ID: 1118840265

View in Genome Browser
Species Human (GRCh38)
Location 14:69504617-69504639
Sequence TAGAAGAAGAAAAATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1476
Summary {0: 1, 1: 0, 2: 12, 3: 136, 4: 1327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118840265_1118840269 20 Left 1118840265 14:69504617-69504639 CCACCCTCATTTTTCTTCTTCTA 0: 1
1: 0
2: 12
3: 136
4: 1327
Right 1118840269 14:69504660-69504682 GCTCATTTTATCCTTCCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118840265 Original CRISPR TAGAAGAAGAAAAATGAGGG TGG (reversed) Intronic
900010052 1:98332-98354 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
900026164 1:274916-274938 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
900035946 1:408769-408791 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
900057569 1:644520-644542 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
901216395 1:7557869-7557891 TGGAGGAAGAAAAGTGAGGGAGG + Intronic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
901813293 1:11779715-11779737 GAGAGGAAGAGAAAGGAGGGTGG + Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
901866601 1:12110587-12110609 AAGAAAAAGAAAAATGACTGAGG - Intronic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902031050 1:13422519-13422541 TAAAAGATGAAAAATGCGGCTGG - Intergenic
902296470 1:15470533-15470555 TTGGAGATGTAAAATGAGGGGGG - Intronic
902299266 1:15489825-15489847 TTGGAGATGTAAAATGAGGGGGG - Intronic
902503000 1:16922831-16922853 GAGAAGAGGTAAAATGTGGGTGG - Intronic
902533697 1:17106760-17106782 TAGGAGAAGAAAGATGAGAGAGG + Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903202841 1:21756538-21756560 TCCAAGAAGAAAAAGGTGGGTGG - Exonic
903352488 1:22726188-22726210 GAGAAGGAGAAAAAGGAGGAAGG - Intronic
903458032 1:23502092-23502114 AAGAAGAAGAAAGAAGAAGGAGG - Intergenic
903467447 1:23561753-23561775 TAGAGGAAGGAAAAGAAGGGAGG - Intergenic
903604052 1:24561918-24561940 AAAAAAAAGAAAAAGGAGGGAGG + Intronic
903761082 1:25699326-25699348 AAGAAGAAGAAGCATGAGAGAGG + Intronic
903772170 1:25770805-25770827 GAGAAGAAAGAAAATGGGGGTGG - Intronic
903986362 1:27232161-27232183 AAAAAGAAGAAAAAAGTGGGGGG + Intergenic
904025631 1:27501730-27501752 TAGAAGTAGAAAAATATGGCTGG + Intergenic
904104715 1:28069575-28069597 AAGAAGAAAAAAAAAGAGGGTGG + Intronic
905970292 1:42136753-42136775 GAGAAGGAGAAAAAGGAGGAGGG - Intergenic
906235818 1:44208591-44208613 TAGAAAAAGAAAAATTAGCCAGG - Intergenic
906937034 1:50223443-50223465 TAAAGGAAAAAAAATGAAGGAGG + Intergenic
907430623 1:54409191-54409213 TAGAAGAAGGGAACTGAGGCAGG - Intronic
907625804 1:56028188-56028210 TAGAAGAAAATAATTGCGGGTGG + Intergenic
908030396 1:59993079-59993101 TGTAAGAAAAAAAATGAGTGAGG + Intronic
908427159 1:64018279-64018301 GAGAAGCAGGAAACTGAGGGAGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908467161 1:64407914-64407936 AAGAAAAAGAAAAAAGAAGGTGG - Intergenic
908793003 1:67801959-67801981 GTGAGGAAGAAAAAGGAGGGAGG + Intronic
908797370 1:67844101-67844123 TAGAAGGAGGAAAATGAGAGAGG - Intergenic
909158928 1:72119456-72119478 TAGTATTAAAAAAATGAGGGGGG + Intronic
909253658 1:73390568-73390590 TAGAAGAAGAAGGAGGAAGGAGG - Intergenic
909286837 1:73830269-73830291 TAGAGGCAGAAAAAGGAGAGAGG + Intergenic
909295998 1:73949684-73949706 TAAAAGAAGAAAAAAGGTGGAGG + Intergenic
909472424 1:76043377-76043399 TAAAAGAAAAAAAAAGGGGGGGG + Intergenic
909516889 1:76520524-76520546 TAGAAGTAGAAAACTATGGGTGG - Intronic
909591261 1:77351801-77351823 TAGAAGAAGACAAAGGAGAAAGG + Intronic
909641854 1:77877198-77877220 TAGAAGATGAAAAAAGTGGGCGG + Exonic
909705293 1:78575260-78575282 TAAAAGAAGAAAAATGTTGAAGG - Intergenic
909772161 1:79437442-79437464 AAGAAAAAGAAAATTGAGGATGG + Intergenic
910373169 1:86540204-86540226 TAGAATTAGAAAAATGAGTATGG + Intergenic
910404113 1:86867780-86867802 TACAACAGGAAAACTGAGGGTGG + Intronic
910416453 1:87004228-87004250 TACAAGTAGAAAAATTAGGTGGG + Intronic
910433782 1:87184627-87184649 AAGAAGAAGAAAAATTAGCCAGG + Intergenic
910619453 1:89236585-89236607 GAGAACAAGAAAAAGCAGGGTGG - Intergenic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
910873148 1:91853284-91853306 AAGAAGAAGAAAAAAAGGGGAGG + Intronic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911060714 1:93745514-93745536 GAGGAGAAGAAAAATGGTGGGGG - Intronic
911303234 1:96201852-96201874 TTGAAGAAGAGAAATGAAGGTGG + Intergenic
911659160 1:100480875-100480897 TAGAAGGAAAAAACTGAGGAAGG - Intronic
911761334 1:101620842-101620864 CAGAAAAAGAAAAAAGAGAGTGG - Intergenic
911815820 1:102349132-102349154 TACTAGAAGAAAAATGAAGCTGG - Intergenic
911939328 1:104021435-104021457 TAGAGAAATAAAAATAAGGGTGG - Intergenic
911956921 1:104248066-104248088 TGGAGGAAGAAAAATGCAGGGGG - Intergenic
911988092 1:104657342-104657364 GAGGAGAAGAAAAAGTAGGGAGG - Intergenic
912048368 1:105490263-105490285 TAGAAGATGAGATTTGAGGGAGG - Intergenic
912058235 1:105632050-105632072 TGGCAGGAGAAAAATGAGAGTGG - Intergenic
912158635 1:106953347-106953369 GAGAAGAAGCAAAGTGAGAGAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912939599 1:114033241-114033263 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
913059182 1:115189046-115189068 GAGAGGAAGAAAAATGTGGTGGG - Intergenic
913096387 1:115521083-115521105 TAGAATAAGGAAAATGAGTAAGG - Intergenic
913280325 1:117179314-117179336 TAGAAGAAGGGAAATCAGGGCGG + Intronic
913676159 1:121142699-121142721 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
914028052 1:143930643-143930665 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
914351900 1:146847230-146847252 TTGAAGAAGGAAAAGGTGGGAGG - Intergenic
914387827 1:147188941-147188963 GAGAAGAAGGAAAATGAAGTTGG + Intronic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914772268 1:150698710-150698732 TAGAAGAATCAAAGTGATGGAGG + Exonic
914835121 1:151200171-151200193 GAGAAGAAGAAAGATGGGTGGGG + Intronic
915324109 1:155071730-155071752 GGGAAGAAGAAAAAGGGGGGAGG - Intergenic
915432453 1:155877262-155877284 TAGAAATAGAAAAATTAGGCCGG - Intronic
915505909 1:156356206-156356228 TAGAAGATGAAAAATACGGCAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916195714 1:162220291-162220313 TAGCTGAATCAAAATGAGGGAGG - Intronic
916212466 1:162369994-162370016 TAGAAGAATGAAAAAGAGGAAGG - Exonic
916414768 1:164582075-164582097 TAGAAGAAAAAAATTCAGGTAGG + Intronic
916421435 1:164641265-164641287 GAGAAGAAGAGAAATGGGAGTGG + Intronic
916565294 1:165970639-165970661 TTGAAGAAGAAAAATAAGAAAGG - Intergenic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916914931 1:169396255-169396277 TAGAAAAACAAAAAGGAGGCTGG + Intronic
917345326 1:174022750-174022772 TGGAAGAAGAAAAATGGGGTGGG - Intergenic
918065554 1:181098791-181098813 TAAAAGAAAAAAAATGTGGCTGG - Intergenic
918132984 1:181645424-181645446 TATAAGAAGAAAAAAGAGGGTGG - Intronic
918278285 1:182976398-182976420 TAGCACAAGAAAAATGAGAGAGG + Intergenic
918730729 1:187992541-187992563 AGGAAGAGGAAAAATGGGGGAGG + Intergenic
918743704 1:188170765-188170787 AAGAACAAGAAAAATGTGGCAGG - Intergenic
919021727 1:192114665-192114687 GAGAAAAGAAAAAATGAGGGAGG + Intergenic
919041311 1:192391760-192391782 TAAAAGAAAAAAAATGAGTTGGG - Intergenic
919079444 1:192852177-192852199 TTAAGGAAGAGAAATGAGGGTGG + Intergenic
919291519 1:195639509-195639531 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920032331 1:203044910-203044932 GAGAAGAAGAAAAGAGAAGGGGG - Intronic
920406578 1:205718213-205718235 AAAAAAAAGAAAAAAGAGGGAGG - Exonic
920447328 1:206028609-206028631 TAAAAGATGGAAAAGGAGGGAGG - Intergenic
920463526 1:206161537-206161559 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
920749805 1:208663127-208663149 TAGAGGAATAAAAAAGGGGGAGG - Intergenic
920867760 1:209767673-209767695 TTGAAAAAAAAAAAAGAGGGGGG + Intronic
921263492 1:213404000-213404022 TAGGAGAAGGCAGATGAGGGAGG + Intergenic
921301097 1:213752355-213752377 TAAAAGAAAAAAAAAAAGGGTGG + Intergenic
921511656 1:216038490-216038512 TAGAATAAGAAAGTGGAGGGGGG - Intronic
921708302 1:218348149-218348171 AAGAAAAAGAAAAGTGGGGGCGG + Intronic
921768449 1:219003102-219003124 TAGAAGAAGAAAAAAGTGACAGG - Intergenic
921990638 1:221362440-221362462 TAGAAGAGGAACAAAGAAGGAGG - Intergenic
922258484 1:223914337-223914359 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922449006 1:225721596-225721618 GAGAAGAAAAAAACTGAGTGTGG + Intergenic
922450583 1:225734141-225734163 TAAAAGAGGAAAAATCAGAGAGG - Intergenic
922592839 1:226791519-226791541 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
922658769 1:227410509-227410531 GAAAAGAAGAAAAGAGAGGGAGG - Intergenic
922710906 1:227831038-227831060 GAAAATAAGAAAAATGAGAGTGG - Intronic
922974318 1:229771020-229771042 TAGGAGAAAACAATTGAGGGAGG + Intergenic
923059623 1:230458902-230458924 GAGAAGGAGAAAAAGGAGTGAGG - Intergenic
923378667 1:233392606-233392628 AAGAAGAAGAAAGAAGAAGGAGG - Intergenic
923687633 1:236164327-236164349 TACAAGAATGAAAAAGAGGGAGG - Intronic
923700540 1:236296033-236296055 AAGAAGAAGAAAAAATTGGGGGG - Intergenic
923841441 1:237676046-237676068 CCGAAGAACAAAAATGAGGTAGG + Intronic
924061374 1:240178427-240178449 AAGAAGAAGAAGAAGAAGGGGGG - Intronic
924286437 1:242492841-242492863 TATAAGAAGAAACATAAGAGGGG - Intronic
924514137 1:244752302-244752324 TAGAAAAAGAAAAAAGAAAGGGG - Intergenic
924523366 1:244824611-244824633 TATAAGAAGAACACTGAGGCCGG - Intergenic
924680364 1:246224882-246224904 CAGAAGCAGAAAAAGGAAGGTGG + Intronic
924683571 1:246263400-246263422 TTGAAGTAGAAAAGTTAGGGAGG + Intronic
924736472 1:246761369-246761391 AATAAGAAGAAAAAAGAGGCCGG - Intronic
924788981 1:247226415-247226437 AAGAAGAAAAAGAATGAGTGTGG - Intergenic
924802150 1:247335385-247335407 TAGGAGGAGGAAAGTGAGGGAGG + Intergenic
924901346 1:248404439-248404461 TAAAAAAAGTAAAATGAGGGAGG + Intergenic
1062927142 10:1325701-1325723 TAGTACAAGAAAGATGTGGGAGG - Intronic
1063057221 10:2518961-2518983 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063403434 10:5770260-5770282 TAGAAGAGGAAAAGTGAGTGTGG + Intronic
1063579061 10:7288873-7288895 TAGAAATAGAAAAATGAGCCAGG + Intronic
1063677265 10:8152135-8152157 TAGAAGAGTAAAAATATGGGAGG + Intergenic
1063713306 10:8502221-8502243 TTTAAGAAGAAATATCAGGGTGG + Intergenic
1063737928 10:8782323-8782345 AAGGAAAAGAAAAATGAAGGAGG + Intergenic
1063778932 10:9298651-9298673 AAGAAGAAAAAAAATGTGTGAGG - Intergenic
1063997045 10:11629233-11629255 GAAAAGAAGAATAATGAGGCCGG - Intergenic
1064074100 10:12255167-12255189 TAGGAGGAGAAAACAGAGGGAGG - Intergenic
1064686512 10:17867312-17867334 AAGAAGAAGAAGAAGGAAGGAGG - Intronic
1064777054 10:18790288-18790310 ATGAATGAGAAAAATGAGGGAGG - Intergenic
1065050325 10:21785426-21785448 TGGAAGAAGAAAACTGAAGGAGG + Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065487776 10:26251192-26251214 TAGAAAAAGAAAGATGAGGCTGG - Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1065923837 10:30417958-30417980 TAAAAGAAAAAAAATTAGTGGGG + Intergenic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066024684 10:31343126-31343148 TTCAAAAAGAAAAATGGGGGAGG - Intronic
1066162936 10:32754631-32754653 TAAAATAATAAACATGAGGGAGG + Intronic
1066285657 10:33963577-33963599 TAGAAAAAGTTAAATGAAGGAGG - Intergenic
1066532758 10:36358358-36358380 TAGAAAAAAAGAGATGAGGGGGG - Intergenic
1067055467 10:43047358-43047380 TGGAAGAAGAAAAATAGGAGGGG + Intergenic
1067107404 10:43375321-43375343 AAGAAGAAAAAAAGTGAGGCTGG - Intronic
1067254911 10:44627822-44627844 GAGAAAAAAAAAAAAGAGGGTGG + Intergenic
1067355549 10:45522076-45522098 TAAAAACAGAAAAATGTGGGAGG - Intronic
1067715631 10:48688952-48688974 TAGAAGCAGAAATATGAGTTTGG + Intronic
1067823571 10:49551915-49551937 TAGAATAAGAAAAATGCCTGAGG - Intergenic
1067878384 10:50024073-50024095 TGGGAGAAGGAAAAAGAGGGTGG - Intergenic
1067893338 10:50153855-50153877 TGGGAGAAGGAAAAAGAGGGTGG + Intergenic
1068539274 10:58272919-58272941 AAAAAAAAGAAAAATAAGGGGGG + Intronic
1068589072 10:58834924-58834946 AAGAAAAAGAAAAATTAGGCAGG + Intergenic
1068631237 10:59299974-59299996 TGGCAGAAGAAAAATGAGACTGG + Intronic
1069021719 10:63495767-63495789 AAGAAGAAGAAAATTGAGAAAGG + Intergenic
1069138820 10:64798951-64798973 TAGAAAGAGAATAATGAGGGTGG - Intergenic
1069218423 10:65852304-65852326 TAGAAAAAAAGAAATGAGAGAGG + Intergenic
1069362702 10:67661272-67661294 AAGAAAGAGAAAAAGGAGGGAGG + Intronic
1069473065 10:68710314-68710336 AAGAAGAAGAAAGAAGAAGGAGG - Intergenic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1070141499 10:73741432-73741454 TAGAAAAAAAAAAAGGTGGGGGG + Intergenic
1070223506 10:74475755-74475777 TAAAAGAAGAAAAGAGAGAGAGG + Intronic
1070607537 10:77909500-77909522 TATTAAAAAAAAAATGAGGGTGG + Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1070908803 10:80099533-80099555 GAGAAGAAAAGAAAGGAGGGAGG + Intergenic
1071093288 10:81945277-81945299 TAAAAGAAGGAAAAAGAAGGAGG - Intronic
1071358846 10:84824849-84824871 GAGAAGAAGAGAAAGAAGGGAGG - Intergenic
1071702962 10:87962052-87962074 TAGAATAAGAAATAGGAAGGGGG - Intronic
1071724147 10:88179149-88179171 TAGAAGAAAAGAAATCAGGTAGG + Intergenic
1071877816 10:89861501-89861523 CAGAAGAAGAAAGAAGAAGGAGG - Intergenic
1072085631 10:92076758-92076780 TAGAAGAAGGAAGAAGAAGGAGG + Intronic
1072133589 10:92521177-92521199 TAGAAAAACCAAAATTAGGGAGG + Intronic
1072227756 10:93386280-93386302 AAGAAAAGGAAAAAAGAGGGCGG - Intronic
1072490103 10:95896798-95896820 GAAAAGAAGAAGAATAAGGGGGG - Intronic
1072517265 10:96197637-96197659 TATAAGAAGAAAACAGAGGTTGG + Intronic
1072781045 10:98252138-98252160 TAAAAGAAGAACAATGCGTGGGG + Intronic
1072974830 10:100048532-100048554 TAAAAAAAGAAAAATTAGGCGGG + Intronic
1073028798 10:100508353-100508375 GAGAAGGAGGAAGATGAGGGAGG + Intronic
1073091358 10:100942677-100942699 TAGAAATAGAAAAATTAGGCTGG - Intronic
1073308747 10:102524299-102524321 AAGAAAAAGAAAAATTAGGCTGG - Intronic
1073580780 10:104663817-104663839 TAAAAGAAGAAAGAGGAGTGGGG - Intronic
1073742538 10:106425035-106425057 GAGAAGAAGAAAAATTAAGCAGG + Intergenic
1073784674 10:106875858-106875880 CAGAAGTAGAAAAAGTAGGGAGG + Intronic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074373136 10:112916726-112916748 GAGAAGGTAAAAAATGAGGGTGG + Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074954611 10:118376285-118376307 TAGAAGAAAATAAATTAGGAAGG + Intergenic
1075382664 10:122031702-122031724 TCGAAAAAGAAAAAGGAGGCTGG - Intronic
1075391719 10:122097166-122097188 AAGAAAAAGAAAAATTAGCGTGG + Intronic
1076168721 10:128302823-128302845 TAGAGGAAGAAAGTAGAGGGTGG - Intergenic
1076197899 10:128533251-128533273 AAGAAGGAAGAAAATGAGGGAGG + Intergenic
1077613800 11:3660935-3660957 CAGAAGAAGAACCATGAGGATGG + Intronic
1078130697 11:8611879-8611901 AAGAAGAAGAAAAAGCAGAGAGG + Intergenic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078404742 11:11060535-11060557 GAAAAAAAGAAAAATGAGGTGGG + Intergenic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1078929372 11:15901457-15901479 GAGAAGAAGAAAAATAGGAGTGG + Intergenic
1079005712 11:16789988-16790010 AGGAAGAAGAGAAATAAGGGTGG - Intronic
1079050607 11:17154704-17154726 CAGAGGAAGAAAAGTGAGGAAGG + Intronic
1079544571 11:21617290-21617312 TGGAAGATGAAAAATTATGGTGG + Intergenic
1079749060 11:24172498-24172520 TAAAACAAGACAAATGAGGATGG - Intergenic
1079987627 11:27215520-27215542 CAGAAGAACAAAGATGAAGGAGG + Intergenic
1080257567 11:30308179-30308201 TAGAAGATGAGAAATGAGATTGG - Intergenic
1080432115 11:32208953-32208975 AAAAAAAAGAAAAAGGAGGGAGG + Intergenic
1080691223 11:34560002-34560024 TGGAAGAATAAAAGTAAGGGAGG + Intergenic
1081102805 11:39026042-39026064 TAGAAGAATAAAAATGAACTGGG - Intergenic
1081340302 11:41919371-41919393 TAGAAGAAGAAAAATGATTTAGG - Intergenic
1081385894 11:42472597-42472619 TAGAATAAGAAAAATCTGGCTGG - Intergenic
1081401310 11:42646328-42646350 TAAAAGAAAAACATTGAGGGTGG + Intergenic
1081470372 11:43364666-43364688 TATAAGAAGAAAAATAATAGTGG - Intronic
1081731202 11:45372842-45372864 TAGGACAAGAAAACTGTGGGTGG + Intergenic
1082664310 11:55955528-55955550 TTGAAGAAGAGTAAAGAGGGAGG - Intergenic
1082750456 11:57009557-57009579 TGGAAGAATAAAAGAGAGGGAGG + Intergenic
1082756016 11:57077452-57077474 AAGAAGAAGAAAAAAAAGGCAGG + Intergenic
1083141451 11:60725183-60725205 AAGAAGAAGAAAAAAAAGAGTGG - Intergenic
1083378436 11:62244641-62244663 TAGGAAAAGAAAAAAGAAGGTGG - Intronic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1083708671 11:64534099-64534121 TCCAAGAAGAAAACTGAGGCTGG - Intergenic
1084299200 11:68235305-68235327 AATAAAAAGAAAAATGAAGGTGG + Intergenic
1085080599 11:73630624-73630646 AAGAAAAAGAAAAAAAAGGGGGG + Intergenic
1085633371 11:78138641-78138663 GAGAAAAAGAAAAAAGAGGAAGG + Intronic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1085858349 11:80202174-80202196 GTGAAGAAGAAATATGAAGGTGG + Intergenic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086770030 11:90750599-90750621 TAAAAGAAAATAAAAGAGGGTGG - Intergenic
1087175741 11:95093245-95093267 TAGAACATAAAATATGAGGGTGG - Intronic
1087519079 11:99206534-99206556 TAGTAGGAGAAAAATCATGGTGG - Intronic
1087792727 11:102424071-102424093 TAAAAGCAGCAAATTGAGGGAGG + Intronic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1088267768 11:108003923-108003945 TAGAAGGGGAAAAATGATGATGG - Intergenic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1088924578 11:114287683-114287705 TTAAAGAAGAAAAATAAGGTGGG - Intronic
1089029921 11:115315164-115315186 TACCAAAAGAAAAAGGAGGGAGG + Intronic
1089369621 11:117946136-117946158 CACAAGAATAAAAATGAGGGTGG + Intergenic
1089380655 11:118028857-118028879 AAGAAGAAGAAAAAAGTTGGGGG + Intergenic
1089470514 11:118716670-118716692 TAAAAAAAAAAAAAAGAGGGAGG - Intergenic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1089739350 11:120571675-120571697 AAGAAGAGGAGAGATGAGGGGGG - Intronic
1089980074 11:122765012-122765034 TAGAAAAAAAAAAATGTAGGGGG + Intronic
1090050181 11:123371000-123371022 TAGAAGAAGAGATTTAAGGGAGG + Intergenic
1090527330 11:127551517-127551539 TAGAAGAAGAAAAACAATGGAGG - Intergenic
1090815054 11:130285586-130285608 CAGAAGAACAAAAAAGAGGCTGG - Intronic
1090863285 11:130673256-130673278 CAGCAGAAGAGAAATGATGGTGG + Intronic
1091337142 11:134780702-134780724 AAGAAGGAGAAAGAGGAGGGAGG - Intergenic
1091515780 12:1179801-1179823 GATATGAAGAAAAATGAGGCCGG - Intronic
1091885977 12:4017337-4017359 TAGCAGAAGAAAAGAGAGGTGGG - Intergenic
1091995706 12:4992097-4992119 CAGAAAAAAAAAAAAGAGGGGGG - Intergenic
1092067426 12:5603496-5603518 TAGAAGAAGAAAGAGAAAGGTGG + Intronic
1092286450 12:7131503-7131525 TGGAGGCAGAAAAAAGAGGGAGG + Intronic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092322313 12:7489224-7489246 CAGAAGAAGAAATATGCTGGAGG - Intronic
1092518253 12:9238518-9238540 GAGATGAAGGAAATTGAGGGAGG + Intergenic
1092601805 12:10074593-10074615 GAGAATAAGAAAAATTAGGAGGG + Intronic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092640412 12:10501881-10501903 AAGAATAAGAAAAATCAAGGCGG - Intergenic
1092797143 12:12123317-12123339 TAGAAGAAGAAACTTGTGGCAGG + Intronic
1092996853 12:13958955-13958977 TAAAAGAAAAAAAAAGGGGGTGG + Intronic
1093002962 12:14019286-14019308 TTGAAAAAGAAAAATGAAGTTGG - Intergenic
1093120728 12:15268059-15268081 TAAAAAAAAAAAAAGGAGGGGGG - Intronic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093400129 12:18735739-18735761 TAGAGTAAGAAAAAAGAGAGAGG - Intronic
1093772549 12:23034458-23034480 GGGAAGAAGAAAAAAGAGGGAGG - Intergenic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094197026 12:27760283-27760305 GAAAAGAAAAAAAATTAGGGGGG - Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094432212 12:30381762-30381784 AAGAAGAAGAACAAAGATGGAGG + Intergenic
1094478995 12:30865347-30865369 TATAAGAAGAAACATGAGCAAGG - Intergenic
1094561322 12:31556201-31556223 TAAAAAAAGAAAAAAAAGGGGGG - Intronic
1095085939 12:38057398-38057420 AAGAAAAAGAAAAAGGTGGGGGG + Intergenic
1095249728 12:39964205-39964227 TAGAAAAAGAGAGTTGAGGGAGG - Intronic
1095376618 12:41536775-41536797 AAGAAGAAGAAAAATCAAGAAGG - Intronic
1095545625 12:43364685-43364707 AAGAAGAAGAAAAATGAATAGGG + Intronic
1095654101 12:44649174-44649196 GAGAAGGAGAAAAATAAGGAAGG - Intronic
1095897967 12:47299784-47299806 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1095922986 12:47549499-47549521 TAGAAGGAGAGTGATGAGGGGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096173386 12:49492797-49492819 AAGAAAAAGAAAGATGAGGCCGG + Intronic
1096244986 12:49979524-49979546 TCGAAGATGAAAAGTGGGGGTGG - Intronic
1096409759 12:51368701-51368723 TTGAAGAAGGAAAAAGTGGGCGG - Intronic
1096804405 12:54131616-54131638 AAGAAAAAAAAAGATGAGGGGGG + Intergenic
1096939877 12:55331651-55331673 TAAAAGAACAAAAAGGAGAGTGG + Intergenic
1097345993 12:58493023-58493045 TTGAAGAAGAAAAATGAAGTTGG - Intergenic
1097389324 12:58989990-58990012 TAGAAAAACAAAAAAAAGGGGGG + Intergenic
1097553921 12:61114117-61114139 TAATAGGAGAAAATTGAGGGTGG + Intergenic
1097860282 12:64512035-64512057 GGGAAGAAGAGAAAGGAGGGGGG + Intergenic
1098237899 12:68435625-68435647 GAGAAGAAGAAGTAAGAGGGAGG + Intergenic
1098401282 12:70079159-70079181 TGGAAGAGGAGAAAGGAGGGAGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098610358 12:72449892-72449914 TAGAAGGAGAAAAGTGAGGAAGG - Intronic
1098705343 12:73681329-73681351 AAGAAGAAAAAAAATGAGATGGG - Intergenic
1098853102 12:75621037-75621059 TTGAAGAAGAGAAATAAGGTAGG + Intergenic
1100535307 12:95503396-95503418 GAGAACAAGAAAAATGAGTATGG + Intronic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1101322432 12:103684397-103684419 TGATAGAAGAAAAATGAGGAGGG + Intronic
1101610016 12:106282806-106282828 TAGGAGGAGAAAATTGAGGCTGG - Intronic
1101669269 12:106852282-106852304 TAGAAGAAGAAAAAATAAGTAGG - Intronic
1101915221 12:108890622-108890644 GAGAAGAAAAAAAAAGAGAGAGG - Intronic
1102081293 12:110100181-110100203 TAGAGGGAGAAAAATAAGGCTGG - Intergenic
1102167963 12:110821035-110821057 AAGAAGAAGAAAGAAGAAGGTGG - Intergenic
1102194729 12:111016928-111016950 GAGAAGAAGAGAAGGGAGGGAGG - Intergenic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1102661323 12:114531372-114531394 AAGAAGGAAGAAAATGAGGGTGG + Intergenic
1102974977 12:117200187-117200209 GAGAAGAAGAAAGAAGAAGGAGG - Intergenic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103354602 12:120310572-120310594 TAAAAGGAGAAAAATGAGGCTGG + Intronic
1103573927 12:121862981-121863003 TAAAAAAAAAAAAAGGAGGGGGG - Intronic
1103654927 12:122463133-122463155 TACAAAAATAAAAATGAGGCTGG + Intergenic
1103712446 12:122922952-122922974 AAGAAGAAGAAAAATTAGCCAGG - Intronic
1103772926 12:123342557-123342579 TAGAAGAAGAAAAATCAATTTGG + Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104211778 12:126695805-126695827 TAGAAGACGATAAAAGAGCGAGG + Intergenic
1104434203 12:128742892-128742914 TTGCAGAAGAAAGATGCGGGAGG + Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105401588 13:20100863-20100885 TAAAAGTACAAAAATGAGGCAGG + Intergenic
1105474031 13:20715899-20715921 TAAAAGAATAAAAATGAGCCAGG - Intronic
1105614250 13:21998259-21998281 TTCAAAAAGAAAAATGAAGGTGG + Intergenic
1105694612 13:22875568-22875590 TGGAAGAAACAAAAGGAGGGAGG + Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106131405 13:26942703-26942725 AAGAAAAAGAAAAAAGAGCGAGG - Intergenic
1106568190 13:30905172-30905194 TAGAAGAAGAGAAGAGAGTGGGG + Intergenic
1106733094 13:32562119-32562141 TATAAGAAGAAATATGAGAGAGG + Intergenic
1106849594 13:33775299-33775321 GGGAAGAAAAAAAAGGAGGGGGG - Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1108097343 13:46917358-46917380 TGGGGGAAGAAAAAGGAGGGAGG - Intergenic
1108259113 13:48639282-48639304 TGGATGGAGAAAAATCAGGGGGG + Intergenic
1108446779 13:50517443-50517465 TAGATGGAGAAAATTAAGGGAGG - Intronic
1108490199 13:50974380-50974402 AGGAAAAAGAAAAAGGAGGGAGG + Intergenic
1108515341 13:51196419-51196441 AATAAGAATAAAAATGAGTGGGG + Intergenic
1108883350 13:55148390-55148412 TAGAAAAGGTAAAAAGAGGGAGG + Intergenic
1108970715 13:56372411-56372433 TACAAGAATAAAAGAGAGGGAGG + Intergenic
1109018040 13:57045335-57045357 TAGAAGAAAAAAAATCAATGAGG - Intergenic
1109106201 13:58253544-58253566 GCAAAGAAGAAAAATGAGGAGGG - Intergenic
1109507871 13:63330858-63330880 GATAAGAAAAAAAATGAGGTAGG - Intergenic
1109558706 13:64018013-64018035 GAGAATAAGAAAACTGTGGGTGG - Intergenic
1109654427 13:65370376-65370398 TAGAAAAAGAAATATTAGGATGG + Intergenic
1109811528 13:67519401-67519423 CAGAAGAAGAAAAATGGATGAGG + Intergenic
1110032482 13:70633186-70633208 TGGAAGAAGAAAAATAAAAGAGG + Intergenic
1110038097 13:70714669-70714691 TAGAAAAAGAAAAAAGGGAGGGG - Intergenic
1110136590 13:72074947-72074969 AAGAACTAGAAAAGTGAGGGTGG + Intergenic
1110431350 13:75427541-75427563 TAGAAAAAGAAAAAAGAAGATGG + Intronic
1110738637 13:78968037-78968059 TGGAAGAAGAAAAAACAGTGAGG - Intergenic
1110815776 13:79858544-79858566 TAGAACATGAAAAATGCTGGAGG + Intergenic
1111282339 13:86043088-86043110 TACAAGAAGAAAACGTAGGGGGG + Intergenic
1111304165 13:86384095-86384117 TCAAAGAAGAAAATTGAAGGTGG - Intergenic
1111590058 13:90334602-90334624 TAGAAAAAGAAATATGGGGCGGG - Intergenic
1111965544 13:94858013-94858035 AAGAAGAAGAATAATGAATGTGG - Intergenic
1111971840 13:94925010-94925032 TTGCAGAGGAAAAAAGAGGGGGG - Intergenic
1112063421 13:95765730-95765752 TAGAAGTACAAAAATGAGCCAGG - Intronic
1112251088 13:97781107-97781129 AAGAAAAAAAAAAAGGAGGGAGG + Intergenic
1112268658 13:97948778-97948800 TAAAAGAAGAGAAATGGGGCCGG - Intergenic
1113169714 13:107486723-107486745 AAGAAGCACAAAAATGAGTGTGG + Intronic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1113303875 13:109054965-109054987 AAGAAGGAGGAAAAGGAGGGAGG - Intronic
1113318687 13:109211156-109211178 TAAAGGAAGAAAAATGGGGGTGG - Intergenic
1114133820 14:19823843-19823865 GAGAAAAAGAAAAATAAGGAAGG + Intronic
1114336451 14:21696120-21696142 TTGAAAAAGAAAAATAAGGTGGG + Intergenic
1114490752 14:23100259-23100281 AAGAAGAAGAAAAAGGTGGGGGG + Exonic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115275658 14:31606046-31606068 AAGAAGAAGAAGAATGGAGGAGG - Intronic
1115464924 14:33704887-33704909 AAGAAGAGGAAAAAATAGGGTGG + Intronic
1115565167 14:34618861-34618883 ATTATGAAGAAAAATGAGGGAGG - Intronic
1115856650 14:37636861-37636883 AAAAAGAAGAAAAAAGTGGGAGG + Intronic
1116008471 14:39323194-39323216 TAAGTGAAGCAAAATGAGGGTGG - Intronic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1116070670 14:40040905-40040927 TAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1116255844 14:42554261-42554283 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
1116520151 14:45836606-45836628 TAGCAAAAAAAAAATGTGGGTGG - Intergenic
1116551956 14:46251574-46251596 TAGGAGCAGACAAGTGAGGGAGG - Intergenic
1116630013 14:47318751-47318773 TAGTAGAATGAAAAGGAGGGAGG + Intronic
1116665140 14:47764926-47764948 TAGAAGGAGAAGAAGGAGAGAGG + Intergenic
1118233764 14:63979910-63979932 AAGAAAAATAGAAATGAGGGGGG + Intronic
1118367482 14:65108237-65108259 TAGAAAAAAAAAAAAGAGGCCGG + Intergenic
1118407001 14:65434779-65434801 TAAAAGAAAAAAAAGGTGGGGGG - Intronic
1118667027 14:68081451-68081473 TAAAAGGAGAAGAGTGAGGGCGG + Intronic
1118789089 14:69072651-69072673 GAAAAGAAAAAAAATGTGGGTGG + Intronic
1118798446 14:69167066-69167088 TAAAAAAAGAAAAAAGAGGCTGG + Intergenic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1118850861 14:69582304-69582326 ATTAAGAAGAAAAAGGAGGGGGG - Intergenic
1118941768 14:70345810-70345832 TCGAACGAGAAAAATGAGGTAGG - Intronic
1119026504 14:71157012-71157034 AAGAAGAAAAAAAAAGAGTGAGG + Intergenic
1119293862 14:73517680-73517702 AAGAAGAAGAAAAGAGAGAGAGG + Intronic
1119307518 14:73619662-73619684 TAGAAGGAGGAAAATAAGGTGGG - Exonic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1119915243 14:78393553-78393575 TTGAAAAAGAAAAATGAAGTAGG - Intronic
1119964619 14:78900426-78900448 AAAAAGAAAAAAAATGAAGGAGG - Intronic
1119979224 14:79060765-79060787 TATAAGAAAAAAAAAGAGGGAGG - Intronic
1120096365 14:80393091-80393113 TAAAGGAAGTGAAATGAGGGTGG + Intergenic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120568973 14:86093986-86094008 TAAAAGATAAACAATGAGGGAGG - Intergenic
1120610370 14:86634335-86634357 AAGAAGAAGAAAAATGGAGAAGG + Intergenic
1121043049 14:90765940-90765962 GAGAAAGAGAAAAATGAGGCTGG - Intronic
1121506103 14:94478767-94478789 TAGAGGAAGAAACAGCAGGGTGG - Intronic
1122183679 14:99972597-99972619 TGCAAGAAGAAAAAAAAGGGGGG - Intronic
1122846553 14:104503217-104503239 GAGAAGAAGCAAGATGGGGGAGG - Intronic
1123453303 15:20388254-20388276 TAGTATAAGAAAAATGAGGGTGG + Intergenic
1123576891 15:21679430-21679452 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1123613513 15:22121898-22121920 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1124160195 15:27261202-27261224 TAGAAGAAGAAAATGGTTGGAGG + Intronic
1124459635 15:29877620-29877642 GAGAAGAAGAAAGAAGAAGGAGG - Intronic
1124709599 15:31996428-31996450 TAGAAGAAGAAAAGAAAGTGTGG - Intergenic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1125057654 15:35381419-35381441 AAGAAAAAGAAAAAAGAGGAAGG + Intronic
1125102761 15:35933985-35934007 CAGAAGTAGAAAAATCAGTGGGG + Intergenic
1125257926 15:37788219-37788241 TAGAAGCAGATAACTGTGGGTGG + Intergenic
1125652544 15:41329474-41329496 TAAAAGTACAAAAATTAGGGGGG - Intronic
1125762915 15:42109953-42109975 AAGAAGAAGAAAAAAGGAGGAGG - Intergenic
1126060714 15:44779260-44779282 TAAAAGAGGAAAGATGAGGTGGG + Intergenic
1126218051 15:46179797-46179819 GAGAAGACCAAAAATGAGTGGGG - Intergenic
1126232619 15:46344593-46344615 TAAAAGGAGAAGAATGAGGAAGG + Intergenic
1126244085 15:46483327-46483349 TGGAAGGAGAAAAATGAGGCTGG + Intergenic
1126337922 15:47606644-47606666 TAAAGGAAGAAAAATCATGGTGG - Intronic
1126429667 15:48568557-48568579 TAGAAGAAGAAGAATAAAGTTGG + Intronic
1126551890 15:49940590-49940612 TAGACAAAGAAAAATGAGGGTGG + Intronic
1126861284 15:52885424-52885446 TAGAAGTAGAGAAATAAGTGAGG - Intergenic
1126966833 15:54063544-54063566 TAGGAGAATAAAAATGAGTGAGG - Intronic
1126971180 15:54113384-54113406 TATAAGCAGAAAAATCAGAGTGG + Intronic
1127217732 15:56842591-56842613 CAGAAAAAGTAAAATGAAGGGGG + Intronic
1127267530 15:57374110-57374132 AAGAAAAAGAGAAAGGAGGGAGG - Intergenic
1127517823 15:59713421-59713443 AAGAAAAAGAAAAAGGAAGGAGG - Intergenic
1127593447 15:60452082-60452104 AACAAGAAGAAACATGAGGTAGG - Intronic
1127706332 15:61550579-61550601 TTTAAGAAAAAGAATGAGGGAGG - Intergenic
1127716275 15:61652088-61652110 TAAAAGAAAAAAAAAGAGGCCGG - Intergenic
1128697828 15:69781635-69781657 GAGAAGAAGAAAACTGACTGGGG + Intergenic
1128817370 15:70622075-70622097 TAAAAGAAGAAAAATGTTGGAGG - Intergenic
1128916704 15:71569510-71569532 TACAAGAAAACAAATAAGGGAGG + Intronic
1129592052 15:76924777-76924799 AAGAAGAAAAAGAATGTGGGAGG - Intergenic
1129735739 15:77961321-77961343 CAAAAGAAGAAAACTGAGGTAGG - Intergenic
1129735901 15:77963074-77963096 TAGAAGAAGAAACCTGGGGCTGG - Intergenic
1130225581 15:82055986-82056008 TTGATGATGAAAAGTGAGGGAGG - Intergenic
1130551449 15:84892215-84892237 TAAAAAAAGAAAAAGGAGGATGG + Intronic
1131034085 15:89209870-89209892 TAAAAGAAGATAAAAGAGAGAGG - Exonic
1131140938 15:89976699-89976721 TATAAGAAGCAAGATGAGGCTGG + Intergenic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1131418712 15:92284996-92285018 AAGTAGAAGAAAACTGAAGGAGG - Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131780152 15:95847206-95847228 GAGAAAAAGAAAAACAAGGGAGG - Intergenic
1131935914 15:97504717-97504739 AAGAAGAAAAAAAAAGGGGGTGG - Intergenic
1131935915 15:97504720-97504742 TACAAGAAGAAAAAAAAAGGGGG - Intergenic
1132220292 15:100100253-100100275 TCGAAGAAGCAAGAGGAGGGAGG - Intronic
1202985759 15_KI270727v1_random:413675-413697 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1133326527 16:4945396-4945418 GAGAAGAAGAAAAAGGAATGTGG - Intronic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133472985 16:6093780-6093802 TACAAAAAAAAAAATGAGTGGGG - Intronic
1133504159 16:6393930-6393952 AAGAAGAAGAAAAGTGGGAGAGG + Intronic
1133634456 16:7652402-7652424 AATAAGAAGAAGAATGTGGGCGG - Intronic
1133812170 16:9169096-9169118 TAGAAGAAGAGAAATGAGATGGG - Intergenic
1133919148 16:10136623-10136645 AATATGAAGAAAAATGGGGGAGG - Intronic
1134308339 16:13053644-13053666 TACACGAAGAAAGATCAGGGAGG - Intronic
1134324287 16:13192883-13192905 GAGAAGAAGAAGAAAGAAGGAGG + Intronic
1134569379 16:15278455-15278477 GAGAAGAGGAAAATGGAGGGTGG - Intergenic
1134732998 16:16477590-16477612 GAGAAGAGGAAAAGGGAGGGTGG + Intergenic
1134871353 16:17654897-17654919 TAAAAATAGAAAAATGAGGCGGG + Intergenic
1134934440 16:18234383-18234405 GAGAAGAGGAAAATGGAGGGTGG - Intergenic
1135919553 16:26636673-26636695 TATAAGAAGAAAAGTCAAGGTGG + Intergenic
1135942428 16:26834220-26834242 AAGAAGAAGGAAGAGGAGGGAGG + Intergenic
1135962886 16:27012429-27012451 TAGCAGAAGAAAGATGACTGTGG - Intergenic
1135983745 16:27168562-27168584 TAGGGGAAGAAAGATGAAGGAGG + Intergenic
1136107386 16:28039957-28039979 GAGATGGAGAAAAACGAGGGAGG - Intronic
1136144952 16:28311081-28311103 TGGAAGGAGAAGAAGGAGGGAGG + Intronic
1136160313 16:28415451-28415473 TAAAAGAAAAAAAAAGAGGCTGG + Intergenic
1136351329 16:29710093-29710115 AAGAAGGAGAAAAAAGGGGGGGG + Intergenic
1136574398 16:31114916-31114938 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
1136656994 16:31715377-31715399 TTGAAGAACAAAAAGGAAGGGGG + Intronic
1136939665 16:34510988-34511010 AAGAAGGAGGAAAAGGAGGGCGG - Intergenic
1136960155 16:34837572-34837594 AAGAAGGAGGAAAAGGAGGGCGG + Intergenic
1137019482 16:35409949-35409971 AGGAACAAGAAAAATGGGGGAGG + Intergenic
1137377251 16:47962801-47962823 TAGAACAAGAAAAATGAGACTGG + Intergenic
1137567143 16:49540433-49540455 AAGAAAAAAAAAAATGAGTGGGG - Intronic
1137792769 16:51188846-51188868 TAGAGGAATAAAAATGTAGGTGG + Intergenic
1137820391 16:51439125-51439147 GAGAAAAAGAAAAAAGAGGGAGG + Intergenic
1137897169 16:52226509-52226531 TAGAACAAGAAAATAGAGGAAGG - Intergenic
1137903009 16:52289656-52289678 AAAAAGAAAAAAAAAGAGGGGGG - Intergenic
1138055346 16:53827215-53827237 TAGAAGAAGAGAAATGTGGGTGG - Intronic
1138095169 16:54205749-54205771 TAGCTGATGAGAAATGAGGGTGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138266365 16:55662750-55662772 TCTAAGTAGAAAAATGGGGGTGG - Intronic
1139001183 16:62512001-62512023 GAGAGGAAGAAAAGTGGGGGGGG + Intergenic
1139002160 16:62525182-62525204 TCGAAGAAGAAAAACGGGTGGGG + Intergenic
1139171990 16:64641979-64642001 TAGAAGAACAAAGCTGAAGGTGG - Intergenic
1139982133 16:70868306-70868328 TTGAAGAAGGAAAAGGTGGGAGG + Intronic
1140067463 16:71623985-71624007 TAGAAGGAAAAAGAAGAGGGTGG - Intergenic
1140077050 16:71709823-71709845 AAGAAAAAGAAAAATGTGTGTGG - Intronic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140401155 16:74672832-74672854 TAGAAGAAGAAAGAAGACAGAGG + Intronic
1140422647 16:74833332-74833354 TAAAAATACAAAAATGAGGGAGG - Intergenic
1140857472 16:78990643-78990665 TGAAAGAAGAAAAAGGAGGAAGG + Intronic
1140944456 16:79754906-79754928 GAGAAAAAGAAAATTCAGGGAGG + Intergenic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141533549 16:84663168-84663190 TAGAAGCAGAAAACTGGGGCAGG - Intronic
1141544148 16:84752465-84752487 TAAAAGAATAAAAATGAGGAAGG - Intronic
1141788986 16:86220200-86220222 TAAAAAAAAAAAAATGAGGCTGG + Intergenic
1142346365 16:89556657-89556679 TAGAAGTAGAAAAATTAATGAGG + Intronic
1142454278 16:90208572-90208594 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1142795040 17:2301141-2301163 AAAAAGGAGAAAAAGGAGGGAGG + Intronic
1142989171 17:3717988-3718010 TAGAAGAAGATAAAGGGAGGTGG - Intronic
1143800099 17:9372216-9372238 TAGGAGAAGAAAAAGACGGGAGG - Intronic
1143804996 17:9418905-9418927 AAAAAGAAAAAAAAAGAGGGGGG - Intronic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144055141 17:11533885-11533907 TAGAGTAAGAATAATGAGGCTGG - Intronic
1144161136 17:12559340-12559362 TAGAAGAAGGAAAGAGAGGAAGG - Intergenic
1144360242 17:14485223-14485245 AAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1145102975 17:20092066-20092088 AAGTAGAAGAGAAAGGAGGGAGG - Intronic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145943111 17:28754111-28754133 TAAAAAAAGAAAACTGAGGCCGG - Intergenic
1146168362 17:30611562-30611584 TTAAAGAAGAAAAATGTGGCCGG + Intergenic
1147291061 17:39443454-39443476 TAGAAGTAAAAAATTGAGGTAGG - Intronic
1147305785 17:39563534-39563556 TGGAAGAAGAAGAGAGAGGGAGG - Intronic
1147502002 17:40974629-40974651 AAGAAGAAAAGAAAGGAGGGAGG - Intergenic
1147759060 17:42785777-42785799 AAGAAAAAGAAAAATGGGGAGGG - Intronic
1148549637 17:48542909-48542931 TAGAAGAAGAAGAAAGGGAGTGG + Exonic
1148562515 17:48614038-48614060 AAGAAGAAGAAAAGTAAGGCAGG + Intronic
1148609621 17:48955987-48956009 AATAAGAAGAAAAAAGAGGCCGG - Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149375846 17:56043073-56043095 GAGATGAAGAAACCTGAGGGAGG + Intergenic
1149399461 17:56280168-56280190 TAAAAGACGAAAAATGAGCTGGG - Intronic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149558333 17:57590130-57590152 TGGAGAAAAAAAAATGAGGGAGG - Intronic
1149755164 17:59180289-59180311 TAAAAGAACAAAAATGAGCTGGG - Intronic
1150033105 17:61762293-61762315 TACTAGAAGAAAACAGAGGGGGG + Intronic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150308254 17:64105111-64105133 AAAAAGAAGAAAAAAGAGAGAGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150426352 17:65080006-65080028 TATAAGAAAAAAAATGAGGTCGG - Intergenic
1150931813 17:69592962-69592984 GAGAAGAAAAAAATGGAGGGAGG - Intergenic
1150957384 17:69874181-69874203 TAGAAGGGGAAGAATGAGTGTGG + Intergenic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151413229 17:73944845-73944867 TAGAGGAAGAAAAAGAAGTGGGG - Intergenic
1151947536 17:77327727-77327749 TAGAAAAAAAAAGAGGAGGGTGG - Intronic
1152439199 17:80295164-80295186 TAAAAGGAGGAAAATGGGGGAGG - Intronic
1152452838 17:80393864-80393886 TAGAAGAAAAAAAAAAAGAGGGG - Exonic
1152478787 17:80536423-80536445 AAGAAAAAGAAAAATGGGGCCGG - Intergenic
1152983869 18:304797-304819 TATAAGAAGAGACATGAGCGGGG - Intergenic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154265861 18:12878368-12878390 AAGAAAAAGAAAAATGTGGCTGG + Intronic
1154465824 18:14642156-14642178 TAGAAGGAGGAAAGAGAGGGTGG - Intergenic
1155102499 18:22626174-22626196 CAGAGGAAGAAAGATGAAGGGGG + Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1155943153 18:31819904-31819926 TAGAGGAAGAGAAAGGAGAGAGG - Intergenic
1156040698 18:32817963-32817985 TCAAAGAAGCAAAATGTGGGGGG + Intergenic
1156075350 18:33270286-33270308 TCAAAGAAGAAAAGAGAGGGGGG + Intronic
1156100541 18:33588967-33588989 TAGAAGAAAAAAGATGAAGGTGG - Intronic
1156257588 18:35412348-35412370 TGAAAGAAGAAAAAGGAGTGAGG - Intergenic
1156284403 18:35676654-35676676 TAAAGGAAGAAAGAGGAGGGTGG + Intronic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156741117 18:40329674-40329696 TATAAGATGAAAAATGATGATGG - Intergenic
1156952029 18:42912960-42912982 AAAAAGAAGAAAAACGAGGGAGG + Intronic
1157129794 18:44996137-44996159 GAGAAGAAGAGAAAAGAGGGAGG - Intronic
1157218407 18:45805455-45805477 CAGAAGAACAAAAATCAGAGGGG + Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157698297 18:49742550-49742572 TACAAGGAGAAAAATCAGGTGGG - Intergenic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158034627 18:53011739-53011761 TAGAAAAAAAAAATTGAGGTAGG - Intronic
1158156818 18:54435276-54435298 GAGAAGCATAAAAATGAAGGAGG - Intergenic
1158804566 18:60954408-60954430 TAGTAGAAGACAAAAGAGTGTGG - Intergenic
1158975277 18:62705383-62705405 TAGGAGAAAAAAAATCTGGGAGG + Intergenic
1159116191 18:64115423-64115445 AAGAAGGAGGAAAATGAGGTAGG + Intergenic
1159572129 18:70127748-70127770 AAAAAGAAAAAAAATGAAGGAGG + Intronic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1160186932 18:76682995-76683017 TAGAAAAAGAAAAATTAGTCGGG - Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160433280 18:78826995-78827017 TGGAAAGAGCAAAATGAGGGTGG - Intergenic
1161020623 19:2009492-2009514 TAGAAGTAGAACAATCTGGGTGG - Intronic
1161365527 19:3877194-3877216 TAGATGAATAAAAAAGAGGGAGG - Intergenic
1161914268 19:7216970-7216992 AAGAAGAAGAAAAATTAGCTGGG - Intronic
1162103047 19:8352188-8352210 AAGAAGAAAGAAAAAGAGGGAGG + Intronic
1162549651 19:11351451-11351473 TAAAAAAAAAAAAATGAGGAGGG + Intronic
1162889898 19:13725137-13725159 AGGAAGAAGGAAAATGAAGGAGG + Intergenic
1162980202 19:14234111-14234133 TTAAAAAATAAAAATGAGGGAGG + Intergenic
1163050983 19:14683339-14683361 TAGAAGAAGAGAACTGAAGAAGG + Intronic
1163149162 19:15401015-15401037 AAGAAGAAGAGAAAGCAGGGCGG - Exonic
1163387240 19:17007375-17007397 AAGAAGAAGAAAGAAGAAGGAGG + Intronic
1163431108 19:17268262-17268284 AAAAAGAGGAAAAAAGAGGGGGG + Intronic
1163462828 19:17448885-17448907 TAAAACAAGAAAAAGGAGGCCGG + Intronic
1163538628 19:17893436-17893458 GAGAAGCAGAGAAAGGAGGGAGG + Intronic
1163703960 19:18801527-18801549 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1164001538 19:21104909-21104931 TATAAAAATAAAAATGAGGCCGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164265380 19:23610925-23610947 GAGAACAAGAAAAAGCAGGGTGG - Intronic
1164292222 19:23879072-23879094 AAGAGGAGGAAAAATGAAGGAGG + Intergenic
1164457426 19:28420508-28420530 CTGATGAAGTAAAATGAGGGGGG + Intergenic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1164682998 19:30148405-30148427 TAAAATGAGCAAAATGAGGGTGG - Intergenic
1164943423 19:32269355-32269377 GAGAAAAAGAAAAATTAGGTAGG - Intergenic
1165171337 19:33894118-33894140 TAAAAAAAGAAAAAAGAGGCTGG - Intergenic
1165678507 19:37750241-37750263 TAAAAGTAGAAAAATTAGTGAGG - Intronic
1165723839 19:38099004-38099026 GAGAAGAAAAGAAAGGAGGGAGG - Intronic
1165775582 19:38402802-38402824 CAGCAGAAGACAACTGAGGGAGG + Intergenic
1165960307 19:39528689-39528711 GAAAAGAAGAGCAATGAGGGTGG + Intergenic
1166256820 19:41612568-41612590 TAGCAGAATAAAATTGAGGGTGG + Intronic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1166920465 19:46225994-46226016 TAAAAGAAGAAGAATGAAGAAGG + Intergenic
1167343394 19:48929877-48929899 TCAAAAAAGAAAAAAGAGGGCGG - Intergenic
1167397600 19:49241469-49241491 TGGAAGAATAATAATGAGGCCGG + Intergenic
1167686993 19:50962648-50962670 TAGAAAAGGACCAATGAGGGAGG - Intronic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1167835432 19:52064601-52064623 CAGAAGAACAAACAAGAGGGAGG + Exonic
1168452130 19:56474822-56474844 TAAAAAAAGAAAAAAAAGGGCGG - Intronic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
926423978 2:12724730-12724752 CAGAAGGAGAAATATGAGGCTGG - Intronic
926481996 2:13410978-13411000 TAGTATAAGAAAAATGAGGGTGG - Intergenic
926574462 2:14564708-14564730 AAGAAGAAGAAACAGGAGGGAGG + Intergenic
926678910 2:15649423-15649445 TAGCTGAGGAGAAATGAGGGCGG + Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
927116458 2:19907873-19907895 TTGAAGAAGAAAAACAAAGGAGG + Intergenic
927182693 2:20458286-20458308 TAGAAAAAAAAAAATTAGAGGGG + Intergenic
927295876 2:21452668-21452690 GAGAAGAAAACAAATTAGGGAGG - Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927344494 2:22022080-22022102 TAGCAAAAGAAAAAAAAGGGAGG - Intergenic
927409932 2:22813633-22813655 GAGAAACAGAACAATGAGGGGGG + Intergenic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
928237770 2:29559695-29559717 TAAATGAAGAGTAATGAGGGTGG + Intronic
928330948 2:30357471-30357493 TATAATAAGAAACATGAGGCCGG - Intergenic
928373777 2:30759162-30759184 AAGGAGGAGAAAAACGAGGGAGG - Intronic
928530602 2:32187018-32187040 AAGAAAAAGAAAAATGAGTTCGG + Intronic
928542466 2:32295897-32295919 TAAAAGATGAAAACTGAGGCTGG - Intronic
928746728 2:34424752-34424774 GAGAAGGAGAGAAAGGAGGGGGG + Intergenic
928980769 2:37133343-37133365 CAGAAGAGGAGAAATGAGAGGGG - Intronic
929079267 2:38106345-38106367 AATAAGAAGAAAAATCAGAGTGG + Intronic
929122267 2:38493457-38493479 AGGAAGAAGAAAAATGGGAGAGG - Intergenic
929554590 2:42917762-42917784 TCGAAGATGAATAATGAGGTAGG + Intergenic
929677398 2:43950907-43950929 TAGAAGTAGAAAAATTAGCCGGG + Intronic
929799924 2:45091033-45091055 TTGAAAAAGGAAAAAGAGGGTGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930175274 2:48295056-48295078 GGAAAGAAGAAAAATGAAGGGGG - Intergenic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930515439 2:52401838-52401860 TAAAAGATGATAAATGTGGGGGG - Intergenic
930898130 2:56469922-56469944 TAGAAGGAGAAAAAAGAGAAAGG + Intergenic
931068664 2:58619010-58619032 AAGAAAAAAAAAAAAGAGGGTGG + Intergenic
931165826 2:59746680-59746702 TGGAAGAAAAAAAAAGAGGAAGG + Intergenic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931508493 2:62960268-62960290 TAGAATGAAAAAAATGAGAGAGG - Intronic
931938086 2:67220044-67220066 AAGAAGAAGAAAAAAAAGGTGGG + Intergenic
932018676 2:68060046-68060068 GAGAAGTAGAAAACTGTGGGAGG - Intronic
932062148 2:68513878-68513900 TAAATGAAAAAAAATTAGGGTGG - Intronic
932099779 2:68888136-68888158 TACAAGAAGAAAAATTAGCAGGG + Intergenic
932205285 2:69875405-69875427 GAAAAAAAGAAAAATGAAGGTGG - Intronic
932357956 2:71082125-71082147 TAAAAGTAGAAAAATTAGGTGGG + Intergenic
932415900 2:71573795-71573817 AAGAAAAAGAAAAATCAGGAGGG - Intronic
932472012 2:71965764-71965786 CAAAGCAAGAAAAATGAGGGAGG - Intergenic
932517204 2:72364213-72364235 TAAAGAAAAAAAAATGAGGGGGG + Intronic
932690900 2:73912869-73912891 TAGATTAAGAAATATGAGGCTGG + Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933199619 2:79434322-79434344 GAGAAGAAGAAAAATAAGAGAGG + Intronic
933204474 2:79489656-79489678 TAGAATAAGCAAAATGAGCCAGG - Intronic
933460093 2:82572055-82572077 AAGAAGAAGAAACATTATGGAGG - Intergenic
933488659 2:82955954-82955976 GAGAAGAAGAAAGAGGAAGGAGG + Intergenic
933501067 2:83112030-83112052 TAGAAAAAGAAAAATGATACTGG + Intergenic
933529762 2:83492467-83492489 TAGAACAAGAAAAATTAGCATGG + Intergenic
933903507 2:86866465-86866487 TGGAAAAATAAAAATGTGGGAGG - Intergenic
934144563 2:89078709-89078731 GAGCAGAAGGGAAATGAGGGAGG - Intergenic
934224689 2:90121840-90121862 GAGCAGAAGGGAAATGAGGGAGG + Intergenic
935311900 2:101792624-101792646 AAGAAGAAGAAAGAAGAAGGAGG - Intronic
935723616 2:106001842-106001864 TTGAAAAAGAAAAATGTTGGGGG - Intergenic
935952769 2:108345793-108345815 AAGAGGAAGAAAAATCAGAGAGG + Intergenic
936091268 2:109502867-109502889 AAAAAGAAGAAAAATGGTGGTGG - Intronic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936964737 2:118116631-118116653 TAGAAGGAGAAATGTGTGGGAGG + Intergenic
937404619 2:121615382-121615404 CAGCATAAGTAAAATGAGGGAGG + Intronic
937872366 2:126795316-126795338 TGGAAAAACAAAAATGATGGAGG + Intergenic
937992357 2:127671733-127671755 AAGTAGAAGAAAAAGGAAGGAGG + Intronic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938621558 2:133059932-133059954 CAGAAAAAAAAAAATGAGGGAGG + Intronic
938635798 2:133225044-133225066 TTAAAGAAGAAATATCAGGGTGG - Intronic
938639194 2:133262701-133262723 TAGATGAATAAGAATGTGGGTGG - Intronic
938660052 2:133477189-133477211 TAGAAGAGCAAAAAGGAGTGAGG + Intronic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
938928914 2:136068780-136068802 TAGAAGAAGAAAAAAAAAGCTGG - Intergenic
939007078 2:136801618-136801640 TATTAGAAGAAAAATGGCGGTGG + Intronic
939075559 2:137598839-137598861 TAAAAGAAAAAAAAGAAGGGAGG - Intronic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939342364 2:140915261-140915283 TAGAGAAAGAAAAATTAGTGTGG + Intronic
939691321 2:145265208-145265230 TAGTAGGAGAAAAATGAGAGGGG - Intergenic
939799864 2:146696113-146696135 TAGAAGAAAAGAAAGAAGGGGGG - Intergenic
939818320 2:146923741-146923763 AAAAATAAGAAAAATGAAGGAGG + Intergenic
940479707 2:154212712-154212734 TAGAAGGAGAAGAAGGATGGGGG - Intronic
940841870 2:158593136-158593158 TAGAAGAATAGAAATGAGGAAGG + Intronic
941175437 2:162192454-162192476 TGGAAGGAGAAAAATGAGCCTGG - Intronic
941272280 2:163445214-163445236 GAAAAGAAGAAAAAAGAGAGAGG - Intergenic
941577792 2:167256722-167256744 TAGAAGGATAAAAATCAGGATGG + Intronic
941597605 2:167497220-167497242 CAGAGGAAGGGAAATGAGGGGGG + Intergenic
941609428 2:167642693-167642715 TATGAGAAGAAAAATAAGGCAGG - Intergenic
941904762 2:170710073-170710095 TAGAAGAAAACAAAGGAGGCTGG - Intergenic
941950093 2:171146513-171146535 TAAAAGAAAAAATATGACGGTGG + Intronic
942020505 2:171863228-171863250 TATAAGAAGAAAAATGGGCCAGG + Intronic
942494661 2:176527117-176527139 GAAAAGAGGAAAAAGGAGGGTGG - Intergenic
942683568 2:178507232-178507254 TGGGGGAAGAAAAATGTGGGAGG - Exonic
943234639 2:185301503-185301525 TAGAAAAATAAAAATAAGGATGG - Intergenic
943301623 2:186209874-186209896 TAGGAGAAGAAAAAAGTTGGAGG - Intergenic
943631350 2:190256022-190256044 TAGTAGGAGAAAAAAGAGTGAGG + Intronic
944768937 2:202893814-202893836 TAAAAGGAGCAAATTGAGGGAGG - Intronic
944855383 2:203762242-203762264 TAGAAGGAAAAGAATGAAGGGGG - Intergenic
945028113 2:205638496-205638518 TATAATAAGAAAAACCAGGGAGG + Intergenic
945076479 2:206044602-206044624 GAGATAAAGAAAAATGAGGATGG + Intronic
945155165 2:206830429-206830451 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945224599 2:207520540-207520562 AAAAAGAAAAAAAATGAGAGGGG + Intergenic
945966056 2:216188066-216188088 TAGGGGAAGAAAAAAGAGTGAGG - Intronic
946305740 2:218856062-218856084 TAGAAAAAGAAAAGAGAGCGAGG - Intergenic
946325187 2:218981416-218981438 TAGAAGAAAAAAAGTGAAAGAGG + Exonic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946474735 2:219996322-219996344 TAGGAGGTGAAAAATGAAGGTGG - Intergenic
946882304 2:224188605-224188627 AAGAAGAGGGAATATGAGGGGGG + Intergenic
947206031 2:227661971-227661993 TAATGGAAGAAAAAAGAGGGTGG - Intergenic
947240238 2:227986644-227986666 TAGAATAAGAAATTAGAGGGAGG + Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947387187 2:229602926-229602948 TTGAATAAGAACAATGTGGGAGG + Intronic
947397243 2:229698226-229698248 TAAAAGAAAAAAAATGTGGAAGG + Intronic
947497457 2:230648351-230648373 TCAAAGAAAAAAAAAGAGGGAGG + Intergenic
947662926 2:231883366-231883388 TAGAGGAAGAAAAAGGAAAGAGG - Intergenic
947752231 2:232539117-232539139 AAGAAGAAGAAAAATTAGCCAGG + Intergenic
947921390 2:233877942-233877964 TAGAGTAAGAAAAGGGAGGGGGG - Intergenic
947930578 2:233961598-233961620 GAAAAGAAGAAAAAAGAGGCCGG - Intronic
947960641 2:234233911-234233933 AAGAAGAAGAAAAAGGGAGGGGG - Intergenic
948724537 2:239925242-239925264 AAAAAGAAGAAAAATGTGGGAGG + Intronic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
949085736 2:242153227-242153249 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1168863580 20:1064278-1064300 AAGAGGAAGAAAAAGGAGGGAGG + Intergenic
1168981019 20:2003617-2003639 TAGGAGAAGAAAAAGCAGTGAGG - Intergenic
1169114712 20:3056632-3056654 AAGAAGATAAAAAATTAGGGAGG - Intergenic
1169124005 20:3114134-3114156 TAAAAAAAGAAAAAAGAGAGAGG + Intronic
1169323604 20:4656281-4656303 GAGAAGAAGAGAAATGAAGTGGG - Intergenic
1169618086 20:7472291-7472313 TACAAGAACAAAAATCAGGTGGG - Intergenic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1169799669 20:9502164-9502186 AAGAACAAAAAAAATGAGGGCGG - Intergenic
1169852330 20:10065708-10065730 AAAAAGAAGAAAAAAGAGAGGGG + Intergenic
1170067485 20:12329286-12329308 AAGAAGAAGAAAGATAAGGATGG - Intergenic
1170127024 20:12975231-12975253 TAGAAGGAGGAAACTGAGGAGGG - Intergenic
1170922729 20:20694143-20694165 TAAAAAAAAAAAAGTGAGGGAGG + Intronic
1171077466 20:22143106-22143128 AAGAAGAGGAAAAGTGAAGGAGG - Intergenic
1171498407 20:25574348-25574370 TAGAAAAAAAAAAAAGACGGTGG - Intronic
1171562282 20:26136444-26136466 TGGGAGGAGGAAAATGAGGGAGG + Intergenic
1172174489 20:32963871-32963893 TAGAAGTAGAAAAAAGGAGGAGG - Intergenic
1172561739 20:35895011-35895033 AAGAAGAAGAAAAATTAGCTGGG - Intronic
1172928640 20:38564908-38564930 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
1173122521 20:40306832-40306854 TAGAGGATGTAAAATGAGGAGGG + Intergenic
1173135617 20:40436393-40436415 AATAAAAAGAAAAATGAGGCCGG + Intergenic
1173261008 20:41435811-41435833 AAAAAGAAGAAAAAAGTGGGAGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173858323 20:46265775-46265797 AAGAAGAAGAAAAAGGAGAATGG - Intronic
1174158680 20:48534790-48534812 AAGAAGTGGAGAAATGAGGGGGG + Intergenic
1174317243 20:49713015-49713037 TAGAGGAAGAAAGGGGAGGGAGG + Intronic
1174325361 20:49774480-49774502 AAGAAAAAAAAAAATGAGGCTGG + Intergenic
1174571069 20:51501665-51501687 TATAAGAAGAAAAATAAGGCAGG - Intronic
1174612708 20:51811979-51812001 AAGAAGAAGAAAAACAAAGGAGG + Intergenic
1174619527 20:51863519-51863541 AAGAAAAAGAAAAATGGTGGTGG - Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175792614 20:61751157-61751179 TAGAACAAGAAAAAGATGGGAGG + Intronic
1176202342 20:63867248-63867270 TAAAAAAAGACAAATGAGGCTGG - Intronic
1176808763 21:13516438-13516460 TAGAAGGAGGAAAGAGAGGGTGG + Intergenic
1176880781 21:14190608-14190630 TAGATGAAGAGAAATAAGGAAGG + Intronic
1177076232 21:16577133-16577155 TAAAAGAAAAAAAACGGGGGCGG - Intergenic
1177224780 21:18239925-18239947 TAGAAGAGAAAGAAAGAGGGAGG + Intronic
1177531043 21:22358433-22358455 TAGTAGAATAAATATGAGAGTGG + Intergenic
1177689586 21:24488118-24488140 TGGAAGAAGAAAGAGGAGAGTGG + Intergenic
1177809244 21:25907134-25907156 TAGAAGAAGAAGAAGAAGAGCGG - Intronic
1177902020 21:26927997-26928019 GAGATGAGGAAAACTGAGGGAGG + Intronic
1178080629 21:29060382-29060404 TAGAAGAAAAAAATTGGAGGGGG + Intronic
1178455295 21:32744275-32744297 AAGAAAAAAAAAAAGGAGGGGGG + Intronic
1178612213 21:34093960-34093982 AAGAAGCAGAGAAAAGAGGGAGG - Intronic
1178684557 21:34701044-34701066 TAGGAGAAAAAAAATCAGTGAGG + Intronic
1178747215 21:35264720-35264742 AAGAAAAGGAAAATTGAGGGTGG - Intronic
1178835898 21:36097283-36097305 GAGAAGAAAAAAAGTGAAGGAGG - Intergenic
1179116674 21:38499708-38499730 GAGAAGGAGAAAGATAAGGGGGG + Intronic
1179214285 21:39352854-39352876 AAGAAGAATGAAAATGAGTGAGG + Intergenic
1179315996 21:40244981-40245003 TACAGGAAGAAAATCGAGGGAGG + Intronic
1181379707 22:22491769-22491791 TAGTTTAAGAAAAATGAGGCTGG - Intronic
1181496156 22:23288572-23288594 TAGATGAGGAGAAATGGGGGAGG - Intronic
1181581089 22:23828491-23828513 TAGAAGTAGAAAAATTAGCCAGG + Intronic
1182022459 22:27092156-27092178 GAGAAGAAGAAAAAAGAAAGAGG + Intergenic
1182137820 22:27922282-27922304 TAAAAGAAAAAAAAAGAGGTTGG - Intergenic
1182175600 22:28284039-28284061 TGGAGGAAGAATATTGAGGGTGG - Intronic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182263153 22:29090652-29090674 TTGAAGAAAAAAAATAAGGGAGG + Intronic
1182286326 22:29250349-29250371 GAGAAGAAGAAAAAGGCAGGAGG - Intronic
1182489627 22:30662666-30662688 AAAAAGAAAAAAAATGAGGCGGG + Exonic
1182505053 22:30776090-30776112 AAGAAAAAGAAAAATGAGTCTGG - Intronic
1182694068 22:32184859-32184881 AAAAAGAAAAAAAAAGAGGGGGG - Intergenic
1183031165 22:35106253-35106275 TAAAACAAGAATAATGAGGAAGG - Intergenic
1183680408 22:39325420-39325442 AAGAAGAAGAAAGAAGAAGGAGG + Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1183901307 22:41008081-41008103 TGGAAGAAGAAAATAGAGTGGGG - Intergenic
1184379406 22:44135735-44135757 TAGAGGAGGAGACATGAGGGAGG - Intronic
1184627813 22:45751225-45751247 TAAAAGAAGAACAAAGAGGCTGG - Intronic
1184719723 22:46304148-46304170 AAGAAAAAAAAAAATGAGCGGGG - Intronic
1185046018 22:48529134-48529156 TAGAGGCAGAAAAATCAAGGTGG + Intronic
1185113144 22:48914198-48914220 TAACAGTAGAAAAATGAGTGAGG - Intergenic
1185156229 22:49195100-49195122 TAGAACAAGCAAGGTGAGGGAGG - Intergenic
949168770 3:972768-972790 TAGAAAAAGACAGATGAGAGAGG - Intergenic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950269122 3:11599296-11599318 CAATAAAAGAAAAATGAGGGGGG + Intronic
950322285 3:12067895-12067917 TACAAAAAGAAAAATTAGGCAGG + Intronic
950618248 3:14179572-14179594 TCTATGAAGAAAAATGAGGCAGG - Intronic
950733651 3:14986477-14986499 AAGAAGGAGAAAATTGAGGAAGG + Intronic
950960888 3:17105790-17105812 TAGAAGAGCAAAAATAAGGATGG + Intergenic
951186266 3:19717041-19717063 GAAAAGAAGATAAAAGAGGGAGG - Intergenic
951305551 3:21056519-21056541 AAGAAAATGAAAAATGAGGAGGG + Intergenic
951386231 3:22045971-22045993 GGGAAGAAAAATAATGAGGGAGG + Intronic
951673042 3:25205902-25205924 TAGAAGAAAAAAAATTAGCTGGG - Intronic
951974354 3:28487828-28487850 TAGGTGAAGAAAAAAAAGGGGGG - Intronic
952004671 3:28829387-28829409 TAGAAGGAGAAAAATGATATGGG + Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952134726 3:30404591-30404613 TAGCACAAGAAAAATGAGTAAGG + Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952439478 3:33311357-33311379 GAGAAAAAGAAAAGTGGGGGCGG - Intronic
953113929 3:39972755-39972777 TAGAAGAAAAAAATTGAAAGGGG - Intronic
953374650 3:42418578-42418600 AAAAATAAGAAAAAGGAGGGAGG + Intergenic
954044864 3:47920859-47920881 AAGAAGTAGAAAAATGTGGCTGG + Intronic
954167775 3:48774127-48774149 TAAAAGAAAAAAAATTAGGCCGG - Intronic
954373730 3:50183586-50183608 TAGAAGAAGAGAAAGGGGAGAGG - Intronic
954505095 3:51062548-51062570 TATAAAAAGAAAAATCAGAGTGG - Intronic
954529395 3:51304914-51304936 TAAAAGAAGTAAAATCAGAGGGG - Intronic
954725298 3:52603516-52603538 GAGAAGAAGAAAAAAGAGGTTGG - Exonic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955307465 3:57848608-57848630 AAGAAGAAGAAAAAGAAGAGGGG - Intronic
955529203 3:59855311-59855333 GACAAGAAGATAAATGGGGGAGG - Intronic
955883722 3:63575345-63575367 TGGAAGAAGAAAAATCTGGAAGG - Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956102096 3:65779168-65779190 GTGAAGAAAAAAAATGAGTGAGG - Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956223625 3:66931687-66931709 TAAAAGAAGAAAAAGGAAGAAGG - Intergenic
956534178 3:70257067-70257089 TAGACCATGAAAAATGAGAGAGG + Intergenic
956648250 3:71478501-71478523 TAAAAAAAGAAGAATGAGAGTGG + Intronic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957309721 3:78504446-78504468 TAGAAGGAAAAAAATGAGGGAGG + Intergenic
957344500 3:78944509-78944531 TAGAAGAAAATAAATGTGGAGGG + Intronic
957589517 3:82177554-82177576 TGGTAGAAGAAATAGGAGGGGGG - Intergenic
957764623 3:84606833-84606855 TAGAAGAATAAAAAGGAATGGGG + Intergenic
957883191 3:86248601-86248623 CAGAAGAAAAAAAAAAAGGGGGG + Intergenic
958510678 3:95043755-95043777 GAGAAGGAGAAAAAAAAGGGGGG - Intergenic
958657363 3:97019233-97019255 TAAAAGAAGATAAATGTGGGCGG - Intronic
958786284 3:98599721-98599743 TACAATAAGAAAAAGAAGGGAGG - Intergenic
959445651 3:106435687-106435709 AAGAAGAAAAGAAAAGAGGGAGG + Intergenic
959502754 3:107125267-107125289 AAGGAGAAGAAAAAAAAGGGGGG + Intergenic
959745573 3:109772743-109772765 TAGAAAAAGAAAAATTAGACTGG + Intergenic
959871813 3:111337389-111337411 AAGAGGAAGACAAAAGAGGGAGG + Intronic
959929817 3:111967709-111967731 TGGAAGAAGAAAAACGACGCCGG + Exonic
960018915 3:112926961-112926983 TAGAAGAAGAAGTATGTGGAGGG + Intronic
960280971 3:115781136-115781158 AAGAAGGAGAAAAATGAAAGCGG + Intergenic
960363448 3:116742266-116742288 GAGAAGAAAAAAAAAAAGGGGGG + Intronic
960394240 3:117116999-117117021 TCAAAGAAGACAAATGAGGATGG - Intronic
960408601 3:117293142-117293164 GGGAGGGAGAAAAATGAGGGAGG + Intergenic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
960559806 3:119071770-119071792 TTGAAAAAGAAAAATGAAGTGGG - Intronic
960680169 3:120239391-120239413 AAGAAGAAGAAGAAGAAGGGAGG - Intronic
961143774 3:124577211-124577233 TGGAAAAAAAAAAAAGAGGGTGG + Intronic
961529274 3:127530228-127530250 GAAAGGAAGAAAGATGAGGGTGG + Intergenic
961918941 3:130405730-130405752 TGGAAGAGAGAAAATGAGGGAGG - Intronic
962162858 3:133017966-133017988 TACATTAAGAAAAATTAGGGAGG + Intergenic
962842815 3:139251344-139251366 GAGAGGAGGAAAAAGGAGGGAGG - Intronic
962852369 3:139317577-139317599 CAAAAGAATAAAAATAAGGGTGG + Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963108324 3:141665190-141665212 TTAAAGAAGAAAAAAGAGGCTGG + Intergenic
963895235 3:150678742-150678764 TAAAAGAAGAAAAATGAGACTGG + Intronic
964496157 3:157292685-157292707 TAAAAAAAGAAAAAAGAGGCCGG + Intronic
964525398 3:157611415-157611437 CAAAAGAGGAAAAAGGAGGGAGG + Intronic
964558164 3:157963959-157963981 TAGCAGAAAAAAAAAAAGGGGGG + Intergenic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
964842350 3:161007885-161007907 TAGAAGTAGAAAGATGAGTCAGG + Intronic
965134672 3:164747362-164747384 TTGAATATGAAAAATGAGGCAGG + Intergenic
965252550 3:166361311-166361333 TAGAAAAAGAAAACTAAGTGAGG + Intergenic
965329444 3:167352244-167352266 TAGATTAAGAAAAATGAGAGAGG + Intronic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
965935624 3:174106862-174106884 TAGAAGAAAAAAAAGGAGAAAGG - Intronic
966010007 3:175063636-175063658 TAGAAGTAAAAAAATTAGTGGGG - Intronic
966159065 3:176949074-176949096 TAGAAGAAGAGAAAGGAGTTTGG - Intergenic
966331377 3:178818603-178818625 TAAAAAAAGAGAAATGATGGAGG - Intronic
966351714 3:179038415-179038437 TAAAAAAAGAAAAATGAGGCAGG + Intronic
966392430 3:179466480-179466502 TGGCAGAAGAACAAGGAGGGAGG - Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966666135 3:182472993-182473015 TAGAAGAAGAAGACTGAAGAGGG - Intergenic
966759766 3:183407547-183407569 AAGAAGCAGAAGAAAGAGGGAGG - Intronic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967410412 3:189161251-189161273 TAGCAAAAGAAAAATGAGAGAGG - Intronic
967423651 3:189301565-189301587 CAGAAGAAGAAAAAAAATGGAGG - Intronic
967607326 3:191462984-191463006 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
967767234 3:193294331-193294353 TAGATCAAGAAAATAGAGGGAGG - Intronic
968184267 3:196621213-196621235 TAGAAAAAAAAAAATTAGCGGGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968758789 4:2430775-2430797 TAAAAGAAAAAAAATGAGCCAGG + Intronic
969464337 4:7346100-7346122 TAGAAAAAGAAAAATAAGCCTGG - Intronic
969557631 4:7923759-7923781 TAGAAGAAGAGAAACCAGGCCGG - Intronic
969680902 4:8642853-8642875 GACAAGAAGGAAAATGTGGGTGG - Intergenic
969832257 4:9807287-9807309 TAGAAGAAATAAAATGAGCAGGG - Intronic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
969998969 4:11344695-11344717 TATAGGAAGAAAAATGGGGTTGG - Intergenic
970027992 4:11644360-11644382 AAGAAGGAGAAAAAGGAGAGGGG - Intergenic
970142846 4:13001293-13001315 TAGGAGAAGAAAAATGACCTAGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970421159 4:15906586-15906608 TAAAAAAAGAAAAAAGAGGATGG - Intergenic
970547812 4:17147666-17147688 TAGAGGTAGCAAAATGAAGGTGG + Intergenic
970694673 4:18663537-18663559 TAGAAGGAGAAAAATGGGCCAGG + Intergenic
970752027 4:19375483-19375505 TAAAAGAAGAGACATGAGGTAGG - Intergenic
970867245 4:20773288-20773310 TAGGAGAAGGCAAAGGAGGGTGG - Intronic
970940022 4:21620987-21621009 TATAAGAAGAAAAAGTAGGAAGG - Intronic
970950756 4:21752579-21752601 TAGAGGAAGAAAAAAAAGGGAGG + Intronic
970968202 4:21951185-21951207 TAGAGTGAGAAAACTGAGGGAGG - Intergenic
971063821 4:23004497-23004519 TAGAAAATGAAAAATGATGCAGG - Intergenic
971134428 4:23852571-23852593 TGGAGGTAGAAAAATGGGGGAGG - Intronic
971415279 4:26421264-26421286 TAAAAAAAGAAAAATGGGTGTGG - Intronic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971562780 4:28102514-28102536 AAGAAGAAAAATATTGAGGGTGG + Intergenic
971586760 4:28414509-28414531 AAGAAGAAGAAAGAAGGGGGAGG - Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
971866683 4:32181360-32181382 TAGAAAAAAAAAAGGGAGGGGGG - Intergenic
971875892 4:32308035-32308057 TAAAAGAGGAAAAATGGTGGTGG + Intergenic
972501172 4:39679393-39679415 TAGAACTAAAAAAATGAGGCCGG - Intergenic
972539752 4:40029077-40029099 TAAAAGTACAAAAATGTGGGAGG + Intergenic
972541238 4:40041295-40041317 CAGAAGAAAAAAATTGAGGCTGG + Intergenic
972796094 4:42421189-42421211 TAGATGAAGAAAAAGGTGGAGGG + Intronic
972888556 4:43525005-43525027 AAGAGGAAGAAACATTAGGGAGG - Intergenic
973087355 4:46082314-46082336 GAGAAGAAGAGAAATAAGGGAGG - Intronic
973254837 4:48099625-48099647 CTGAAAAAGAATAATGAGGGAGG + Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973671404 4:53222150-53222172 TAGAAAAACAAAGGTGAGGGTGG - Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974964592 4:68745714-68745736 TATAAGATGTAAAATGGGGGTGG + Intergenic
975028214 4:69578510-69578532 GAGAAGAAGAAGAAAGAAGGAGG - Intergenic
975067758 4:70089358-70089380 TGGAAGGAAAAAAAAGAGGGAGG + Intergenic
975119926 4:70717220-70717242 TAGAAAAAGATAAATGAAGGGGG - Intronic
975391308 4:73821002-73821024 TAGAAGATGAAAAATGAGTTGGG + Intergenic
975445461 4:74459041-74459063 TCGAAGAAAAAAAATGAAGAAGG - Intergenic
975471260 4:74771164-74771186 TAGAAAAAGAAAGAAGAGGAGGG + Intronic
975662956 4:76705603-76705625 AAGTAGAAGAAATATGTGGGTGG + Intronic
975771991 4:77735375-77735397 AAGATGAAGAAAACTGAGGCTGG + Intronic
976324823 4:83759246-83759268 GAGAAGAAGAAAACAGAGAGAGG + Intergenic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
977320389 4:95507522-95507544 TAGAGGAAGAAAAATCAGAGAGG - Intronic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978625171 4:110677190-110677212 TAGCAGTAGAAAAATATGGGTGG - Intergenic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
978765734 4:112403165-112403187 CAGAAGGAGAAAAATGAAAGAGG - Intronic
978851597 4:113343808-113343830 AACAAGAAGAAAAATGAGCTTGG - Intronic
978936622 4:114385258-114385280 GAGAGAAAGAAAAATAAGGGAGG + Intergenic
979019563 4:115479010-115479032 TATAGGAAGAAGAACGAGGGAGG + Intergenic
979237437 4:118418128-118418150 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
979580761 4:122356741-122356763 AAGAAAAAGAAAAAGGTGGGTGG + Exonic
979618312 4:122769520-122769542 TAGAATCACAAAGATGAGGGAGG - Intergenic
979672332 4:123373119-123373141 AAGAAAAAGAGAAAGGAGGGAGG + Intergenic
979681617 4:123466401-123466423 TGGAGGGAGAAAAATGGGGGTGG + Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
979954516 4:126935399-126935421 AAGAAGAAGAAAAAAGAAAGAGG + Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980415297 4:132480506-132480528 AAGAAGAAGAAAAAAAAGGTGGG + Intergenic
980425672 4:132624654-132624676 AAGAAGAAGGAAAAAGAAGGAGG - Intergenic
980471677 4:133261417-133261439 TAGAAAAAAAAAAAATAGGGTGG - Intergenic
980579823 4:134734737-134734759 TATAAGAAGAAATATAAGAGAGG - Intergenic
980581595 4:134761583-134761605 TAGGAGAAGAAAAAAGTGGGAGG + Intergenic
980597860 4:134978407-134978429 TTGAAGAAGGAAAATAAAGGTGG - Intergenic
981132174 4:141169229-141169251 AGGAAGAAGAAAAAAGGGGGCGG - Intronic
982027091 4:151261683-151261705 TAGCAGAAGAAATATGAAAGAGG - Intronic
982170846 4:152660379-152660401 CAAAAGAAGTAAAGTGAGGGGGG - Intronic
982213552 4:153060493-153060515 TAGTAGAAAAATAATGAGGCCGG + Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982634654 4:157879115-157879137 TGGAAAAAAAAAAAAGAGGGGGG - Intergenic
983298416 4:165895726-165895748 TAAAAGAAGAAAAAGGTGGGAGG + Intronic
983641994 4:169951809-169951831 TAAAAAAAAAAAAAAGAGGGGGG - Intergenic
983782848 4:171694379-171694401 AAGAAAAAGAAATATCAGGGAGG - Intergenic
984048738 4:174836996-174837018 TAGAAGAATAAAAATATGGCTGG + Intronic
984227519 4:177052877-177052899 AAGAATAATAAAAAAGAGGGAGG + Intergenic
984403146 4:179292767-179292789 GAGCAGAGGAAAACTGAGGGAGG - Intergenic
984403153 4:179292813-179292835 GAGCAGAGGAAAACTGAGGGAGG - Intergenic
984436470 4:179716815-179716837 TAGATAAAGAAGAGTGAGGGAGG + Intergenic
984619701 4:181938371-181938393 TAAAATAAGAAAATTGAAGGAGG - Intergenic
984620954 4:181951222-181951244 TGGAAGAAAAAAAATGTGTGTGG - Intergenic
985004773 4:185523617-185523639 TAAAAGAAAAAAAAAGGGGGGGG - Intronic
985967418 5:3348184-3348206 TAGCAGAAGTATAAGGAGGGAGG - Intergenic
986009681 5:3700900-3700922 GAAAAGAAGAAGAAGGAGGGAGG - Intergenic
986277981 5:6297367-6297389 TAGAAGAAGAAGGCTGAGGTGGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
987679314 5:21115368-21115390 TAGAAGAAAAAAAGTGGGAGGGG - Intergenic
987785409 5:22492641-22492663 TAGAAAATGAAAAATCAGGCTGG - Intronic
988053181 5:26056644-26056666 TAGAAGAAAAACAATGCTGGTGG + Intergenic
988053885 5:26066802-26066824 TAGAGGAAAAGAAATGATGGGGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988174006 5:27696798-27696820 GAGAGGGAGAAAAAGGAGGGAGG + Intergenic
988216597 5:28282654-28282676 TAAAAGAAAAAAAAACAGGGTGG - Intergenic
988368542 5:30335438-30335460 TATAAGAAGAAAAGTGGGGATGG + Intergenic
988792703 5:34623319-34623341 TATAAGAAGAGACATGAGGCCGG + Intergenic
989272558 5:39550128-39550150 TAAAAGCAGAAACATGAAGGAGG - Intergenic
989278068 5:39611336-39611358 AAGAAAAAGAAAAAAGAGAGAGG - Intergenic
989429746 5:41338939-41338961 TAAAAGAACCAGAATGAGGGCGG - Intronic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
989756220 5:44958785-44958807 GAGAAGAAGGAAAAAGAAGGAGG - Intergenic
990034605 5:51304473-51304495 AATAAGAATAGAAATGAGGGAGG + Intergenic
990070369 5:51775664-51775686 CAGAAGATGAAAAATGGGAGAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990173254 5:53078917-53078939 GAGAAGAAAAAAAATGAGTCTGG + Intronic
990286297 5:54303718-54303740 AAAAAGAAGAAAAAGGAGAGGGG + Intronic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990935442 5:61142876-61142898 AGAAAGAAGAAAAAAGAGGGAGG - Intronic
990977171 5:61570269-61570291 AAGAAGAAAGAAAATGATGGGGG + Intergenic
991268040 5:64745926-64745948 TAGAAGAAAAAAAAAGGTGGAGG + Intronic
991272138 5:64796764-64796786 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991272151 5:64796808-64796830 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991292002 5:65042228-65042250 AGGAAGAAGAAAAATGCTGGAGG - Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
992073230 5:73167872-73167894 TAGAAGTATTAAAGTGAGGGAGG + Intergenic
992112595 5:73510072-73510094 GAGAAGGAGGAAAGTGAGGGAGG + Intergenic
992149032 5:73883159-73883181 CAGAAGAAGAAAAAAGGGGTGGG - Intronic
992304603 5:75423197-75423219 TAGAAGGACAAAAGTGATGGTGG - Intronic
992423514 5:76631105-76631127 TAGAACCAGAAAAATGAAAGAGG - Intronic
992753545 5:79883187-79883209 TAAAAAAAGAAAAATGAAGGGGG + Intergenic
992768910 5:80028867-80028889 TAAAATAAGAAAAAACAGGGAGG - Intronic
992773150 5:80068145-80068167 TGGAAGAGGAAAAATGATAGAGG - Intronic
992787539 5:80184368-80184390 TGGAGGAAGAAAAAAGAGGTAGG - Intronic
992930943 5:81644431-81644453 CAGAAAAGGAAAAATGAGAGAGG + Intronic
992990195 5:82275977-82275999 TAGGATAAAAAAAATAAGGGGGG + Exonic
993064761 5:83083816-83083838 TAGAGGAAGAAAGATAAGGAAGG - Intronic
993235540 5:85303880-85303902 GAAAAGGAGAAAAATGAGTGTGG - Intergenic
993820764 5:92613510-92613532 TAGAATAAAAAGAATGAGTGGGG + Intergenic
993978175 5:94508522-94508544 TAGAATATGAAAAAAAAGGGGGG + Intronic
994205430 5:97029785-97029807 GGAAAGAAGAAAAATGAGGGAGG + Exonic
994464544 5:100109974-100109996 AAGAAGGAGAAAAATAATGGAGG - Intergenic
994474677 5:100251507-100251529 TAGAAGGAAAAAACTGTGGGAGG - Intergenic
994862272 5:105212653-105212675 TAGAAGAAAAAATGTGGGGGAGG - Intergenic
994913680 5:105945620-105945642 AAGAAGAAGAAAGAAGAGGGAGG + Intergenic
995245086 5:109926011-109926033 TGGAAGAATAAAAAAGAGGGAGG - Intergenic
995690571 5:114821921-114821943 AAGTAGAAAAAAAAAGAGGGAGG - Intergenic
995756913 5:115515291-115515313 CAGAAGAATAAACATGAGTGGGG - Intergenic
995968143 5:117934687-117934709 TTCCAGAAGAAAAATGAGAGAGG + Intergenic
996066061 5:119080530-119080552 TTGTATAAGAAAAATGTGGGAGG - Intronic
996282793 5:121751675-121751697 TTGCAGAAGAAAAAGGAGAGAGG + Intergenic
996334831 5:122371949-122371971 TTAAAGAAGAAAAATGTGTGAGG + Intronic
996336061 5:122385381-122385403 TTGAAGCAGAAAAATGATAGAGG - Intronic
996452322 5:123639641-123639663 AAGAAGAAGAGAAAGGAGAGAGG - Intergenic
996849594 5:127937448-127937470 TATAAGAAGAGATATGAGAGAGG + Intergenic
996877622 5:128256976-128256998 TAGAAGATAAAAAATGATGAGGG - Intergenic
997023890 5:130035161-130035183 AAGAAGCAGAAAGATGAGGTAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
997464604 5:134078963-134078985 AAGAAAAAAAAAAAGGAGGGGGG - Intergenic
998700084 5:144688309-144688331 CAGAAGAAGAAAGAAGAGGTAGG - Intergenic
999762510 5:154713311-154713333 TAGAAGAGGAAAGCTGAGAGTGG - Intronic
999874013 5:155782319-155782341 AAGAAAAATAAAAATGAGGCCGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
999994063 5:157075152-157075174 TAGAAGCAGAAACATCAGTGTGG + Intergenic
1000453334 5:161418257-161418279 CAGAAGAAGAATAATGACTGAGG - Intronic
1000797413 5:165682335-165682357 TAAAAAAAGAAAAATGAGGGGGG + Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001031664 5:168267684-168267706 TAAAATAATAAAAATGAGGTTGG - Intergenic
1001100647 5:168811008-168811030 TAGGAGAAGAACAATGTGGCTGG - Intronic
1001164060 5:169347481-169347503 TAAAAGATGAACAATGAGGTTGG - Intergenic
1001316712 5:170647328-170647350 AAGAAGAAGAAAAAAGTTGGAGG + Intronic
1001747156 5:174100614-174100636 TGGAAAAAGAAAAGGGAGGGAGG - Intronic
1002029455 5:176416931-176416953 AAGAAGAGGAAAATTGAGGCTGG + Intergenic
1002327309 5:178418330-178418352 TAGGGCAAGAAAACTGAGGGTGG - Intronic
1002708988 5:181182853-181182875 TAGAAGAATAAAAATCAGCCAGG + Intergenic
1002737875 5:181410095-181410117 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1002760532 6:198365-198387 TAGACAAAGAGAAATAAGGGTGG + Intergenic
1003142234 6:3481232-3481254 TAGAAGAAAAAAAAACAGTGGGG - Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1005116975 6:22349652-22349674 TAGAAGCAGAAAAATGTGTCTGG - Intergenic
1005417094 6:25611589-25611611 GAGAAAAAGAAAAGTGAGGAAGG + Intronic
1005511046 6:26511744-26511766 TAAAAGAAAAAAAATGGGGTGGG - Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1005826728 6:29636498-29636520 AAAAAAAAGAAAAGTGAGGGTGG - Intergenic
1005972334 6:30771082-30771104 TAGAAGCAGAGAGATGAGGTAGG - Intergenic
1006277587 6:33018046-33018068 GTAAAGAAGAAAGATGAGGGTGG - Intergenic
1007126389 6:39429285-39429307 TAGAATAAGAGACTTGAGGGTGG - Intronic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1008109853 6:47479868-47479890 TAGAAAAGGAAAGATGATGGGGG - Intronic
1008367849 6:50703774-50703796 TAGAGGAAGAAGAAAGAGGGAGG - Intergenic
1008584797 6:52938734-52938756 GAGAAGAAGAAGAATGAATGGGG + Intergenic
1009059731 6:58384512-58384534 TAGAGGAAGAAAAATGAAGCAGG + Intergenic
1009231180 6:61062882-61062904 TAAAGGAAGAAAAATGAAGCAGG - Intergenic
1009451671 6:63808302-63808324 ATGAAGAAGAAAAGTGAGAGTGG + Intronic
1009694207 6:67077789-67077811 TAGAAAATGAAAAATGAGATTGG + Intergenic
1009738077 6:67705045-67705067 AGGAAAAAAAAAAATGAGGGGGG + Intergenic
1009831206 6:68938150-68938172 AAGAACAAGAAAAATCAGTGAGG + Intronic
1009855033 6:69251200-69251222 TGGAAGAAGACTAATAAGGGAGG - Intronic
1009948994 6:70373754-70373776 TATATGAAGCAAAATGAAGGTGG - Intergenic
1010504604 6:76641750-76641772 TACTAGAAGAAAAAAGGGGGAGG + Intergenic
1010744911 6:79549673-79549695 TAAAATAACAAAAATCAGGGAGG + Intergenic
1010804573 6:80219881-80219903 TAAAAGAATAAGAATCAGGGTGG - Intronic
1010846518 6:80715831-80715853 TAGATGAGAAAAAATGATGGAGG + Intergenic
1010863754 6:80946829-80946851 TTGAAGTAGATAAATGAGGAAGG - Intergenic
1010933685 6:81834956-81834978 TAAAGGAAGAAGAATGAGGGAGG + Intergenic
1011085624 6:83537432-83537454 GAGAAAAAGAAAAGGGAGGGAGG - Intergenic
1011417115 6:87133470-87133492 TATAAGAGGAAATATCAGGGTGG - Intergenic
1011556837 6:88578653-88578675 TTGAAGAAGAAAAATAAAGTTGG - Intergenic
1011656531 6:89557016-89557038 GGGAAGAAGAGAAATGGGGGAGG + Intronic
1011982237 6:93394437-93394459 TAGATTAACAAAAATGTGGGAGG + Intronic
1012011532 6:93792796-93792818 TAGAAGAAGAAGAAGCAGTGTGG + Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012105425 6:95151432-95151454 TCAAAGACTAAAAATGAGGGTGG - Intergenic
1012330965 6:97986600-97986622 AGGAAGAACAAAAATGAGGGTGG + Intergenic
1012546018 6:100420387-100420409 AAGAAGAAGAAAATTAAGAGGGG - Intronic
1012623427 6:101377128-101377150 TAGAAGAAGGAAACTGAAGGAGG + Intergenic
1012752182 6:103177972-103177994 TAGAAATAGAACAATGAGTGGGG + Intergenic
1013128988 6:107213462-107213484 TAAAAAAAGAAAAAGAAGGGTGG + Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013788514 6:113809877-113809899 TAGAGGAAGAAAAAAGGGGAAGG - Intergenic
1014072015 6:117193232-117193254 GAGAAAAAGCAAAATGAGGTGGG - Intergenic
1014207597 6:118672993-118673015 ATGATGAAGAAAGATGAGGGAGG + Intronic
1014378734 6:120712490-120712512 TGGAAGAAAAAAAAAGAGAGAGG + Intergenic
1014623154 6:123694335-123694357 TAGAAGAAAAAAAATCAGCAAGG + Intergenic
1015132815 6:129833036-129833058 TTGAAAAAGAAAAATGATGCAGG + Intronic
1015141067 6:129932385-129932407 GAGAAAAAGAAAGAGGAGGGAGG + Intergenic
1015194519 6:130510595-130510617 TAGAAAAAGCAACATTAGGGTGG + Intergenic
1015278941 6:131411684-131411706 AAGAAGGAGAAAAATGAGACTGG + Intergenic
1015590608 6:134819331-134819353 GAGATGAAGAAAAATGAGGGGGG - Intergenic
1015755270 6:136599983-136600005 TGGAAGAAGAAAAAGTAGAGAGG + Intronic
1015882484 6:137882861-137882883 TAGAAGAAAAAAAAAAAAGGAGG + Exonic
1015898576 6:138040664-138040686 TAGAATAAGACAAATTAGGCTGG - Intergenic
1015969194 6:138727497-138727519 TGGAAAAAGAAAAATGAGGCAGG + Intergenic
1015999797 6:139030421-139030443 AAGATGAAGAACAATGAAGGGGG - Intronic
1016404338 6:143714721-143714743 GAGAAGAAAAGAAATGAAGGGGG - Intronic
1017048587 6:150369945-150369967 TGGAAGTAGAGAATTGAGGGCGG + Intronic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017548929 6:155483111-155483133 TAGAAGCAGATAATTGAGTGGGG - Intergenic
1017575314 6:155795804-155795826 TAGAAGAAGAGAAGTGGGGATGG - Intergenic
1017645220 6:156533967-156533989 TATAAGAAGAGAAACCAGGGTGG - Intergenic
1017799214 6:157877265-157877287 TAAAAGAAAAAAAAAGCGGGGGG + Intronic
1018255746 6:161917096-161917118 AAGAAAAAGAAAAATTAGGCTGG - Intronic
1018657914 6:166057601-166057623 TAGAAGCAGAAAAAGGAAGAGGG + Intergenic
1018676414 6:166226223-166226245 TATAAGAAGACAAAGAAGGGAGG + Intergenic
1019242974 6:170685653-170685675 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1019535285 7:1526144-1526166 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1019535309 7:1526231-1526253 GAGAAGAAGAAGAAGAAGGGGGG + Intergenic
1020053195 7:5097001-5097023 TGGAAGTAGAATAATGAGGCGGG - Intergenic
1020401256 7:7780206-7780228 TTGAAGAAGAGAGATGGGGGTGG - Intronic
1020428603 7:8096319-8096341 TAGAAAAAAAAAAAAGAGGCTGG - Intergenic
1021052102 7:15999543-15999565 GAAAAGAAGAAAAATGAGAGGGG + Intergenic
1021226445 7:18033581-18033603 TAAAATAAAAAGAATGAGGGTGG - Intergenic
1021336453 7:19408501-19408523 TCAAAGAAGAGAGATGAGGGAGG - Intergenic
1021729312 7:23581147-23581169 TCGAAAAAAAAAAAAGAGGGAGG - Intergenic
1022353767 7:29591055-29591077 TTGAAAAAGAAAAATGAAGCTGG - Intergenic
1022642681 7:32203210-32203232 AAGAAGAAGAAATATGTGGGAGG - Intronic
1022812763 7:33885764-33885786 TGGAGGAAGAAATAGGAGGGAGG + Intergenic
1022867859 7:34441143-34441165 TTAAATAAGAAAAATAAGGGGGG + Intergenic
1023080416 7:36521324-36521346 AAGAAGAAGAAAAAGAAGTGGGG - Intronic
1023095309 7:36654308-36654330 AAGAAGAAGAAAAAGGAGAGAGG - Intronic
1023219137 7:37900465-37900487 TACAACAAGATAATTGAGGGAGG + Intronic
1023565022 7:41515616-41515638 GAGAGGAAGAAAAATGATGTAGG + Intergenic
1023581618 7:41690131-41690153 AAGAAGAAGAAAGAAGAGGAGGG - Exonic
1023615168 7:42012378-42012400 GAGAAGAAGAAAAGGGAGGGGGG - Intronic
1023824848 7:44002145-44002167 TAGAAGCACAAAAATGAGCTGGG + Intronic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024836834 7:53530525-53530547 TAGAAGCAGCAAATTGTGGGGGG - Intergenic
1024999547 7:55303655-55303677 AAGAAGAAGAAAGAAGAAGGAGG + Intergenic
1025011922 7:55404304-55404326 TAAAAGAAGAAGAAAGAAGGAGG - Intronic
1025057917 7:55779961-55779983 AAGAAGATGAAAAATGAGGCTGG - Intergenic
1025266026 7:57457638-57457660 TAAAAGAAAAAAAATGTGGCTGG - Intronic
1026078927 7:67199922-67199944 GAGAAGAAGAGAAGAGAGGGAGG + Intronic
1026088397 7:67280919-67280941 TAGAAGCACAAAAATGAGCTGGG + Intergenic
1026147530 7:67760309-67760331 AAGAAGAGGGAAAGTGAGGGAGG - Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026350342 7:69510075-69510097 GAGAAGGATAAAAAGGAGGGAGG + Intergenic
1026373800 7:69729423-69729445 TAAAAGTATAAAAATGGGGGGGG - Intronic
1026697893 7:72612017-72612039 GAGAAGAAGAGAAGAGAGGGAGG - Intronic
1026849702 7:73717184-73717206 GAGAAGGAGAAAGAAGAGGGAGG + Intronic
1026857256 7:73762918-73762940 GAGAAAAAGAAAGATGGGGGAGG - Intergenic
1027117999 7:75496224-75496246 TAGAAGCACAAAAATGAGCTGGG + Intergenic
1027186543 7:75974821-75974843 TAAAAAAAGAAAAAAGAGGCTGG - Intronic
1027273806 7:76539236-76539258 TAGAAGCACAAAAATGAGCTGGG - Intergenic
1027327253 7:77058290-77058312 TAGAAGCACAAAAATGAGCTGGG - Intergenic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027651824 7:80878079-80878101 TAGAATAAAAAAAATGAGGCCGG + Intronic
1027693865 7:81383870-81383892 TATAAGAAGAAAAATCAGGCAGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1027762546 7:82298355-82298377 TAGAAGAAGAAAGAAGACAGTGG - Intronic
1027869365 7:83687214-83687236 TGCAAGAAGAAAAATAAGGAAGG + Intergenic
1028021226 7:85776418-85776440 TAGAAGTAGAGCAAAGAGGGTGG - Intergenic
1028170577 7:87590869-87590891 TAGAAGAGCAAAAAGGAAGGAGG + Intronic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028268981 7:88763565-88763587 AAAAAAAAGAAAAATGAGAGAGG + Intronic
1028478614 7:91279441-91279463 TAGAAGAATATAAAGGATGGTGG - Intergenic
1028509653 7:91610175-91610197 CAGGAGAGGAAAAAGGAGGGGGG + Intergenic
1028712759 7:93928645-93928667 TAGAATTAGAAAAATCAGGCCGG + Intergenic
1028880573 7:95875267-95875289 AAGAAAAAGAAAAAAAAGGGAGG + Intronic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029262242 7:99310915-99310937 TAGAGGAATGAAAATGAGTGGGG + Intergenic
1029286979 7:99472561-99472583 TAAAAGAAGAAAAATGGGCCAGG - Intergenic
1029294085 7:99525642-99525664 TTCAAGCAGAAAAGTGAGGGAGG - Intronic
1029294460 7:99528727-99528749 TTGATCCAGAAAAATGAGGGAGG - Intronic
1029719504 7:102353822-102353844 TAGAAGCACAAAAATGAGCTGGG - Intergenic
1029753111 7:102555450-102555472 TAGAAGCACAAAAATGAGCTGGG + Intronic
1029771062 7:102654533-102654555 TAGAAGCACAAAAATGAGCTGGG + Intronic
1030421077 7:109306995-109307017 TGGAAGAAGAAAAAGGAAGTTGG - Intergenic
1030447180 7:109661078-109661100 AAGAAGTAGAAAACAGAGGGAGG + Intergenic
1030987601 7:116260976-116260998 TAGAAGATGGAAACTCAGGGTGG + Intergenic
1031083947 7:117283864-117283886 CAGAAGATGGAAAATGAGAGAGG + Intronic
1031295746 7:120001134-120001156 TTGAAGATGAAAAATAAAGGTGG - Intergenic
1031454690 7:121964661-121964683 TAAAAGAAGAAAAATGAAGCAGG + Intronic
1031482749 7:122299118-122299140 GAGAAGGAGAAAAGAGAGGGAGG - Intergenic
1031590566 7:123586658-123586680 TACTAGAAGAAAAATGGGGTTGG - Intronic
1031632089 7:124055472-124055494 TAGAAGAAGAGAAAGGATTGGGG + Intergenic
1031803887 7:126283676-126283698 TAGAAGAAAGGAAATGAAGGGGG - Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031956741 7:127950209-127950231 TAGAGGAAAAAAAAAGGGGGAGG - Intronic
1033078194 7:138269177-138269199 GAGAAGAATAAAAATGGGGCTGG + Intergenic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1033652106 7:143351534-143351556 TGGAAAAAGAAAAAAGACGGGGG - Intronic
1033674827 7:143530467-143530489 AAGAAGAAGAAACATATGGGAGG + Intergenic
1033697009 7:143798973-143798995 AAGAAGAAGAAACATATGGGAGG - Intergenic
1033830758 7:145249615-145249637 TAGAAGAAAAAAAATGAGACTGG + Intergenic
1033840910 7:145371931-145371953 AAGAAGAAGAAAAATAAGGTGGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033924898 7:146445729-146445751 TAGAGCAAGATGAATGAGGGAGG + Intronic
1034077988 7:148250785-148250807 TATAATAAGTAAAATGAGGCCGG - Intronic
1034584623 7:152078176-152078198 TAGAAGGAGAAGAGGGAGGGGGG + Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035419659 7:158717113-158717135 GAGAAGAAGGAAAAAGAAGGAGG - Intergenic
1035505147 8:122509-122531 CAGAAGGAGAAAAGTGAGTGAGG - Intergenic
1036048065 8:5166113-5166135 GAGAGGAAAAAAAATGATGGAGG + Intergenic
1036156418 8:6346414-6346436 AAAAAGAAAGAAAATGAGGGCGG + Intergenic
1036335815 8:7869032-7869054 AAGAAGGAGGAAAAGGAGGGAGG + Intergenic
1036988488 8:13565183-13565205 TAGAAGGAGATATATGTGGGTGG - Intergenic
1037151248 8:15637828-15637850 GAGAGGAAGAAATAGGAGGGAGG - Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037304365 8:17489848-17489870 AAGAAGAAGAAAAATAGGAGAGG - Intergenic
1037476494 8:19262875-19262897 TAGAAGATGCAGAATGAAGGAGG - Intergenic
1037660562 8:20922907-20922929 CAAAAGAAGAAAAAGGATGGAGG - Intergenic
1037699100 8:21256228-21256250 AAGAAGAACAAGAATGAGTGAGG - Intergenic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1038681196 8:29670116-29670138 TAGAAGAACAGAAATGTGGCAGG + Intergenic
1038835653 8:31119165-31119187 AAGAAGAAAAGAAAGGAGGGAGG - Intronic
1039390854 8:37179863-37179885 GAGAAGAAGAAAGAAGAGGGAGG - Intergenic
1039439045 8:37581863-37581885 TGGGAAAAGAAAAATAAGGGGGG - Intergenic
1039970157 8:42315386-42315408 TAGATGAAGAGAAAGGAGGAAGG + Intronic
1040413003 8:47173357-47173379 AAGAAGAAGAAAAAAAAGGTGGG + Intergenic
1041061551 8:54039706-54039728 TAGAAAAAGAACATGGAGGGGGG - Intergenic
1041260615 8:56018123-56018145 TAGAAAAATAAAAATAAGGCCGG - Intergenic
1041763351 8:61391408-61391430 AAGAAAAGGAAAAATGAGGTGGG + Intronic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1042138850 8:65659212-65659234 TAGTAGTAGAAAAATAAGAGTGG - Intronic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042593650 8:70422986-70423008 TAAAAGAAAAATAATGAGTGGGG - Intergenic
1042748301 8:72131537-72131559 AAGGAGAAGAAAAAGGAAGGAGG - Intergenic
1042836937 8:73087515-73087537 TTGAAGAAAAAAAACGAGCGGGG - Intronic
1042889335 8:73589969-73589991 GGGAAGAAGAAAGAGGAGGGAGG + Intronic
1043009357 8:74862308-74862330 AAGAAGAAGAAAAAAGAAAGGGG + Intergenic
1043086172 8:75836170-75836192 TAGTAGAAGAAGACTGAGGGAGG - Intergenic
1043211056 8:77518505-77518527 TTGAAGAATGAAAATGAGAGAGG + Intergenic
1044044370 8:87412791-87412813 AAGAAGAGGAGAAAAGAGGGAGG + Intronic
1044464461 8:92487442-92487464 TCAAAGATGAAAAATGAGGAGGG + Intergenic
1044950683 8:97432895-97432917 TAGAAGCAGGAAAATGAGTTAGG + Intergenic
1044993482 8:97817290-97817312 TACAAAAAGAAAAATTAGGTGGG - Intronic
1045042920 8:98244200-98244222 GACAAAAAAAAAAATGAGGGGGG + Intronic
1045402301 8:101831524-101831546 TAGAAGTATAAAAATGGGGAGGG - Intronic
1045490198 8:102662433-102662455 AAAAAGAAGAGAACTGAGGGTGG + Intergenic
1045527533 8:102954093-102954115 TAAAAAAAAAAAAATGAGGCTGG - Intronic
1045669956 8:104539779-104539801 AAGATAAAAAAAAATGAGGGAGG + Intronic
1045906319 8:107349404-107349426 TAGCAGAAGAAATTTCAGGGAGG + Intronic
1045947758 8:107815745-107815767 AAGAAGGAGAGAAATGAGAGAGG + Intergenic
1045974179 8:108112788-108112810 TGGAAGGAGTACAATGAGGGAGG - Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046399080 8:113679943-113679965 TGGAAGAAGAAAACTTTGGGAGG + Intergenic
1046415842 8:113912212-113912234 TAGAAGAATAAAAAGGGTGGAGG + Intergenic
1046574103 8:116003916-116003938 TAAAACAAGAAACAGGAGGGAGG + Intergenic
1046739589 8:117814028-117814050 AAGAAGAAGAAAGAAGAAGGAGG + Intronic
1047284459 8:123475074-123475096 TATAAAAAAATAAATGAGGGAGG - Intergenic
1047372491 8:124267520-124267542 TAGAAAAAGGAAAATGAAGGTGG - Intergenic
1047433994 8:124819314-124819336 TATAAGAGGTAGAATGAGGGAGG - Intergenic
1047680010 8:127245024-127245046 TAGAAAAAAAAAAAGGAGAGGGG + Intergenic
1047690932 8:127353903-127353925 AAGAAGAAGAAAGAAGAAGGAGG + Intergenic
1047780522 8:128107102-128107124 AAGAAGAAGAAAAAAAAGGGGGG + Intergenic
1047873433 8:129109952-129109974 CAGAAGAATGAAAATGAGAGGGG - Intergenic
1048284451 8:133130916-133130938 TGGAGGAAGAAAGAGGAGGGGGG + Intronic
1048430863 8:134369282-134369304 AAGAAGAAGAAGAAGAAGGGAGG - Intergenic
1048457189 8:134588999-134589021 TAGAAGAAGAAAAGTGTGTGTGG + Intronic
1049004570 8:139846516-139846538 AATAAGAAGAAAAATGAAGATGG + Intronic
1050004568 9:1116644-1116666 AAAATGAAGAAAAATGAAGGAGG - Intergenic
1050102305 9:2131682-2131704 TAGAAAAAACAAAATGAGGCCGG + Intronic
1050132791 9:2429937-2429959 CAGTAGAAGAAAAATGATCGTGG - Intergenic
1050193511 9:3055487-3055509 TAGAATAAGATAAAGAAGGGAGG + Intergenic
1050290362 9:4148165-4148187 TATAATAAGAAAAAGGGGGGAGG - Intronic
1050313841 9:4380964-4380986 AATTAGAAGAAAAATGTGGGAGG + Intergenic
1050315680 9:4398525-4398547 TGGAAGAAGAAAGAAGAAGGAGG - Intergenic
1050406428 9:5313806-5313828 TAGAAGAAAATAACTAAGGGAGG + Intergenic
1050408051 9:5330661-5330683 AAGAAGAAGAAGAATTAGAGAGG + Intergenic
1050475916 9:6040964-6040986 AAGAAGAAGAAAGAAGAAGGAGG - Intergenic
1050702652 9:8358269-8358291 AAGAAAAAAAAAAATGATGGGGG - Intronic
1050763290 9:9100462-9100484 TAGAAGAAGAAATGTGGGGGTGG - Intronic
1051009726 9:12396690-12396712 TAAAAGAAGAGAAAAGCGGGAGG + Intergenic
1051028610 9:12646668-12646690 TAGAAAAAGGAATTTGAGGGAGG + Intergenic
1051124138 9:13785200-13785222 TAAAAAAAAAAAAATTAGGGGGG - Intergenic
1051133093 9:13884510-13884532 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051454545 9:17239906-17239928 TAGAAAAAGAAAAAATATGGAGG - Intronic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1051783547 9:20717178-20717200 TACAAAGAGAAAAATGAGGAAGG + Intronic
1052088946 9:24303263-24303285 CAGAAGGAGAAAAATGAGAAAGG - Intergenic
1052099422 9:24426382-24426404 TAGAATATGAAAAAGGAGAGAGG - Intergenic
1052520462 9:29541487-29541509 GAGAAGGAGAAAAGGGAGGGAGG - Intergenic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1053279257 9:36806866-36806888 TAGAAAAAAAAAATTGATGGAGG + Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1055131660 9:72782413-72782435 TTGAATAAGAATAGTGAGGGTGG - Intronic
1055253417 9:74336395-74336417 TACAAGAAGAAAACTGATTGTGG + Intergenic
1055770404 9:79710743-79710765 TAGAAGAGGAAAGAATAGGGAGG - Intronic
1055863212 9:80779971-80779993 AAAAAGAAGAAAAATGTGGGAGG - Intergenic
1056206254 9:84322238-84322260 TAGAAGAAGAAGAAAAAGAGAGG + Intronic
1056545145 9:87606777-87606799 GGGAAGGAGAAAAAGGAGGGAGG - Intronic
1056558472 9:87709460-87709482 TAGTAGAAGAAAGGTGAGGGAGG + Intergenic
1056772520 9:89490022-89490044 TAAAAAAAAAAAAAGGAGGGTGG - Intronic
1056832869 9:89930903-89930925 GAGAAGAAGGGACATGAGGGAGG + Intergenic
1056906169 9:90649897-90649919 TTGAAAAAAAAAATTGAGGGAGG + Intergenic
1057005620 9:91555985-91556007 TATAATAAGAAAAATTATGGGGG + Intergenic
1057258452 9:93569354-93569376 AAGTAGAATAAAACTGAGGGAGG - Intergenic
1057395811 9:94679019-94679041 TGGGAAAACAAAAATGAGGGAGG + Intergenic
1058150409 9:101457465-101457487 TAAATTAAGAAAAATGAGAGAGG - Intergenic
1058170572 9:101675991-101676013 TAAGACAAGAAAAATCAGGGGGG - Intronic
1058250737 9:102692589-102692611 CAGAAGATGAAAAATGATGAAGG + Intergenic
1058293867 9:103280197-103280219 GAGAAAAAAAAAAAAGAGGGAGG + Intergenic
1058425450 9:104871682-104871704 GAGAGGCAGAAAAATGAGAGAGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058628881 9:106965394-106965416 TAGAAGAAGAAACACCAGGTAGG + Intronic
1058882370 9:109296877-109296899 AAAAAAAAAAAAAATGAGGGAGG + Intronic
1058938006 9:109786816-109786838 TAGAAAAAGCTAAGTGAGGGGGG + Intronic
1059115774 9:111599251-111599273 TAGAAGAAGAAAGATCGGGGTGG - Intronic
1059510948 9:114846172-114846194 GATAAGAAGAAAAGTAAGGGGGG + Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1060116070 9:120941921-120941943 TAAAAGAAGAAAAATTAGCTGGG + Intergenic
1060446166 9:123690104-123690126 GGGAGGAAGAAAAAGGAGGGAGG + Intronic
1060709677 9:125846638-125846660 TAGAAGGAGAAAGCTGATGGAGG - Intronic
1060760382 9:126242460-126242482 TAAAAAAAGAAGAATGAAGGGGG - Intergenic
1060921740 9:127425133-127425155 TAGAAGGAGAAAAGTGACAGAGG - Intronic
1061365231 9:130169181-130169203 TGAAAGAAGAAAAATGAGGCGGG - Intergenic
1061389450 9:130309540-130309562 AAAAAAAAGAAAAATGATGGCGG + Intronic
1061426811 9:130504395-130504417 TAAAAGATGAAAAATAATGGTGG + Intergenic
1061563013 9:131418562-131418584 AAGAAGAAGACAAATCAGGCTGG - Intronic
1203441209 Un_GL000219v1:10297-10319 AGGAGCAAGAAAAATGAGGGAGG + Intergenic
1203512018 Un_KI270741v1:129205-129227 AGGAGCAAGAAAAATGAGGGAGG + Intergenic
1203603163 Un_KI270748v1:34877-34899 CAGAAGGAGAAAAGTGAGTGAGG + Intergenic
1185501747 X:602075-602097 GAGAAGAAGAAAAAGGAAGGAGG - Intergenic
1185610931 X:1393110-1393132 AAGACGGAGAAAAAGGAGGGAGG - Intergenic
1185610959 X:1393287-1393309 AAGAGGGAGAAAAAAGAGGGAGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185668080 X:1784027-1784049 CAAAAGAAGAAAAGTGAGGAAGG + Intergenic
1185773526 X:2784104-2784126 TAGCAGGAGAAAAAGGTGGGTGG - Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1186066587 X:5772685-5772707 TACAAAAAGAAAAAAGAAGGAGG - Intergenic
1186094193 X:6082211-6082233 TTGAAAAAGACAAATGAGGTAGG + Intronic
1186291138 X:8100241-8100263 GAGAAGAGAGAAAATGAGGGAGG + Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186322374 X:8443021-8443043 TTGAAGAAGAAAAATGATTATGG - Intergenic
1186393383 X:9183201-9183223 GTGAAGGAGAAAAATGGGGGTGG - Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1186854613 X:13613893-13613915 TTGAAGAAAAAAAATGGGGATGG - Intronic
1186906017 X:14111276-14111298 TGGAAGATGAAAAATGATAGAGG - Intergenic
1186989021 X:15047723-15047745 TATCAGAAGAAATAAGAGGGGGG + Intergenic
1187097705 X:16164934-16164956 AAGAAGAAAAGAAAAGAGGGAGG - Intergenic
1187671463 X:21670074-21670096 TTGAAGAAGAAGAATGTTGGAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187909415 X:24097062-24097084 TTGAAGAAGGTAAATGAGAGGGG + Intergenic
1188033208 X:25287805-25287827 AAGAAGAAGGAAAAAGAGAGGGG - Intergenic
1188058865 X:25575777-25575799 TAGTAGAAGAAAACTGAGAATGG + Intergenic
1188710242 X:33387888-33387910 TGTAAGAAAAAAAAGGAGGGAGG + Intergenic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1188980183 X:36720428-36720450 GAGAAGAAGAAGAAGAAGGGAGG + Intergenic
1188992651 X:36841528-36841550 AAAAAGAAGAAGAATGAGAGTGG - Intergenic
1189058542 X:37727180-37727202 TGGAAGAAGAGAAATGAGGCAGG + Intronic
1189081534 X:37977966-37977988 TAGAAGAAGAAAACGGAGTGTGG + Intronic
1189173057 X:38927667-38927689 TGGAACAAGAAAAATTAGGAGGG - Intergenic
1189197089 X:39161989-39162011 CAGAGGAAGAAAAATGAAGTTGG - Intergenic
1189345086 X:40234740-40234762 AAAAAAAAGAAAAATGAGGCAGG - Intergenic
1189486598 X:41437988-41438010 TAGAAAAACAAAAATTAGGCTGG + Intergenic
1189565536 X:42237400-42237422 TAGAAAAAAAAAAGTGGGGGTGG + Intergenic
1189670643 X:43404785-43404807 TAGAAGAACAAACAGGAAGGAGG - Intergenic
1189802487 X:44704761-44704783 AAGAAGAAGAAAAATTAGCTGGG + Intergenic
1189898399 X:45680762-45680784 AAGAAGGAGAAAAATTAGAGTGG - Intergenic
1189927013 X:45966096-45966118 TTGACTAAGAAAAATGAGAGTGG - Intergenic
1190312979 X:49130267-49130289 CAAAAGAATAAAAAAGAGGGAGG + Intergenic
1190341768 X:49302670-49302692 AAGAAGAAGAAAAATTAGCTGGG - Intergenic
1190369672 X:49728393-49728415 TTGAAGAAGAATGATGAGAGTGG + Intergenic
1190668053 X:52713495-52713517 AAGAAGAAGAATAAGGTGGGAGG - Intergenic
1190671364 X:52744909-52744931 AAGAAGAAGAATAAGGTGGGAGG + Intergenic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1190718797 X:53129383-53129405 AAGAAGAAGAAAAATCAGGCTGG - Intergenic
1190801527 X:53793880-53793902 TAGACGAAGAAAAACAAAGGAGG - Intergenic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191593673 X:62917805-62917827 TAGAAGAAGAAAAAGAAAAGGGG + Intergenic
1192036146 X:67565031-67565053 TAGATGAAGGAAAATGGCGGTGG - Intronic
1192272040 X:69589904-69589926 AAGAAGAAGAAAGAAGAAGGAGG - Intergenic
1192295566 X:69844081-69844103 TTGAAGAAGAAAAAAGGGGGTGG + Intronic
1192379164 X:70597330-70597352 AAAAAGAAGAACAATGAGGGGGG + Intronic
1192499066 X:71636825-71636847 TAGTAGAAGAGAAAGCAGGGGGG + Intergenic
1192630637 X:72775512-72775534 TAAAAGAAGAATAGTGAGGGGGG + Intergenic
1192651073 X:72945292-72945314 TAAAAGAAGAATAGTGAGGGGGG - Intergenic
1192678724 X:73228986-73229008 AAAAAGAAGAAAAATGATGGAGG - Intergenic
1193232262 X:79061918-79061940 TACAAGAAGAAAAATGTTTGGGG - Intergenic
1193542288 X:82787341-82787363 TAGAAGAAGAGAGATGGTGGAGG - Intergenic
1193568375 X:83108762-83108784 TAGAACAAGACAAAGGAGGAGGG - Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194113733 X:89871139-89871161 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1194193411 X:90864786-90864808 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1194676205 X:96796726-96796748 GAGAAGAATAAAAAAGATGGGGG - Intronic
1194769346 X:97882140-97882162 TGGAAGAGGTAAAATGAGGATGG - Intergenic
1194847735 X:98832531-98832553 AACAAGAAGAAAAAGGAGGAAGG - Intergenic
1195268541 X:103208184-103208206 TTGAATAAGAGAAATGAGAGGGG + Intergenic
1195412064 X:104578211-104578233 GAGAAGCAAAAAGATGAGGGTGG + Intronic
1195426442 X:104737808-104737830 TAGAAGAGCAAAAATGAGGCTGG - Intronic
1195433496 X:104815826-104815848 AAAAAAAAAAAAAATGAGGGGGG - Intronic
1195868830 X:109464284-109464306 TAGAGAAAGAAAAAGGAGTGAGG - Intronic
1196149326 X:112355167-112355189 TAGAAGTAGAGAAAGGAGAGGGG - Intergenic
1196364303 X:114906565-114906587 TAAAGGAAGAAAAAGGAAGGGGG - Intronic
1196534542 X:116827408-116827430 GAGAAAGAGAGAAATGAGGGAGG + Intergenic
1196600301 X:117594050-117594072 GAGAAAAAGAACAAAGAGGGAGG + Intergenic
1196640825 X:118058295-118058317 AAGAGAAATAAAAATGAGGGGGG - Intronic
1196661655 X:118276992-118277014 AAGAAGAAGAAAAATAATGTGGG - Intergenic
1196733643 X:118965490-118965512 TAGAAGAAGAAAAGGGGGAGTGG - Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1197176498 X:123491767-123491789 AAGAAGAAGAAAAATGGGAGTGG + Intergenic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197607201 X:128597951-128597973 TAGAAGAAGGAAGAGCAGGGTGG - Intergenic
1197905429 X:131419861-131419883 TTGAAGAAGAAAAATAATGAAGG + Intergenic
1198059702 X:133032941-133032963 TAGAAGAACAGAAAGGAAGGTGG - Intronic
1198381769 X:136090805-136090827 TTGAAGAAGAACAATAAGGTGGG + Intergenic
1198385037 X:136120749-136120771 TTGAAAAAGAAAAATGAAGTTGG - Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198810783 X:140534179-140534201 TGGAAGAAGAGGAAGGAGGGAGG + Intergenic
1198811161 X:140537717-140537739 TAGAAGAATAGAGATGAGTGAGG - Intergenic
1198976114 X:142338109-142338131 TAAAATACGAAAACTGAGGGAGG + Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1199751569 X:150824226-150824248 AAGAAGAAGAAAGAAGAAGGAGG + Intronic
1199782566 X:151076142-151076164 TACAAGAAGAAAAATTAAGTTGG - Intergenic
1199975135 X:152890320-152890342 ATGATGAAGAAAACTGAGGGAGG + Intergenic
1200466411 Y:3526177-3526199 GAGAAGAAGAAAAATTAGGCAGG - Intergenic
1200540022 Y:4447173-4447195 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1200738837 Y:6831310-6831332 AAGAAAAAGAAAGAAGAGGGAGG - Intergenic
1201069230 Y:10129245-10129267 AAGAAGAAGAAAAATGGGCCAGG + Intergenic
1201541060 Y:15105448-15105470 AAGAAGAAGAAAGAAGAGGAGGG - Intergenic
1201558238 Y:15287484-15287506 CAGAAGAAGAGAAATGGGAGGGG - Intergenic
1202171951 Y:22059313-22059335 TAGAGAAAGAAAAATTAGGTGGG - Intergenic
1202219411 Y:22527059-22527081 TAGAGAAAGAAAAATTAGGTGGG + Intergenic
1202323767 Y:23669022-23669044 TAGAGAAAGAAAAATTAGGTGGG - Intergenic
1202547004 Y:26001032-26001054 TAGAGAAAGAAAAATTAGGTGGG + Intergenic