-86944832 AGGAGGCTAAGGTGGGAGGATGG - Intronic
934133269 2:88970164-88970186 CTCAGGCCCTGGAGTGAGGAGGG - Intergenic
934234293 2:90216426-90216448 CTCAGGCCCTGGAGTGAGGAGGG + Intergenic
934882554 2:97996148-97996170 CGCAGGAGAAGGAGGGAGGCAGG + Intergenic
934964081 2:98704663-98704685 GGGAGGCTAAGGTGGGAGGATGG + Intronic
935332468 2:101987059-101987081 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
935698040 2:105786841-105786863 CTAAGGCTAGGGTGGGAGCAGGG - Intronic
935728734 2:106047043-106047065 GTCAGGCTAAGGAGGTATGGGGG - Intergenic
935755171 2:106270991-106271013 CCCAGGATAAGGAGGGAAGGTGG - Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
935991408 2:108721844-108721866 AGGAGGCTAAGGTGGGAGGATGG - Intronic
936092554 2:109510696-109510718 CCCAGGCTGGGCAGGGAGGAGGG - Intergenic
936427018 2:112430850-112430872 AGGAGGCTAAGGTGGGAGGACGG + Intronic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
937104533 2:119297609-119297631 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
937413917 2:121699324-121699346 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
937465756 2:122131733-122131755 CCCAGGCCAAGGAGGGAGAGGGG - Intergenic
937662864 2:124450924-124450946 GGGAGGCTGAGGAGGGAGGATGG + Intronic
938259418 2:129884478-129884500 CTCAGTCTCAGGATGGTGGATGG + Intergenic
938548942 2:132361711-132361733 CTCAGGCGCAGGAGGGAGGACGG - Intergenic
938699681 2:133864753-133864775 TTAAGGCTGAGGTGGGAGGATGG - Intergenic
938798185 2:134735953-134735975 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
939018232 2:136926587-136926609 AGGAGGCTAAGGTGGGAGGATGG + Intronic
940088295 2:149886479-149886501 CGGAGGCCAAGGAGGGTGGATGG + Intergenic
940888405 2:159011638-159011660 AGGAGGCTAAGGAGGGAAGATGG - Intronic
941457778 2:165730597-165730619 AGGAGGCTAAGGAGGGAGAATGG + Intergenic
942206936 2:173628764-173628786 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
943813854 2:192225938-192225960 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
944318499 2:198308936-198308958 GGGAGGCTAAGGTGGGAGGATGG - Intronic
944454924 2:199883525-199883547 CTCAAGTTAATGAGGGTGGAGGG - Intergenic
944596302 2:201264725-201264747 AGCAGGCTGAGGTGGGAGGATGG + Intronic
945188200 2:207160943-207160965 CTCAGGGTAAGGAGTGGGGGTGG + Intronic
945289190 2:208111007-208111029 GTCAGGCTGGGGAGGGGGGAGGG - Intergenic
945452830 2:210013549-210013571 AGGAGGCTGAGGAGGGAGGATGG - Intronic
946265635 2:218539070-218539092 GGGAGGCTAAGGTGGGAGGATGG - Intronic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
946912833 2:224484064-224484086 ATGAGGCTAAGGTGGGAGGATGG + Intronic
947087947 2:226476585-226476607 GGAAGGCTAAGGTGGGAGGACGG + Intergenic
947114229 2:226751611-226751633 TTCAGGCTAAGGAGAAAGGAGGG + Intronic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
947733739 2:232444469-232444491 CTCTGGCCCAGGAAGGAGGAGGG - Intergenic
948070136 2:235114208-235114230 CTCTGCCTAGGGTGGGAGGAAGG - Intergenic
948132207 2:235609008-235609030 AAGAAGCTAAGGAGGGAGGAAGG + Intronic
948386323 2:237583231-237583253 TGGAGGCTAAGGTGGGAGGATGG + Intronic
948674479 2:239588940-239588962 CTGAGACTCAGGTGGGAGGAGGG - Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169042827 20:2509634-2509656 CTGAGGCTGAGGCTGGAGGATGG + Intronic
1169049048 20:2560730-2560752 CGGAGGCTAAGGTGGGAGAATGG + Intronic
1169077940 20:2773378-2773400 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
1169139240 20:3217571-3217593 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169305223 20:4483703-4483725 CTCAGGAAAGGGAGGGAGGGAGG - Intergenic
1169427172 20:5505321-5505343 CACAGGCTGAAGAAGGAGGATGG - Intergenic
1170648906 20:18221346-18221368 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
1170934852 20:20800711-20800733 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171141526 20:22747869-22747891 CTCAGGCTGAGGCAGGAGAATGG + Intergenic
1171187568 20:23133718-23133740 CACTGGTTAGGGAGGGAGGAAGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171877767 20:30594272-30594294 CTCAGGCGCTGGAGGGAGGACGG - Intergenic
1172690225 20:36784782-36784804 ATAAGGCTAAGGAGAGAGGCTGG + Exonic
1173026661 20:39313685-39313707 ATCAGGCTAAGGAATCAGGATGG - Intergenic
1173122935 20:40310351-40310373 CTCAGGCTAAGCAGGAAGACTGG + Intergenic
1173150279 20:40561452-40561474 CTCAGGCAAAGGAGGCTGGTTGG - Intergenic
1173496479 20:43522575-43522597 AGAAGGCTAAGGAGGGAGGATGG - Intronic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173656778 20:44704910-44704932 CTCAGGGGTAGAAGGGAGGAAGG + Intergenic
1174010697 20:47447281-47447303 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174423198 20:50414079-50414101 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1174763749 20:53231987-53232009 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1175010969 20:55735628-55735650 CTCAGGAGAAAGAGGAAGGATGG - Intergenic
1175238077 20:57526578-57526600 GAAAGGATAAGGAGGGAGGAGGG + Intergenic
1175415745 20:58799764-58799786 GGGAGGCCAAGGAGGGAGGATGG + Intergenic
1175572360 20:60033667-60033689 CTCAGGCTGAGCAGAGAGTACGG + Intronic
1175843587 20:62047280-62047302 CTCGGGGTAAGGAGGGAGCCTGG - Intronic
1175870378 20:62206522-62206544 CTCGGGCTGAGGAGGGCGGGAGG + Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176083795 20:63286749-63286771 CCCAGGCTAGGGTGGGAGGGAGG + Intronic
1176158611 20:63636921-63636943 CTCATGCTTAGGAGGGAGTTGGG - Intergenic
1176376834 21:6090923-6090945 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1177159850 21:17535901-17535923 GAGAGGCTAAGGTGGGAGGATGG + Intronic
1178349905 21:31865322-31865344 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1178680326 21:34668914-34668936 CCCAAACAAAGGAGGGAGGAGGG + Intergenic
1178826860 21:36024525-36024547 CTCAGGAGACGGAGGCAGGATGG + Intergenic
1178899756 21:36589478-36589500 GCCAGGCTGGGGAGGGAGGAGGG - Intergenic
1179106035 21:38401665-38401687 CTCGGGCTAGGGAGGGAGACGGG - Intronic
1179141925 21:38733339-38733361 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1179174253 21:38995918-38995940 GACATGCCAAGGAGGGAGGAGGG + Intergenic
1179298129 21:40081499-40081521 CAAAGGCTCAGGAAGGAGGAGGG - Intronic
1179746641 21:43447321-43447343 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1181160847 22:20958619-20958641 CACAGGCTGAGGTGGGAGGATGG + Intergenic
1181290722 22:21790999-21791021 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1181789557 22:25253773-25253795 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1181813546 22:25420550-25420572 TTCAGGCTCAGGAAGGAGGTTGG + Intergenic
1181824376 22:25502598-25502620 CAGAGGCTCAGGTGGGAGGATGG - Intergenic
1181830091 22:25553617-25553639 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1181831467 22:25564271-25564293 TTCAGGCTCAGGAGCGAGGTTGG + Intergenic
1181914339 22:26267527-26267549 CTCTGGGTAAAGAGGGAGTAGGG + Intronic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182033023 22:27174957-27174979 CTCACGCTAAGGAGTGAGTGAGG + Intergenic
1182250489 22:28996176-28996198 GGGAGGCTAAGGAAGGAGGATGG - Intronic
1182371111 22:29811677-29811699 CTCAGGGTGAGGAGGAAGAAAGG - Intronic
1182411351 22:30189636-30189658 CTCAGGGCAAGGAGGGAGCAAGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182643486 22:31788376-31788398 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1182960542 22:34470314-34470336 GTAAGGCTAAGGCAGGAGGAGGG + Intergenic
1183017550 22:35001647-35001669 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1183029791 22:35094869-35094891 CTAAGGCTGGGGAGGCAGGAGGG + Intergenic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183953767 22:41367411-41367433 CGCAGGCTAGGGAGGCAGGCGGG - Intronic
1184707424 22:46224225-46224247 AGCAGGCTAGGCAGGGAGGAGGG - Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
949178096 3:1091324-1091346 CTTGGTCTAAGGAGGGAGCACGG + Intergenic
949344892 3:3067662-3067684 CACAGGGCAAGAAGGGAGGAAGG + Intronic
949565210 3:5238042-5238064 TTCAGGCTGGGGAGAGAGGAGGG + Intergenic
949928570 3:9060677-9060699 GGGAGGCTAAGGTGGGAGGATGG - Intronic
949930833 3:9077230-9077252 CTGAAGCAAAGGAGGGAGGAGGG - Intronic
950077975 3:10200655-10200677 GTGAGGCTGAGGCGGGAGGATGG + Intronic
950152040 3:10695229-10695251 AGCAGGCAAAGGAGGGAGGGAGG + Intronic
950213383 3:11140332-11140354 CCACGCCTAAGGAGGGAGGAAGG - Intronic
950285215 3:11739441-11739463 CTCACTGTAAGGAGGCAGGAGGG - Intergenic
950292235 3:11794375-11794397 GGGAGGCTAAGGTGGGAGGATGG - Intronic
950308087 3:11931725-11931747 AAGAGGCTAAGGTGGGAGGATGG + Intergenic
950646524 3:14380518-14380540 AGGAGGCTAAGGCGGGAGGATGG + Intergenic
950665293 3:14491610-14491632 CTCAGCCCGAGGAGGGAGGGGGG + Exonic
952275499 3:31871756-31871778 AGGAGGCTAAGGTGGGAGGATGG + Intronic
952404712 3:32995038-32995060 CTCTGGCTTTGGAGGGAGGTAGG + Intergenic
952909962 3:38175402-38175424 GGGAGGCTAAGGTGGGAGGATGG - Intronic
952944194 3:38466199-38466221 CAGAGGCTAAGGAGGTAGGTAGG + Intronic
953237514 3:41119438-41119460 GGAAGGCTAAGGTGGGAGGATGG + Intergenic
953963451 3:47283776-47283798 CCCAGGCACAGGAGGGAGGCTGG - Intronic
954318813 3:49817002-49817024 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
954374559 3:50187316-50187338 GGGAGGCTAAGGTGGGAGGATGG + Intronic
954675151 3:52311587-52311609 CTCAGGCAAAGGAGGGCTGGAGG - Intergenic
955286230 3:57644408-57644430 ATGAGGCTGAGGTGGGAGGATGG - Intronic
955367584 3:58324976-58324998 CTAAGGCTAATGAGGAAAGAGGG - Intergenic
955400840 3:58590405-58590427 CTCAGGCTAAGGTGGTGGCATGG - Intronic
955508221 3:59653303-59653325 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
956143459 3:66168880-66168902 GGAAGGCCAAGGAGGGAGGATGG + Intronic
956751163 3:72345131-72345153 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
956933088 3:74068321-74068343 TGGAGGCTAAGGTGGGAGGATGG + Intergenic
957319117 3:78606475-78606497 CACAGGTTAAAGAGGGAGAAGGG - Intronic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
957810077 3:85210644-85210666 CCGAGGCTCAGGTGGGAGGATGG - Intronic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
958484533 3:94687183-94687205 ATAAGGCTAGGGAGGGAGGCAGG - Intergenic
959066186 3:101659132-101659154 GGGAGGCTAAGGTGGGAGGATGG + Intronic
959681813 3:109105141-109105163 GGGAGGCCAAGGAGGGAGGATGG + Intronic
959707019 3:109347809-109347831 CGCAGGCTGAGGCGGGAGAATGG - Intergenic
960230165 3:115216663-115216685 TGGAGGCTAAGGTGGGAGGATGG - Intergenic
960586740 3:119327033-119327055 CGGAGGCTGAGGTGGGAGGATGG + Intronic
960598667 3:119432874-119432896 GACAGGATAAGGAGGAAGGAAGG + Intronic
960987557 3:123290650-123290672 CTCAGGCTAAGGGAGGAGGCAGG - Intronic
961491766 3:127261347-127261369 CACAGGGGAAGGAGGCAGGATGG - Intergenic
961584711 3:127912763-127912785 GACAGGCTGAGGTGGGAGGATGG + Intergenic
961621821 3:128230392-128230414 GGGAGGCTGAGGAGGGAGGATGG - Intronic
962536741 3:136335618-136335640 GTGAGGCTAAGGTAGGAGGATGG - Intronic
963779594 3:149474018-149474040 CTAAGGCTAAGGGGAAAGGAAGG - Exonic
963880776 3:150525802-150525824 GAGAGGCTAAGGTGGGAGGATGG + Intergenic
964262780 3:154858514-154858536 CTCAGGATAGGGAGTGGGGATGG - Intergenic
964324582 3:155532719-155532741 CTCAGGCTTAGCAGGAAGCATGG - Intronic
965378878 3:167962719-167962741 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966276922 3:178184187-178184209 TTCAGGATTAGGAGGGAAGAGGG - Intergenic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
966323101 3:178722786-178722808 AGCAGGCTGAGGTGGGAGGATGG + Intronic
966568301 3:181408627-181408649 CACAAGCTAAGGAGGAAGCATGG - Intergenic
967134589 3:186502669-186502691 CTCAGCCTAAGGAAGGTGGGAGG + Intergenic
967193824 3:187009525-187009547 GGGAGGCTGAGGAGGGAGGATGG + Intronic
967202344 3:187083264-187083286 GTAATGCCAAGGAGGGAGGATGG + Intergenic
967300680 3:188009187-188009209 CCCAGGAGAAGGAGGGAGAAGGG + Intergenic
967307905 3:188076760-188076782 CGGAGGCTAAGGTGGGAGAATGG - Intergenic
967481446 3:189977847-189977869 GGGAGGCTGAGGAGGGAGGATGG - Intronic
967863864 3:194174452-194174474 GGGAGGCCAAGGAGGGAGGATGG + Intergenic
968161694 3:196432191-196432213 CTCTTCCTCAGGAGGGAGGACGG + Intronic
968492296 4:896401-896423 CTCAGGTTAAGTAGGGCGCACGG + Intronic
968539888 4:1161634-1161656 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
968720050 4:2195720-2195742 CTCAGGCTGAGGTGGGAGGATGG - Intronic
969278324 4:6152051-6152073 AGCAGGCGAAGGAGGAAGGAAGG + Intronic
969371906 4:6736983-6737005 GGGAGGCCAAGGAGGGAGGATGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970619084 4:17798489-17798511 ATGAGGCTGAGGTGGGAGGATGG + Intergenic
970969127 4:21961066-21961088 GACAGGATAAGGAGGAAGGAAGG + Intergenic
971081079 4:23212077-23212099 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
971142619 4:23941154-23941176 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
971377284 4:26065385-26065407 GGGAGGCTAAGGTGGGAGGAAGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971767007 4:30845702-30845724 GGGAGGCTAAGGAGTGAGGATGG - Intronic
972400253 4:38695152-38695174 CTCTAGCAAAGGAGGGAGAAAGG + Intronic
972454716 4:39242359-39242381 GGGAGGCTAAGGCGGGAGGATGG - Intronic
972531402 4:39964462-39964484 CGGAGGCTGAGGTGGGAGGATGG + Intronic
972628036 4:40819914-40819936 AGGAGGCTAAGGTGGGAGGATGG - Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973252672 4:48076731-48076753 AAGAGGCTAAGGTGGGAGGATGG - Intronic
973620171 4:52718245-52718267 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
973937511 4:55863003-55863025 GGGAGGCTAAGGTGGGAGGATGG - Intronic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975065181 4:70052870-70052892 GGGAGGCTAAGGTGGGAGGATGG + Intronic
975141577 4:70923840-70923862 CTCAGGCTGAGGCAGGAGAATGG + Intronic
975145418 4:70962117-70962139 CAGAGGCTGAGGTGGGAGGATGG + Intronic
975608931 4:76184675-76184697 GGGAGGCTAAGGTGGGAGGATGG + Intronic
976591076 4:86850479-86850501 GTCAGGCTGAGGAGGAAGGGAGG + Intergenic
977308438 4:95354582-95354604 ATAAGGCTGAGGTGGGAGGATGG - Intronic
978082897 4:104616368-104616390 CTCTGCTTAAGGAGAGAGGAGGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978507163 4:109471245-109471267 GTGAGGCTGAGGTGGGAGGATGG - Intronic
980694453 4:136337340-136337362 TTCAGGCTTGTGAGGGAGGACGG + Intergenic
981503316 4:145475344-145475366 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
981622089 4:146712810-146712832 TTCAGGGTAAAGAGAGAGGATGG + Intronic
982087516 4:151851243-151851265 CACAGGCTAAGGGGGGAGATGGG - Intergenic
982232228 4:153219761-153219783 GGCAGGCTGAGGTGGGAGGATGG + Intronic
982352689 4:154433223-154433245 CACAAGCCAAGGAGGGAGGAAGG + Intronic
982718801 4:158838323-158838345 GTGAGGCTGAGGTGGGAGGATGG - Intronic
983542833 4:168931246-168931268 CTCAGGCTTAGGAGATAGGCTGG - Intronic
984322043 4:178208413-178208435 CACAGGCTAAGGTGAGAAGAAGG - Intergenic
984466508 4:180106458-180106480 GGGAGGCCAAGGAGGGAGGATGG - Intergenic
987101937 5:14598604-14598626 GTTAGGCTGAGGCGGGAGGATGG + Intronic
987334772 5:16889066-16889088 AGCAGGCTGAGGTGGGAGGATGG + Intronic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
987363915 5:17131245-17131267 CTCAGACTCTGGAGGCAGGAAGG + Intronic
987425447 5:17767666-17767688 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
987776747 5:22376619-22376641 ATAAGGCTGAGGTGGGAGGACGG - Intronic
987901355 5:24015855-24015877 ATGAGGCTGAGGTGGGAGGATGG + Intronic
990965033 5:61436995-61437017 CTCAGTTTGAGGAGGTAGGAAGG - Intronic
991261256 5:64670824-64670846 CTCAGGTGAAGCAGGGAGCATGG - Intergenic
991437239 5:66609492-66609514 GTGAGGCTAAGGTGGGAGGATGG - Intronic
991509511 5:67361230-67361252 CTCAAGAGAAGGAGTGAGGATGG - Intergenic
991971247 5:72143789-72143811 GGGAGGCTAAGGAGGGAGGATGG - Intronic
992325091 5:75652544-75652566 CTGAGACTGAGGTGGGAGGATGG - Intronic
992434095 5:76738741-76738763 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
992465886 5:77003981-77004003 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
993472138 5:88319054-88319076 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
993483370 5:88451784-88451806 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
994150780 5:96445325-96445347 CGCAGGCTGAGGTGGGAGGATGG + Intergenic
994296002 5:98089332-98089354 CTCAGCCTCTGGAGGGAGGAGGG - Intergenic
994591199 5:101774877-101774899 GTCAGGTTAAGGAAAGAGGATGG - Intergenic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
994700581 5:103128509-103128531 GGGAGGCTAAGGTGGGAGGATGG - Intronic
995501534 5:112812371-112812393 CTCAGGCTAAGGAGGATAGTTGG - Intronic
995712015 5:115045387-115045409 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
995830075 5:116345241-116345263 CTCAGGGGTAGGAGGGAGGGGGG + Intronic
995847270 5:116507811-116507833 TTCAGGCTAAGGAGAGTGAAAGG - Intronic
996151445 5:120040834-120040856 AGCAGGCTGAGGTGGGAGGATGG + Intergenic
996579506 5:125015548-125015570 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
997192799 5:131954741-131954763 CTCAGGCATAGGAGGGGAGAGGG + Intronic
997263805 5:132483383-132483405 CTCAGCCAAAGCAGGGAGCAGGG + Exonic
997374073 5:133384476-133384498 GACTGGCTAAGGATGGAGGAAGG + Intronic
997598411 5:135122604-135122626 ATGAGGCTAAGCAGAGAGGAAGG - Intronic
997610549 5:135212866-135212888 CTCAGGCTGAGGCTGGGGGATGG - Intronic
997872482 5:137517499-137517521 CTCAGGAGAAGCAGGGATGATGG + Intronic
997972470 5:138414850-138414872 TGCAGGCTAGGGTGGGAGGATGG + Intronic
998084245 5:139303624-139303646 CTTGGGCTGAGGTGGGAGGATGG + Intronic
998122909 5:139593853-139593875 GGGAGGCTAAGGTGGGAGGATGG - Intronic
998305278 5:141069939-141069961 TGGAGGCTAAGGTGGGAGGATGG + Intergenic
998316303 5:141185640-141185662 GGGAGGCTGAGGAGGGAGGATGG - Exonic
998826721 5:146109033-146109055 GGAAGGCTGAGGAGGGAGGATGG + Intergenic
999213010 5:149906584-149906606 ATGAGGCTCAAGAGGGAGGAAGG - Intronic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
999486743 5:152004463-152004485 CTCAGGCTGAGGCTGGAAGAAGG + Intergenic
999801479 5:155041869-155041891 GGGAGGCTAAGGTGGGAGGACGG + Intergenic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000136113 5:158352656-158352678 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000147189 5:158464995-158465017 CTCAGTCAAATGAGGCAGGAAGG - Intergenic
1000264301 5:159619924-159619946 CTCCTGCTAAGAAGGGAGGATGG + Intergenic
1001110268 5:168890033-168890055 CTGAGGCTAAGGCAGGAGAATGG + Intronic
1001734043 5:173984227-173984249 TTGAGACTAAGAAGGGAGGATGG + Intronic
1001886273 5:175293388-175293410 CTCAGGCTCCAGTGGGAGGAGGG - Intergenic
1001962841 5:175890640-175890662 CACAGGTGCAGGAGGGAGGAGGG - Intergenic
1002208296 5:177579440-177579462 CAGAGTCTAAGGTGGGAGGATGG + Intergenic
1002700746 5:181122753-181122775 GGGAGGCTAAGGAGGGAGGACGG - Intergenic
1002932982 6:1647015-1647037 CCCTGGCTAGGGAGGAAGGATGG + Intronic
1003427920 6:6009403-6009425 CTCAGGCCTATGAGGGAGGTTGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003907369 6:10714408-10714430 CGGAGGCCAAGGTGGGAGGATGG - Intergenic
1003911919 6:10750863-10750885 TTCTGTCTAAGGAGGGAAGATGG + Intronic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004215519 6:13700466-13700488 CTCAGGCTAAGAAGGAAAGGTGG - Intronic
1004225542 6:13781225-13781247 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1004377892 6:15106483-15106505 TTCAGGAGGAGGAGGGAGGATGG + Intergenic
1004404938 6:15324072-15324094 CTCAGGCTGAGGCAGGAGAATGG + Intronic
1004704955 6:18116209-18116231 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1004972622 6:20928770-20928792 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1005198443 6:23315710-23315732 ACCAGGCTGAGAAGGGAGGAGGG + Intergenic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006294524 6:33164211-33164233 CTCAGACTCAGGCTGGAGGAAGG - Intronic
1006355344 6:33553247-33553269 CTCAGGTTGAGGTGGGGGGAAGG - Intergenic
1006563601 6:34935189-34935211 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1006796386 6:36734984-36735006 CTCAGGCTGTGGAGTGAGAAGGG + Intergenic
1006960226 6:37921957-37921979 TGGAGGCTAAGGTGGGAGGATGG + Intronic
1007450838 6:41939702-41939724 CTTGGGCTAAGGGGGGAAGAGGG + Intronic
1007455142 6:41971368-41971390 CAGAGGCTGAGGCGGGAGGATGG - Intronic
1007551953 6:42736567-42736589 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007988950 6:46234908-46234930 CCCATTCTCAGGAGGGAGGAGGG + Intronic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1008384037 6:50867368-50867390 GGCAGGCTAAGGTGGGAGGATGG - Intergenic
1008668910 6:53746518-53746540 CACAGACTCAGGAGGGATGATGG + Intergenic
1008894576 6:56538085-56538107 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1008897231 6:56570229-56570251 CACAGGCCAGGGAGGGGGGATGG + Intronic
1009346589 6:62619429-62619451 GTCAGGCTAGTGAGAGAGGAAGG + Intergenic
1009834050 6:68974526-68974548 AAGAGACTAAGGAGGGAGGATGG + Intronic
1010247680 6:73676922-73676944 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1010438619 6:75865466-75865488 GAGAGGCTAAGGTGGGAGGATGG - Intronic
1011001015 6:82588711-82588733 CAGAGGCTAAGGTGGGAGGATGG + Intergenic
1011653001 6:89524297-89524319 CTCAGGGGAAGGTGGGAGGGGGG - Intronic
1011681910 6:89791730-89791752 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1011868473 6:91861837-91861859 CAGAGGCTAAGGGGGGAGGACGG + Intergenic
1012061719 6:94493324-94493346 CTCAGGCTGAGGGAGGAGAATGG - Intergenic
1013493842 6:110677952-110677974 CTGAAGCTAAGGCAGGAGGATGG - Intronic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1014388053 6:120825561-120825583 GTGAGGCCAAGGCGGGAGGATGG - Intergenic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015561496 6:134520951-134520973 CACAGGCTTGGGAGGGAGCACGG - Intergenic
1015742992 6:136478341-136478363 CGGAGGCCAAGGTGGGAGGATGG + Intronic
1015795619 6:137008202-137008224 GGGAGGCCAAGGAGGGAGGATGG - Intronic
1016013072 6:139158564-139158586 CCCATGCTGAGGTGGGAGGATGG + Intronic
1016390161 6:143566396-143566418 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1016827424 6:148401147-148401169 CGGAGGTTAAGGTGGGAGGATGG + Intronic
1016982453 6:149864894-149864916 CTGAGGCTGAGTTGGGAGGATGG + Intergenic
1017345540 6:153375785-153375807 CAAAGGCTGAGGTGGGAGGATGG + Intergenic
1018235497 6:161719729-161719751 AGCAGGCTAAGGCAGGAGGATGG - Intronic
1018259048 6:161951385-161951407 CTCTGGCTAAAGAGAGAAGAAGG - Intronic
1018659407 6:166072216-166072238 CTAAGCCAAAGGAGGGAGGTAGG - Intergenic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1018854117 6:167663225-167663247 CTCAGGCAAAGGACAGAGGCTGG - Intergenic
1018969271 6:168514860-168514882 CTTAGACAAAGGAGGGAGGATGG + Intronic
1019078848 6:169413596-169413618 CAGAGGCCAAGGTGGGAGGATGG + Intergenic
1019114224 6:169744632-169744654 CTCAGGGTAGGGAGGAAGAAAGG - Intronic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019323849 7:428193-428215 GGGAGGCTAAGGTGGGAGGACGG + Intergenic
1019358436 7:592929-592951 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1019365948 7:632884-632906 CCCAGGCTCAGGAGGGCTGACGG - Intronic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019764938 7:2843540-2843562 GGGAGGCTAAGGAGGGAGTAGGG + Intronic
1020065742 7:5187279-5187301 CAGAGGCTAAGGCGGGAGGATGG - Intergenic
1020088082 7:5322401-5322423 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1020138000 7:5597127-5597149 CTTCGGCCAAGGAGGGAAGATGG + Intronic
1021635115 7:22684296-22684318 GGCAGGCTGAGGTGGGAGGATGG - Intergenic
1021730260 7:23588655-23588677 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1022226369 7:28367901-28367923 CTTAGTCTAGGGAGGGAGCAGGG - Intronic
1022289824 7:28990134-28990156 CTCATGCTGAGGAGGGAGGGTGG - Intergenic
1022309838 7:29186465-29186487 GGGAGGCTGAGGAGGGAGGATGG + Exonic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1022481168 7:30744086-30744108 GCCACGGTAAGGAGGGAGGATGG - Intronic
1023078873 7:36509073-36509095 AGGAGGCTAAGGCGGGAGGATGG - Intergenic
1023485307 7:40680131-40680153 CTCAGGCAGAATAGGGAGGAAGG + Intronic
1023822901 7:43989973-43989995 CTCAGGGAAAGGAAGGAGGCAGG + Intergenic
1023974852 7:45021150-45021172 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1024326528 7:48113640-48113662 GGCACTCTAAGGAGGGAGGAGGG + Intergenic
1024425432 7:49220090-49220112 CTGAGGCTAGGGAGGAAGAAGGG + Intergenic
1024586894 7:50849845-50849867 CTCAGGATGAGGAAGAAGGAGGG - Intergenic
1024991313 7:55236511-55236533 CTTAGGCTAAAGCAGGAGGAAGG - Intronic
1025056599 7:55770405-55770427 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1025206222 7:56994725-56994747 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
1025247782 7:57330283-57330305 AGCAGGCTAAGGTGGGAGGATGG + Intergenic
1025900704 7:65742190-65742212 GGGAGGCTAAGGTGGGAGGACGG + Intergenic
1025966195 7:66274258-66274280 CTCAGGCTGAGGCAGGAGAATGG + Intronic
1026008942 7:66621701-66621723 GTCAGGATAAGGAAGGAGGCTGG + Intergenic
1026309040 7:69167816-69167838 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1026612498 7:71872851-71872873 GGAAGGCTAAGGCGGGAGGATGG - Intronic
1026675310 7:72423710-72423732 GGGAGGCTAAGGAGGAAGGATGG + Intronic
1026824399 7:73572342-73572364 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1026923473 7:74173311-74173333 CAGAGGCTAAGGCGGCAGGATGG + Intergenic
1026980272 7:74522458-74522480 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1027001124 7:74655112-74655134 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1027181261 7:75941062-75941084 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1027540338 7:79456639-79456661 TTCAGGCTTAGTAGGGTGGAGGG + Intergenic
1027649349 7:80846191-80846213 ATCAGGCTGAGGAGGTAGCAAGG - Intronic
1028101961 7:86831616-86831638 CTCAGACTAAGAAGGAAGAATGG - Intronic
1028384570 7:90240166-90240188 GTGAGGCTAAGGTGGGAGGTGGG + Intergenic
1028420424 7:90626698-90626720 CAGAGGCTAAGGTGGGAGGATGG + Intronic
1028600903 7:92599467-92599489 CTGAGACTGAGGTGGGAGGATGG - Intergenic
1028846326 7:95484225-95484247 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1029040782 7:97571435-97571457 GGAAGGCTAAGGCGGGAGGAAGG - Intergenic
1029171093 7:98629307-98629329 ATCAGTCTAAGGAAGGATGATGG - Exonic
1029248788 7:99221555-99221577 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029492325 7:100878205-100878227 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1029522615 7:101073236-101073258 GGGAGGCTAAGGAAGGAGGATGG + Intergenic
1029547564 7:101218376-101218398 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1029561573 7:101306456-101306478 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1029708790 7:102288559-102288581 TTCACGCTAAGTAGGGAAGAGGG - Intronic
1029751166 7:102543403-102543425 CTCAGGGAAAGGAAGGAGGCAGG + Intronic
1029769118 7:102642508-102642530 CTCAGGGAAAGGAAGGAGGCAGG + Intronic
1030845661 7:114406813-114406835 CTTAGGCTAGGGAGAGAGGGAGG - Intronic
1032177432 7:129642863-129642885 GGGAGGCTAAGGTGGGAGGATGG - Intronic
1032447733 7:131999136-131999158 CCGAGGCTATGGAGGAAGGAGGG - Intergenic
1032798476 7:135298371-135298393 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033586816 7:142780388-142780410 CTCAGGAGATGCAGGGAGGAAGG - Intergenic
1033949013 7:146760527-146760549 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1034118919 7:148609611-148609633 TTCTCTCTAAGGAGGGAGGAAGG + Intronic
1034168447 7:149043649-149043671 CTCAGGCTGAGGCAGGAGAATGG + Intergenic
1034295891 7:149972161-149972183 CTCAGGGAAGGGCGGGAGGATGG - Intergenic
1034496425 7:151425872-151425894 GGCAGGCAAGGGAGGGAGGAGGG + Intergenic
1034531007 7:151696519-151696541 CTCAGTCAAAGGAGAGATGATGG - Intronic
1034810162 7:154124741-154124763 CTCAGGGAAGGGCGGGAGGATGG + Intronic
1035714069 8:1740397-1740419 ATCAGACTCTGGAGGGAGGAGGG - Intergenic
1035987540 8:4451224-4451246 GGGAGGCTAAGGAGGGAAGATGG + Intronic
1036157712 8:6358044-6358066 CAGAGGCTAAGGCGGGAGAATGG - Intergenic
1036466701 8:9004253-9004275 CTCAGGCTGAAGAGGGAGGCAGG - Intronic
1036815777 8:11902047-11902069 CCGAGGCTCAGGTGGGAGGATGG - Intergenic
1037249012 8:16871112-16871134 ATGAGGCTAGGGAGAGAGGAAGG + Intergenic
1037743118 8:21622873-21622895 CTCAGGCTAGGGCAGCAGGAGGG - Intergenic
1037776502 8:21839037-21839059 CCCAGAGCAAGGAGGGAGGATGG + Intergenic
1038098020 8:24337417-24337439 GTCGGACAAAGGAGGGAGGAGGG - Intronic
1038174407 8:25167033-25167055 CTGAGGCTGAGGTGGAAGGATGG - Intergenic
1038253869 8:25932192-25932214 CTAAGGCTTAGAATGGAGGAAGG - Intronic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1039855474 8:41408590-41408612 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1040483865 8:47852009-47852031 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1040531154 8:48267409-48267431 CTCTGCCTAGGGAGGAAGGAAGG + Intergenic
1040626285 8:49152993-49153015 CTCCGGCAAAGGCGGGAGGTGGG - Intergenic
1040690958 8:49937865-49937887 CTCAGAAGGAGGAGGGAGGAAGG - Intronic
1041025930 8:53686994-53687016 CACAGGTTAAGGAAGGAGAATGG + Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042102717 8:65291197-65291219 GTCAGGCAAAGGAAGGAAGAGGG - Intergenic
1042403278 8:68374018-68374040 AACAGGCTAAGGCAGGAGGATGG - Intronic
1042440133 8:68816203-68816225 CCCTTGCTAAGGTGGGAGGATGG + Intronic
1042453108 8:68972643-68972665 TTCAGGCTGAAGAGGGAGGGAGG - Intergenic
1042604404 8:70531169-70531191 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1043264108 8:78240948-78240970 CTCAGGCTGAGGCAGGAGGATGG - Intergenic
1043539146 8:81239762-81239784 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1043667436 8:82833709-82833731 GGGAGGCTAAGGAGGGAGGATGG + Intergenic
1043888500 8:85630389-85630411 CAGAGGCTCAGGTGGGAGGACGG + Intergenic
1043978444 8:86609640-86609662 ATCAGTCTAATGAGAGAGGATGG - Intronic
1044229928 8:89762081-89762103 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1044648992 8:94474900-94474922 AGCAGGCCAACGAGGGAGGAGGG - Intronic
1044659582 8:94582117-94582139 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1044667711 8:94647900-94647922 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1044874645 8:96653034-96653056 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1045048114 8:98298333-98298355 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1045274616 8:100691832-100691854 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1045498999 8:102730790-102730812 AAGAGGCTAAGGTGGGAGGATGG - Intergenic
1045844301 8:106615501-106615523 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1046997789 8:120543591-120543613 CTCAGGACAAGGAGGGATGTGGG + Intronic
1047047466 8:121070900-121070922 GAGAGGCTAAGGTGGGAGGATGG - Intergenic
1047941209 8:129829210-129829232 CTCAGGGGAAGGAGGGAGCAGGG - Intergenic
1048200132 8:132365924-132365946 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1048507896 8:135037002-135037024 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
1048571274 8:135659164-135659186 TTCAGGCTAAAGAGGTAGGTAGG - Intergenic
1048831519 8:138482113-138482135 CCCAGACTATAGAGGGAGGATGG + Intronic
1049142098 8:140964138-140964160 ATCAGTCTTAGGTGGGAGGAGGG - Intronic
1049592037 8:143466961-143466983 CTAAGGCCAAGGAGGGAAGAAGG + Intronic
1049617189 8:143580804-143580826 TCCAGTCAAAGGAGGGAGGAGGG - Intronic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1049977187 9:871139-871161 CTCAGGCTGAGGTAGGATGATGG - Intronic
1050043261 9:1517565-1517587 CTCAACTTAATGAGGGAGGAAGG - Intergenic
1050137193 9:2478714-2478736 GGTAGGCTAAGGAGGGTGGATGG + Intergenic
1052544892 9:29863968-29863990 CCCAGGCTAAGATGGGAGGATGG + Intergenic
1053084993 9:35211854-35211876 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053751956 9:41266199-41266221 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1054257479 9:62830529-62830551 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1054333836 9:63785193-63785215 CTCAGGCGCAGGAGGGATGACGG - Intergenic
1054909088 9:70437689-70437711 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1055398793 9:75901036-75901058 CTCAGACTAAAGAGGAAGGAAGG + Intronic
1055854535 9:80669988-80670010 CCCAGGCCAAAGAGGGAGAAGGG - Intergenic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056136203 9:83631505-83631527 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1056200246 9:84268648-84268670 AGGAGGCTAAGGTGGGAGGATGG - Intergenic
1056599292 9:88033771-88033793 AGGAGGCTAAGGTGGGAGGATGG + Intergenic
1056803740 9:89712444-89712466 CTCTGGCCGCGGAGGGAGGAGGG - Intergenic
1057216174 9:93230119-93230141 CTCAGGCTCAGGACGCAGGCTGG + Intronic
1057243043 9:93429356-93429378 GAGAGGCTAAGGTGGGAGGATGG + Intergenic
1057466275 9:95317324-95317346 CTAAGGCTGAGGCGGGAGGCGGG - Intronic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1058374998 9:104312579-104312601 CCCAGGCTCAGAAGGGAGGGAGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058428337 9:104895785-104895807 CTCAGGCTAGGGAGGGAAATGGG - Intronic
1058643311 9:107107854-107107876 CAAAAGCAAAGGAGGGAGGAAGG + Intergenic
1058793198 9:108471536-108471558 CTGAGGCTAAGGCAGGAGGATGG + Intergenic
1058989892 9:110245512-110245534 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1060140641 9:121206852-121206874 CCCAGGCTGAGGTGGGAGGGTGG - Intronic
1060198154 9:121636427-121636449 TTCAGGAGCAGGAGGGAGGAGGG + Intronic
1060268227 9:122124615-122124637 CACCAGCTAAGGAGGCAGGAGGG - Intergenic
1060693528 9:125686205-125686227 CCCAGGCTGAGGCGGGAGAACGG + Intronic
1060813148 9:126621221-126621243 CTCAGCCAGGGGAGGGAGGAAGG + Intronic
1060929008 9:127476441-127476463 GGGAGGCTAAGGTGGGAGGATGG + Intronic
1061292411 9:129658694-129658716 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1061298133 9:129688164-129688186 GGCAGGCTGAGGTGGGAGGATGG - Intronic
1061617265 9:131788486-131788508 CTCAGCCTCAGGAGGGAGGCTGG + Intergenic
1061814247 9:133184365-133184387 CTCAGGCAAAAGAGGGAAGTTGG + Intergenic
1062259309 9:135652094-135652116 CTCAGGCCAAGATGGGAAGAGGG - Intergenic
1062701165 9:137904469-137904491 AGGAGGCTAAGGTGGGAGGATGG - Intronic
1062707533 9:137953685-137953707 GCCAGGCTAAGGAAGGAGGAGGG + Intronic
1062720457 9:138040041-138040063 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1185469445 X:373821-373843 CTCAGGCTGAGGAGGGCGCATGG + Intronic
1185818417 X:3178962-3178984 GGGAGGCTAAGGAGGGAGAATGG + Intergenic
1185854225 X:3519396-3519418 CGGAGGCTGAGGCGGGAGGATGG - Intergenic
1186567643 X:10680919-10680941 AGCAGGCTGAGGTGGGAGGATGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187626070 X:21115253-21115275 GGGAGGCCAAGGAGGGAGGAAGG + Intergenic
1187718022 X:22123092-22123114 CGCAGGCTAAAGTGGGAAGATGG - Intronic
1189075882 X:37913692-37913714 ATCAGGCCAAGGATGGAGGAGGG - Intronic
1189247117 X:39571810-39571832 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190312194 X:49124446-49124468 CGCAGGCTGAGGCAGGAGGATGG + Intergenic
1190575032 X:51827156-51827178 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1190780555 X:53590595-53590617 CTCAAGCTAAAGAGAGAGGAAGG + Intronic
1192168083 X:68838467-68838489 CCCAGCCTGAGGATGGAGGAAGG + Intronic
1192310843 X:70012958-70012980 CTCAGGCTCAGGAGAGAGCAAGG + Intronic
1192422934 X:71050105-71050127 CTCAGGCTGAGGCAGGAGAATGG - Intergenic
1192432198 X:71119899-71119921 TTCAGGCCAAGGAGGGAGCATGG + Intronic
1192806104 X:74510810-74510832 GGGAGGCTAAGGAGGGAGGACGG + Intronic
1193143159 X:78050853-78050875 CTCAGGGTGAGGAGATAGGATGG + Intergenic
1193773736 X:85619306-85619328 CTCAGGCTTAGGAGGAAGTGAGG + Intergenic
1193824452 X:86205663-86205685 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1194618078 X:96132377-96132399 GGGAGGCTAAGGTGGGAGGATGG + Intergenic
1194655589 X:96569656-96569678 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1194655872 X:96572547-96572569 TTCAAGCTAAGGAGAGAGGCTGG - Intergenic
1194673483 X:96765300-96765322 TGGAGGCTAAGGTGGGAGGATGG - Intronic
1195097009 X:101512264-101512286 CTCAGGCTGAGGCAGGAGAATGG + Intronic
1195254788 X:103080978-103081000 CGCAGGCTCAGGAGGCAGAAGGG + Intronic
1196248411 X:113428659-113428681 CTATGGCCAAGGTGGGAGGATGG - Intergenic
1197073199 X:122325006-122325028 GGGAGGCTAAGGTGGGAGGATGG - Intergenic
1197338984 X:125243184-125243206 CAGAGGCTAAGGCGGGAGAATGG + Intergenic
1197377430 X:125698673-125698695 CTCAGGCAAAGGAGGAACAAAGG + Intergenic
1197647411 X:129033035-129033057 CTTGGGCTAAGATGGGAGGAAGG - Intergenic
1197739973 X:129883347-129883369 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1197872912 X:131076441-131076463 CTCAGGCTCAGGATGGTGAAAGG - Intronic
1197894636 X:131298781-131298803 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1198089887 X:133318142-133318164 CTCAAGCTATGGAGTGGGGAAGG - Intronic
1199112294 X:143949164-143949186 CTCAGGCACTGGAGAGAGGAAGG + Intergenic
1199207148 X:145161996-145162018 GTGAGGCTGAGGTGGGAGGATGG + Intergenic
1199508110 X:148589102-148589124 TTCAGCATAAGGAGGGAGGGGGG + Intronic
1199560030 X:149152048-149152070 CTCAGTCTATGGAGGGAGGGAGG - Intergenic
1200149886 X:153946215-153946237 CTCAGTCTGGGGAGGCAGGAGGG - Intergenic
1200254851 X:154575087-154575109 GGCAGGCCAAGGTGGGAGGATGG - Intergenic
1200262918 X:154629321-154629343 GGCAGGCCAAGGTGGGAGGATGG + Intergenic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1201567748 Y:15384456-15384478 CTCAGGAGGAGGAAGGAGGATGG - Intergenic
1202134316 Y:21646138-21646160 TGGAGGCTAAGGAGGGAGAATGG - Intergenic
1202578762 Y:26356293-26356315 GGGAGGCTAAGGTGGGAGGATGG + Intergenic