ID: 1118840332

View in Genome Browser
Species Human (GRCh38)
Location 14:69505104-69505126
Sequence CACAGCACAGGGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 1, 2: 9, 3: 95, 4: 779}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118840319_1118840332 28 Left 1118840319 14:69505053-69505075 CCAGGAAATTAGGACAGCGGAGA 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG 0: 1
1: 1
2: 9
3: 95
4: 779
1118840323_1118840332 -10 Left 1118840323 14:69505091-69505113 CCTCCCTTAATGCCACAGCACAG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG 0: 1
1: 1
2: 9
3: 95
4: 779
1118840322_1118840332 4 Left 1118840322 14:69505077-69505099 CCACTGCACACAGGCCTCCCTTA 0: 1
1: 0
2: 1
3: 33
4: 385
Right 1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG 0: 1
1: 1
2: 9
3: 95
4: 779
1118840321_1118840332 5 Left 1118840321 14:69505076-69505098 CCCACTGCACACAGGCCTCCCTT 0: 1
1: 0
2: 2
3: 46
4: 309
Right 1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG 0: 1
1: 1
2: 9
3: 95
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118840332 Original CRISPR CACAGCACAGGGAAGGAGGG AGG Intronic
900146818 1:1162201-1162223 CACAGCTGGGGGAATGAGGGAGG - Intergenic
900315110 1:2052435-2052457 AAAACAACAGGGAAGGAGGGAGG - Intronic
900397243 1:2458136-2458158 GACAGCACAGGGAAGGTGGCCGG + Intronic
900402807 1:2479509-2479531 CACAGGAAAGGGAAAGGGGGAGG + Intronic
900458595 1:2789537-2789559 CAGAGCGCAGGGCCGGAGGGAGG - Exonic
900623260 1:3596850-3596872 TAGAGCAGAGGGAAGGTGGGAGG + Intronic
900767149 1:4513186-4513208 CCCTGCAGAGGGGAGGAGGGTGG + Intergenic
900827379 1:4937659-4937681 AACAGCAGAGGGAAGGAAGGAGG + Intergenic
900831135 1:4966446-4966468 CCCTGTACAGGGTAGGAGGGTGG + Intergenic
900860196 1:5223398-5223420 CAGGACACAGGGAGGGAGGGAGG + Intergenic
901193213 1:7424948-7424970 CCCTGCATAGGGAGGGAGGGAGG + Intronic
901470596 1:9453861-9453883 CACAGCCCAGAGATGGAGGAGGG + Intergenic
901519057 1:9768878-9768900 AACAGAAGAGGGAGGGAGGGAGG + Intronic
901670971 1:10856263-10856285 GACAGGACAGGGGAGGGGGGCGG + Intergenic
902078652 1:13806235-13806257 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902078664 1:13806268-13806290 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902137918 1:14326674-14326696 CCAAGCACAGGGAAGGATGCAGG - Intergenic
902183138 1:14704827-14704849 CACAACACAGGGAAGGAGCCAGG - Intronic
902590315 1:17469334-17469356 TACAGGACAGGGAAGGAAGCTGG + Intergenic
902873919 1:19329845-19329867 GATATCACAGGGAAAGAGGGAGG + Intergenic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903122945 1:21228068-21228090 CTCAGCACAGGGCGGGAGGCAGG + Intronic
904277710 1:29395058-29395080 CATCTCACAGGGAAGGTGGGAGG - Intergenic
904290891 1:29485349-29485371 AAGAGCTCAGGGGAGGAGGGGGG - Intergenic
904400735 1:30254806-30254828 GAAAGCACAGGGACGGAGGCTGG + Intergenic
904482862 1:30805178-30805200 CACAGAGCTGGGAAGGTGGGTGG + Intergenic
904603889 1:31688694-31688716 GGCAGCACAGGGACGGAGGGAGG + Intronic
904910504 1:33930912-33930934 CACAGCACAGACTAGGAGTGGGG - Intronic
905248265 1:36629538-36629560 CACATGGCAGGGAAGGAGGGAGG - Intergenic
905484522 1:38285966-38285988 GACAGCACAGGGGAGGGGAGGGG + Intergenic
905811728 1:40917995-40918017 CATACCCCAGGGAAAGAGGGTGG - Intergenic
905933663 1:41807060-41807082 CAGAGCACAGGAAAGTAGCGGGG - Intronic
906155992 1:43614269-43614291 CAGAGCACAGGGCAGCAGGCAGG - Intronic
906782672 1:48586453-48586475 CACAGGACAGGTGAGGAGGGAGG + Intronic
907913986 1:58852324-58852346 CACAGAAAAGGGAGGGAGGGAGG + Intergenic
909134492 1:71780856-71780878 CTCAGAAGAGGGAAGGTGGGTGG - Intronic
909520973 1:76567035-76567057 ATGAGGACAGGGAAGGAGGGAGG + Intronic
910040910 1:82850714-82850736 CACAGCTCAAGGAAGGAGATAGG + Intergenic
910499953 1:87878913-87878935 CACAGCACAAGACAGGATGGAGG + Intergenic
912115025 1:106395168-106395190 CAGAGCAAAGGGGATGAGGGTGG - Intergenic
912431370 1:109630131-109630153 CACAGCAGAGGGCAGGGGGAGGG - Intronic
913034993 1:114956135-114956157 GACAGCACAAGGAAAGAGGTTGG - Intronic
913170964 1:116231929-116231951 CACAGCATTGGGATGGTGGGGGG - Intergenic
913318444 1:117572704-117572726 CACAGCCCTGCGCAGGAGGGAGG - Intergenic
913336151 1:117710458-117710480 CACTGCACAAAGAAGGAGGTGGG + Intergenic
913348081 1:117828083-117828105 CAAAGCAGAAGAAAGGAGGGAGG + Intergenic
914689102 1:150010185-150010207 CACAGCTCAGGAAGGGAGGCCGG + Intronic
914830878 1:151169959-151169981 CAAAGCCCAAGGAAGGAGGCAGG + Exonic
915310306 1:155003066-155003088 GAAAGCACAGGGAAGGGGAGTGG - Intronic
915342558 1:155184483-155184505 CACAGGACAGGGATGGAGAAGGG - Exonic
915507763 1:156368284-156368306 CACACCACAGGGAAGCAGGCTGG - Intergenic
915820250 1:159015628-159015650 CAGTGCACAGGGGAGGAGTGAGG + Intronic
915985224 1:160457865-160457887 AACAGGAAAGGGAAGGAGGAAGG + Intergenic
917348839 1:174056490-174056512 CACAGGAATGGGAGGGAGGGTGG + Intergenic
919724160 1:200871352-200871374 CAGAGCCCAGGGTAGGAAGGTGG - Intergenic
920209680 1:204319203-204319225 CATAGCACAGGAAAGGACTGTGG - Intronic
920525311 1:206661766-206661788 CAGAGCACAGTGTAGAAGGGTGG + Intronic
920843570 1:209575211-209575233 CACTGCACAGAGAAGGAGCCAGG + Intergenic
922362280 1:224834115-224834137 CACAGGAGGAGGAAGGAGGGAGG - Intergenic
922553760 1:226517606-226517628 GACTCCACAGGGAAGGTGGGGGG - Intergenic
922809877 1:228409415-228409437 CAAAAGACAGGGACGGAGGGTGG + Intronic
922875932 1:228939965-228939987 CAGAGGACAGGGAAGGAAAGAGG + Intergenic
923507683 1:234620394-234620416 AACAGCAAATGGAAGCAGGGTGG + Intergenic
924052826 1:240093788-240093810 CAGAGCCCAGGGAGGGCGGGTGG - Intronic
1062817849 10:514197-514219 CAAAGCCCAAGGAAGGGGGGTGG - Intronic
1062913999 10:1233595-1233617 CACAGCCCAGGGCAGGGGCGCGG - Intronic
1063115518 10:3068911-3068933 CACTGCACAGGGTTGGAGCGGGG + Intronic
1063368016 10:5502963-5502985 CACAGAAGAGGGAAGTGGGGGGG + Intergenic
1063917828 10:10902757-10902779 TAAAGCTCAGGAAAGGAGGGAGG + Intergenic
1064285161 10:13985338-13985360 CATGGGACAGGGAAGGAGGCTGG + Intronic
1064435313 10:15305937-15305959 CTCAACACAGGCGAGGAGGGTGG + Intronic
1064463270 10:15555465-15555487 CTGCGGACAGGGAAGGAGGGAGG + Intronic
1064607768 10:17061643-17061665 CCCTGCCCTGGGAAGGAGGGAGG + Intronic
1064714185 10:18159030-18159052 GACAAAACAGGGAGGGAGGGAGG - Intronic
1065129867 10:22609841-22609863 GATGGCAGAGGGAAGGAGGGTGG - Intronic
1065152006 10:22831546-22831568 CCCAGCACAAGGAGGGATGGGGG + Intergenic
1065221638 10:23502035-23502057 AACTGGAGAGGGAAGGAGGGTGG - Intergenic
1065705315 10:28466855-28466877 GAGAGGACAGGGAAGGAGAGAGG + Intergenic
1066010212 10:31188008-31188030 GCCAGCCCAGGGCAGGAGGGGGG - Intergenic
1066187584 10:33025219-33025241 CACAGGGCAGGGAAGGCGAGAGG - Intergenic
1066670545 10:37833395-37833417 CACAGCACAGGGAACCAGAGTGG + Intronic
1067165702 10:43864854-43864876 CACACCACAGGGAAGTGAGGAGG + Intergenic
1067415377 10:46098122-46098144 CACCTCCCAGGGAAGGAGGCAGG + Intergenic
1067435418 10:46273199-46273221 CACCTCCCAGGGAAGGAGGCAGG + Intergenic
1067497490 10:46773688-46773710 CAGAGCCCAGGGGAGGATGGGGG - Intergenic
1067582216 10:47452889-47452911 CACCTCCCAGGGAAGGAGGCAGG + Intergenic
1069088907 10:64175718-64175740 CACAGTGTAGGGAAGGAGGTGGG - Intergenic
1069661444 10:70126212-70126234 CTCAGCACAGGCCAGGAGGAGGG - Intronic
1069911140 10:71760666-71760688 CAGAGCAGATGGAAGGAGAGTGG + Intronic
1069935579 10:71913497-71913519 AACAGCACAGAGCAGGAGAGTGG - Intergenic
1070288066 10:75098112-75098134 CTCAGCAGAGGGCAGGAGAGAGG - Intronic
1070581018 10:77719630-77719652 GACAATACAGGGGAGGAGGGAGG - Intergenic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1070804913 10:79265266-79265288 CCCAGCACAGGGAAGCAGGTAGG + Intronic
1071570869 10:86696173-86696195 CGCAGCAGAGGGAGGGAAGGGGG - Intronic
1071573422 10:86710179-86710201 CACAGCTAGGGGACGGAGGGCGG - Intronic
1071745056 10:88407992-88408014 CACACTACTGGGAATGAGGGTGG - Intronic
1072783728 10:98266996-98267018 GACAGAAGAGGGAAGGAAGGTGG + Intronic
1073084095 10:100877316-100877338 CACGGCCCAGGGAAGGCGGGTGG + Intergenic
1073204601 10:101762283-101762305 AGCAGCCCAGGGAGGGAGGGTGG - Intergenic
1073207743 10:101777459-101777481 CACAGAGCAGGGAGGGAGGCAGG - Intronic
1073546096 10:104350381-104350403 AACAACACAGGGGAGCAGGGTGG + Intergenic
1074191911 10:111145574-111145596 CACAGCACATGGACTGAGAGTGG + Intergenic
1074352719 10:112753959-112753981 CACAGCACAGGTCAGGATTGTGG + Intronic
1074866948 10:117550151-117550173 CCCAGAAGGGGGAAGGAGGGAGG - Intergenic
1075120256 10:119659464-119659486 CACCGCAGATGGAAGGAAGGAGG + Intronic
1075257846 10:120939505-120939527 GAGAGCTCAGGGAAGGAGGAAGG - Intergenic
1075543396 10:123335009-123335031 CACAGGACAGGGAATAAAGGTGG - Intergenic
1075574099 10:123565980-123566002 CACAGGACAGTGCTGGAGGGTGG - Intergenic
1075656863 10:124167821-124167843 CAAGGCCCAGGGAAGGAGGGAGG - Intergenic
1075708264 10:124515969-124515991 CACAGGACAGGGAATCAGAGAGG - Intronic
1075879022 10:125834136-125834158 CACAGTGCAGGCAAGGAGGCTGG - Intronic
1076054008 10:127356645-127356667 CACAGCAATGGCATGGAGGGGGG + Intronic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1076315070 10:129534145-129534167 CACAGCAAAGGGACAGAGGGTGG + Intronic
1076535418 10:131173939-131173961 CTCAGGACTGGGAAGGAGGGAGG + Intronic
1076593559 10:131609197-131609219 CACTGCAGATGGAGGGAGGGAGG - Intergenic
1076597592 10:131634925-131634947 GACAGCAGAGGGAGGGAGCGAGG + Intergenic
1076599966 10:131650983-131651005 CCGAGCACAGGGCAGGAGCGGGG + Intergenic
1076618598 10:131772514-131772536 CTCAGCCCTGGGCAGGAGGGAGG + Intergenic
1076781334 10:132726400-132726422 CAGAGCTCAGGAAAGGCGGGAGG - Intronic
1076791442 10:132779012-132779034 CACAGCACAGCCAGGGACGGAGG - Intronic
1076912646 10:133399413-133399435 GTCAGCTCAGGGAAGAAGGGAGG - Intronic
1077028578 11:452695-452717 CTCTGCACAGGGAAGGGAGGAGG - Intronic
1077317035 11:1924217-1924239 TACAGCACAGGGTTGGGGGGTGG - Intronic
1077360221 11:2137516-2137538 CACAGGGCAGTGAAGGGGGGGGG + Intronic
1077470032 11:2753334-2753356 GTCTGCCCAGGGAAGGAGGGAGG + Intronic
1078840572 11:15073118-15073140 CCCACGGCAGGGAAGGAGGGGGG - Intronic
1079043418 11:17079096-17079118 CATAGCTCTAGGAAGGAGGGAGG + Intronic
1079115249 11:17636459-17636481 CACAGAACAGAGTAGGAGAGGGG + Intronic
1080268663 11:30427011-30427033 AACAGGACAGGGGAGGAGGTAGG + Intronic
1080283885 11:30586383-30586405 CACAGCTCCAGGAAGCAGGGCGG + Intronic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1080839183 11:35968601-35968623 GAAAGCACAGGGAAGCAGGGAGG - Intronic
1080932874 11:36831106-36831128 GACAGGAGAGGGAAGGAGGGAGG - Intergenic
1081792369 11:45797280-45797302 CACAGGGCAGGGAAGGAGCCTGG + Intergenic
1081914432 11:46721644-46721666 CAGAACACAGTGCAGGAGGGAGG - Intronic
1082790053 11:57340883-57340905 CTCTGCAAAGGGAAGGAGGCTGG + Intronic
1083163332 11:60868891-60868913 CACAGCACACGGCAGCAGGCAGG - Intronic
1083311363 11:61785544-61785566 AACAGGACTGGGAAGGAGGCAGG + Intronic
1083840687 11:65302444-65302466 CACAGAACAGGGCACAAGGGTGG + Intronic
1084357888 11:68651725-68651747 GACCGCAGAGGGAGGGAGGGAGG + Intergenic
1084491025 11:69478372-69478394 CTCAGCACAGGGGTGGAGGCGGG - Intergenic
1084569176 11:69949272-69949294 CACAGGGCTGGGGAGGAGGGTGG + Intergenic
1084764718 11:71300822-71300844 AATAGCCCAGGGAAGGAGGCAGG + Intergenic
1084792029 11:71481068-71481090 CACAGCACGGGGAAGCAGCAGGG - Intronic
1085270146 11:75265366-75265388 AAAAGCAGAGGGAGGGAGGGAGG - Exonic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085787957 11:79471616-79471638 CAGGGCTCAGGGAAAGAGGGAGG - Intergenic
1085839643 11:79996702-79996724 CCAGGCACAGGGAAGGATGGAGG + Intergenic
1085854564 11:80161634-80161656 CTCACCACAGGGAGGGAGGAGGG - Intergenic
1086537431 11:87865099-87865121 CCAAGAACAGGGAAGGATGGAGG + Intergenic
1088408085 11:109502764-109502786 CACAGGAGAAGGAAGCAGGGTGG + Intergenic
1088620558 11:111678065-111678087 TAAAGAACAGGGAAGGAGGAAGG - Intronic
1088696258 11:112368591-112368613 CAGAGCACAGAGAATCAGGGTGG + Intergenic
1089118863 11:116117859-116117881 AGAAGCACAGGGAAGGAGGAGGG + Intergenic
1089216142 11:116835774-116835796 CTGAGCACCGGGAAGGGGGGCGG + Exonic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089411998 11:118252100-118252122 CATAGCTCTGGGAAGGAAGGAGG - Intronic
1089512907 11:119011773-119011795 GACAGGACTGGGAGGGAGGGAGG + Intronic
1089554713 11:119310054-119310076 GGCAGGCCAGGGAAGGAGGGCGG + Intronic
1090022674 11:123141524-123141546 CACAGCACAAGGAAGGAGGAAGG - Intronic
1090074423 11:123571026-123571048 CACTGCAGAGGGAAGCAGGAAGG + Intronic
1090172983 11:124621306-124621328 CAGCACTCAGGGAAGGAGGGAGG - Intergenic
1090350722 11:126106068-126106090 AACAGCAGAGGGAGGGAGAGTGG - Intergenic
1090731509 11:129576702-129576724 AAGAGCACAGGGTAGGAGGAAGG - Intergenic
1090845671 11:130528041-130528063 CTCAGCCCAGGGAGGGAGTGAGG + Intergenic
1090887629 11:130893149-130893171 CCCACCACAGGAAAGGAGGATGG + Intronic
1091635998 12:2197096-2197118 CACAGCACCTGGAAGGAGGCAGG - Intronic
1091725616 12:2844708-2844730 CACAGCTTAGGCAAGGAGGAGGG - Intronic
1091779102 12:3202685-3202707 CACACCCCAGGCAGGGAGGGGGG - Intronic
1091949409 12:4580544-4580566 CAAAGAACTGGGAGGGAGGGAGG - Intronic
1092075644 12:5671153-5671175 CCCAGCACTGGAAAGGAAGGTGG - Intronic
1092086454 12:5766950-5766972 CACAGCCCAAGGCAGGATGGAGG + Intronic
1092336450 12:7638408-7638430 CCCAGTACAGGGACAGAGGGAGG - Intergenic
1092968249 12:13666354-13666376 CACAGAAGAGAGAGGGAGGGTGG + Intronic
1094452976 12:30601646-30601668 CACTGCACAGGGATGGGGGATGG - Intergenic
1094532369 12:31288654-31288676 CTCAGGGCAGGGAAAGAGGGAGG - Intronic
1095613131 12:44155887-44155909 CACAGCACAGGGCATGAGTTTGG + Intronic
1096042985 12:48536237-48536259 GAGAGCAGAGGGAGGGAGGGAGG + Intergenic
1096807495 12:54149350-54149372 CACAGCTCTGGGAAGGGGGTGGG + Intergenic
1097599818 12:61676774-61676796 CACAGCACCTGGATGAAGGGAGG - Intergenic
1097862418 12:64531701-64531723 CACACCCGAGGGAAGGAGGGAGG - Intergenic
1098150948 12:67545604-67545626 CACACAACACAGAAGGAGGGAGG + Intergenic
1098193671 12:67977138-67977160 CACAGCCAAGGGAAGCAGTGAGG - Intergenic
1098471619 12:70851433-70851455 CACAGCCTAGGGAAGGAGTCTGG + Intronic
1100978161 12:100143087-100143109 ACCAGCAGAGGGAAGGAGGGAGG - Intergenic
1101816679 12:108151074-108151096 GATGGCACAGGGAAGGAGTGAGG - Intronic
1101860615 12:108479458-108479480 CACAGCAGCAGGAAGGAGGGAGG + Intergenic
1101997275 12:109534223-109534245 CACAGCACCGGTGAGGAGGGAGG + Intronic
1102680121 12:114685376-114685398 CACAGCACAGGGTAAGGGGTGGG + Intergenic
1102878975 12:116469734-116469756 AAAAACAGAGGGAAGGAGGGAGG + Intergenic
1102958182 12:117073167-117073189 CCAAGGACAGGGATGGAGGGCGG - Intronic
1103024826 12:117564961-117564983 CCCCGCACTGGGAAGAAGGGAGG - Intronic
1103977735 12:124714592-124714614 TACAGGAGAGGGAGGGAGGGCGG - Intergenic
1104493742 12:129217499-129217521 CACAGGGCAGGGAAGGCTGGAGG - Intronic
1104998783 12:132675295-132675317 CACATCTCATGGGAGGAGGGTGG - Intronic
1105014354 12:132777123-132777145 CACAGCACACTGGAGGAGCGTGG - Intronic
1105473886 13:20714853-20714875 CTTAGCTCATGGAAGGAGGGTGG + Intronic
1105638953 13:22242783-22242805 CACAGCACAGATATTGAGGGAGG + Intergenic
1106244773 13:27939815-27939837 CTCAGCACGGGCCAGGAGGGAGG + Intergenic
1106672628 13:31922897-31922919 CACAGCACAGAGCAGCAGGGAGG - Intergenic
1107358216 13:39591285-39591307 CACAGCATTGGGAATGATGGTGG + Intronic
1107412292 13:40169020-40169042 CACAGCAGTGTGGAGGAGGGTGG + Intergenic
1107431656 13:40345839-40345861 CTCAGCAGAGGCAAGCAGGGAGG + Intergenic
1108355299 13:49624572-49624594 CACAGCTAAGGGAAGGCAGGGGG - Intergenic
1108933082 13:55854803-55854825 CAAAGAAGAGGGAGGGAGGGAGG + Intergenic
1111598935 13:90447107-90447129 CACATCCCAGGGAAGCAGGAGGG - Intergenic
1111948890 13:94694072-94694094 CACAGCAAAGAGAAAGAGAGAGG + Intergenic
1112343177 13:98568952-98568974 CACAGAAAATGGAAGGGGGGAGG + Intronic
1112620637 13:101050715-101050737 CATGGGACATGGAAGGAGGGTGG - Intergenic
1112651989 13:101409478-101409500 CTCAGCACAGGGTAGGACGGTGG - Intronic
1113162234 13:107394852-107394874 CAAGGAACAGGGAAGGAGGAAGG + Intronic
1113485452 13:110649445-110649467 CACAGCACAGGGGAGGGAGATGG + Intronic
1113618804 13:111699351-111699373 TACAGAACAGGGAAGGAAGGTGG - Intergenic
1113624333 13:111784612-111784634 TACAGAACAGGGAAGGAAGGTGG - Intergenic
1113626318 13:111850616-111850638 GGCACCACAGGGCAGGAGGGTGG - Intergenic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114193904 14:20460991-20461013 CACAGCCTAGGGACGGAAGGGGG - Intronic
1114777054 14:25496215-25496237 CACAGCAGACGAAAGGTGGGGGG + Intergenic
1115315762 14:32023301-32023323 CAAAACACTGGGAAGGAAGGAGG + Intergenic
1117061951 14:51972492-51972514 CACAGCACACTGAAGGAGACAGG - Intronic
1117149490 14:52871141-52871163 CACAGAAAATGAAAGGAGGGAGG - Intronic
1117315878 14:54569579-54569601 CACACCCCAGTGAAGGAGGCTGG - Intronic
1118259747 14:64235830-64235852 CACAGGGCAGGGCAGGATGGGGG - Intronic
1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG + Intronic
1118862098 14:69672483-69672505 CAAAGAACAGGGAAGCAGAGAGG + Intronic
1119076245 14:71642345-71642367 CAGAGCACAGAGAATCAGGGAGG + Intronic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1119458927 14:74781816-74781838 CAGAAGACAGGGAAGGTGGGGGG - Exonic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119759002 14:77138591-77138613 CAGAGCAGAGGGAACGTGGGTGG - Intronic
1120033279 14:79667031-79667053 AATAGCACAGGGAAGCAGAGAGG - Intronic
1121322324 14:92999276-92999298 CACAGCACAGAGAGGGTGGCAGG + Intronic
1122101083 14:99410051-99410073 AACAGGACAGGGCAGGAGGGCGG + Intronic
1122109228 14:99484354-99484376 CATAGCACATGGGAGGGGGGTGG - Intronic
1122135878 14:99632691-99632713 TACAGCACAGCGCAGGAGGCAGG - Intergenic
1122501352 14:102202150-102202172 GAGAGCACAGGGAAGCAGGGTGG - Intronic
1122745806 14:103896667-103896689 CACATGACAGGGAAGAAAGGCGG - Intergenic
1122883879 14:104702024-104702046 CACAGGACGGGGAGGAAGGGTGG - Intronic
1123020273 14:105394690-105394712 CACAGCATGGGGCAGGAGGTGGG - Exonic
1123035854 14:105471681-105471703 CACAGCCCAGGGAGGGTGGGTGG - Intergenic
1123586532 15:21765380-21765402 CCCAGCACTGGAAAGGAAGGTGG + Intergenic
1123623171 15:22207945-22207967 CCCAGCACTGGAAAGGAAGGTGG + Intergenic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1124108983 15:26769766-26769788 CACAGAACAGAGAGGGAGGGAGG - Intronic
1124129968 15:26974575-26974597 GACAGCAGAGGGAGGGAGGAAGG + Intronic
1124187265 15:27541738-27541760 CTCTGCGCAGGGGAGGAGGGCGG - Exonic
1124702789 15:31931317-31931339 CACAGCACAGGGAAGGAAACAGG - Intergenic
1125713414 15:41805159-41805181 AACAGCACAGGAAAGGAGGGTGG + Intronic
1125729577 15:41885658-41885680 CACATGACATGGAAGGATGGGGG + Intronic
1125770106 15:42159569-42159591 CACAGCAGAGGGGACGCGGGGGG - Exonic
1125832643 15:42727752-42727774 CACAGCACTGATCAGGAGGGAGG - Exonic
1126664701 15:51065954-51065976 CAAAAGACAGGGAAGGTGGGAGG + Intronic
1127370180 15:58331917-58331939 CACATCACAGGGAATTAGGAGGG - Intronic
1127483202 15:59396067-59396089 CACATCAGAGGGCAGTAGGGAGG + Intronic
1127730847 15:61800765-61800787 CACTGCACAGGCATGGAGAGTGG - Intergenic
1127774473 15:62254419-62254441 CACGGCACTGGGAAGGATGGAGG + Intergenic
1127776890 15:62270645-62270667 CACAGGGCAGGGAGGGAGGTGGG + Intergenic
1128458000 15:67843720-67843742 CCCACCGGAGGGAAGGAGGGAGG + Intergenic
1128619103 15:69133754-69133776 CTGAGGACAGGGAAGGAGTGTGG + Intergenic
1128625723 15:69200985-69201007 CACATGCCAGGGAACGAGGGTGG - Intronic
1128743191 15:70097076-70097098 CGCAGCCCAGGGAAGGCGGCCGG - Exonic
1128978461 15:72169605-72169627 CAGAGCACAGGTGAGCAGGGAGG + Intronic
1129174883 15:73832713-73832735 CACAGACCAGGGAGGCAGGGAGG + Intergenic
1129464440 15:75716033-75716055 CAGAGCACAGGGTGGGAGGGAGG + Intergenic
1129720806 15:77876979-77877001 CAGAGCACAGGGTGGGAGGGAGG - Intergenic
1129753015 15:78079103-78079125 CCCAGGACAGGCAAGGAGGCTGG + Intronic
1129814679 15:78540967-78540989 CACAGAGCAGAGAAGCAGGGAGG - Intronic
1129832747 15:78681426-78681448 TACAGCAGAGGGAGGGATGGAGG - Intronic
1130390106 15:83447588-83447610 CGCAGAGGAGGGAAGGAGGGAGG + Intronic
1130468269 15:84203645-84203667 CACAGAAGAGGGAAGCCGGGGGG + Intergenic
1130584819 15:85172745-85172767 CACAGAGCAGGACAGGAGGGAGG + Intergenic
1130590562 15:85208243-85208265 CACAGAAGAGGGAAGCCGGGGGG + Intergenic
1130661356 15:85833722-85833744 AACAGGAAGGGGAAGGAGGGTGG + Intergenic
1131188046 15:90292309-90292331 CATAGCACTGGGAAGGGTGGAGG - Intronic
1131970727 15:97890263-97890285 CACAGCGGAAGGAAAGAGGGAGG + Intergenic
1132437545 15:101821575-101821597 CACAGGACAAGGAAGAAGTGTGG - Intergenic
1132637996 16:962709-962731 CACAGACCAGGGAGGGAGGGAGG + Intronic
1132850430 16:2022622-2022644 CCCAGCACAGAGCCGGAGGGAGG - Intergenic
1132863114 16:2081225-2081247 CAGAGCCCAGGGACAGAGGGAGG + Intronic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133063555 16:3190456-3190478 CCCAGCACAAGGAGGCAGGGAGG + Intergenic
1133108827 16:3533432-3533454 CACAGAACAGGGAGGGGGGTTGG - Intronic
1133865866 16:9642899-9642921 GCCAGAACAGGGAGGGAGGGAGG + Intergenic
1134044538 16:11091533-11091555 CACTGCACAGGGAAGGGCGCTGG + Intronic
1134090851 16:11390982-11391004 GTCAGCACAGGGAAGGGGGCTGG - Intronic
1134114665 16:11539023-11539045 CTCAGCTCAGGGAGGGAGGGAGG + Intergenic
1134358884 16:13511656-13511678 TACAGTATAGGGAGGGAGGGGGG + Intergenic
1134848318 16:17460051-17460073 CACAACCCAGGGAGGGAGGCAGG + Intronic
1135060608 16:19268360-19268382 CACAGGACATAGAAGGTGGGAGG + Intergenic
1135304292 16:21355217-21355239 CCCAGCACAAGGAAAGGGGGTGG - Intergenic
1136021909 16:27445862-27445884 CAAGCCCCAGGGAAGGAGGGAGG + Intronic
1136265992 16:29118792-29118814 CCCAGCAGAGGGAAGCATGGGGG - Intergenic
1136301035 16:29334347-29334369 CCCAGCACAAGGAAAGGGGGTGG - Intergenic
1136379661 16:29887277-29887299 CCCACCTCAGGGAAGTAGGGAGG - Intronic
1136406906 16:30053384-30053406 AACAGGAAAGGGAAGGAGGGTGG + Intronic
1137442024 16:48505955-48505977 GAGAGCACAGGGAAGGTAGGAGG + Intergenic
1137701352 16:50500297-50500319 GACAACCCAGGGAGGGAGGGTGG + Intergenic
1137731700 16:50694540-50694562 CTCTGCACTGGGTAGGAGGGAGG - Intronic
1138416903 16:56876755-56876777 AACAGCCCAGGGAAGGCTGGGGG + Intronic
1139297113 16:65910610-65910632 CACACCATAGGGAAGGAGCAAGG - Intergenic
1139343542 16:66287668-66287690 CACAGCAGAGGCATGGAGGGAGG - Intergenic
1139516000 16:67452753-67452775 GACTGCACAGGGAGGTAGGGAGG - Intronic
1139590792 16:67931723-67931745 AACAGCCCAGGGAAGGAGCTAGG - Intronic
1139805980 16:69565924-69565946 CACAGCGCAGGCGCGGAGGGGGG - Intronic
1139923063 16:70471558-70471580 CAGAGCAGATGCAAGGAGGGAGG - Intronic
1140145392 16:72301840-72301862 AACAGCACAGGGATGAAGAGGGG - Intergenic
1140221620 16:73048156-73048178 CACCGCCCGGGGAAGGGGGGCGG + Exonic
1140345849 16:74212445-74212467 TACAGCCCAGGGAAGGAGCTTGG + Intergenic
1140909525 16:79438706-79438728 CAGGGCTCAGGGAAGGACGGAGG - Intergenic
1141010182 16:80389602-80389624 CCCTGCTCTGGGAAGGAGGGAGG - Intergenic
1141012076 16:80412275-80412297 CACAGCATAGGCATGGGGGGTGG - Intergenic
1141034849 16:80618144-80618166 CAGAGCACAGGGCAAGATGGCGG - Intronic
1141286346 16:82676010-82676032 CAAAGGACAGGGAAGAAAGGAGG + Intronic
1141431583 16:83973020-83973042 CAAAACCCAGGGAAGGAGGCAGG - Intronic
1141635883 16:85313548-85313570 CACAGCAAAGGGCAGGGAGGGGG - Intergenic
1142054802 16:87986700-87986722 CCCAGCAGAGGGAAGCATGGGGG - Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1142635336 17:1253746-1253768 CCCAGCTCAGGGAAGGGGCGTGG - Intergenic
1142848438 17:2692981-2693003 CCCAGCACAGTGCAGCAGGGGGG + Intronic
1142890450 17:2939681-2939703 CTCAGGGCAGGGATGGAGGGGGG + Intronic
1142967576 17:3590906-3590928 CGCAGCACCGGGAAGCAGGGGGG - Intronic
1142983198 17:3683173-3683195 CACAGCACAGGGCAGGGTTGGGG + Intronic
1143164250 17:4890006-4890028 GAGGGCACAGGGAATGAGGGGGG - Intronic
1143278348 17:5731288-5731310 TCCAGCAGGGGGAAGGAGGGAGG - Intergenic
1143410828 17:6707382-6707404 CACACAGCTGGGAAGGAGGGAGG - Intronic
1143601710 17:7950952-7950974 CCCAGAGCAGGGAGGGAGGGAGG + Intergenic
1143679232 17:8463996-8464018 CACTGGAGAGGGCAGGAGGGTGG - Intronic
1143830883 17:9649527-9649549 AACCGCAGAAGGAAGGAGGGAGG - Intronic
1144621540 17:16821599-16821621 TCCAGCACAGGGGAGGAGCGAGG - Intergenic
1144705225 17:17363625-17363647 GACAACCCAGGGCAGGAGGGAGG + Intergenic
1144773402 17:17771787-17771809 CTCAGCACAGGGATGAAAGGCGG - Intronic
1144884879 17:18451114-18451136 TCCAGCACAGGGGAGGAGCGAGG + Intergenic
1145147346 17:20493263-20493285 TCCAGCACAGGGGAGGAGCGAGG - Intergenic
1146307801 17:31743965-31743987 CACAGCATTGGGAGGGAGGAGGG - Intergenic
1146723192 17:35137603-35137625 CCAAGCACAGGGAAGCAGGTGGG - Exonic
1146762195 17:35488339-35488361 TAATGCACAGGGGAGGAGGGAGG + Intronic
1146920251 17:36705284-36705306 CCCTGCCCAGGGAAGGGGGGTGG - Intergenic
1147251864 17:39157465-39157487 CACCGCACAGGGAACATGGGGGG + Intronic
1147566766 17:41541231-41541253 GGCAGCAGAGGGAAGGAGTGAGG - Intergenic
1147573510 17:41585913-41585935 TCCAGCACAGGGGAGGAGTGAGG - Intronic
1148072753 17:44917635-44917657 CCCAGCACAGAGAGGGAGGTGGG + Intergenic
1148281932 17:46355025-46355047 GACAGAAAAGGGAGGGAGGGAGG + Intronic
1148304157 17:46572964-46572986 GACAGAAAAGGGAGGGAGGGAGG + Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148764120 17:50027568-50027590 CACAGCAGAGGGAAGGGAGAAGG - Intergenic
1149433804 17:56616779-56616801 CAAAGCACAGGGAAGGAGCAAGG - Intergenic
1150144350 17:62755262-62755284 GACAGCAGAGGGCAGGAGAGGGG + Intronic
1150211686 17:63445581-63445603 GACAGGGCAGGGAGGGAGGGAGG + Intronic
1151337173 17:73446843-73446865 CCCAAGACAGAGAAGGAGGGAGG - Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151713165 17:75818184-75818206 CACAGCAGAGGGGAGGAAGGGGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152106889 17:78335437-78335459 CAGAGAAGAGGGCAGGAGGGAGG - Intergenic
1152130453 17:78472998-78473020 CACAGGAAAGGGGTGGAGGGTGG - Intronic
1152218474 17:79048115-79048137 CACAGCGCAGGGGTGGAAGGTGG - Exonic
1152239508 17:79154114-79154136 GACTGGACAGGGAGGGAGGGAGG - Intronic
1152300771 17:79494343-79494365 CACAGCTCGGGGAGGAAGGGTGG - Intronic
1152305933 17:79520165-79520187 CACTCCACAGGGGAGGAGGCGGG - Intergenic
1152425663 17:80217242-80217264 AACAGCACTGGGAGTGAGGGAGG + Intronic
1152445166 17:80338270-80338292 CACCGCACTGAGAAGGAGGTTGG + Intronic
1152507587 17:80760776-80760798 CATAGTAAAGGGAGGGAGGGAGG - Intronic
1152569368 17:81115001-81115023 GACAGCACAGGACAGGATGGGGG - Intronic
1152880472 17:82811932-82811954 CCCAGCCCAGGAAAGGAGCGGGG - Intronic
1203171916 17_GL000205v2_random:156433-156455 CACAGGACAGAGCAAGAGGGAGG - Intergenic
1153033019 18:732686-732708 CACAGTAAAGGGAAGGAGTGGGG + Intronic
1153544806 18:6194616-6194638 CACAGCACATGGAAGGGAGAAGG - Intronic
1154004350 18:10514127-10514149 AACAGCACAGGGAAAGCTGGGGG - Intergenic
1154019246 18:10648132-10648154 CACAGCTCAGGGAAGGGTAGGGG - Intergenic
1154041987 18:10865125-10865147 TACAGCACAGTGAGGGAGTGGGG + Intronic
1154184970 18:12175092-12175114 CACAGCTCAGGGAAGGGTAGGGG + Intergenic
1155130346 18:22928526-22928548 CACAGCCAAGGGAAGGAGAGAGG + Intronic
1155407652 18:25506934-25506956 CACAGCAGAGGGAAGAATTGTGG + Intergenic
1155811033 18:30235553-30235575 CAAAGCACAGTGAAAGAGGCAGG - Intergenic
1156355880 18:36339570-36339592 CCCACCACAGGGAAGTAGGGAGG - Intronic
1156617754 18:38808017-38808039 CACACCACTGGGAATGAGGAAGG + Intergenic
1157077466 18:44480809-44480831 CAAAGCCCAGAGAAGGATGGAGG - Intergenic
1157349436 18:46871433-46871455 CTCAGAACAGGGAGGGAGGGAGG + Intronic
1157563363 18:48663836-48663858 CACACCACAGGGAAGGAGGGAGG - Intronic
1157565058 18:48674327-48674349 AGCAGCACAGGGGAGGAAGGTGG - Intronic
1157568871 18:48699089-48699111 CACAGCACAGATAAGAAGAGTGG - Intronic
1157599821 18:48887057-48887079 CACCTCAGAGGGAAGGAGTGAGG + Intergenic
1157768991 18:50327812-50327834 CACAGACCGGGGAAGGCGGGAGG + Intergenic
1157828263 18:50832236-50832258 AACAGCAAAGGGAAGGGGGAAGG - Intergenic
1157972460 18:52285944-52285966 CAGAACACCAGGAAGGAGGGAGG + Intergenic
1158950591 18:62491203-62491225 CAAAGCACGGGGAGGAAGGGAGG + Intergenic
1159214646 18:65375134-65375156 GAAATCAAAGGGAAGGAGGGAGG - Intergenic
1159985053 18:74831874-74831896 CACAGCACACGGAGGGTGGGAGG - Intronic
1160004944 18:75062841-75062863 CAATGCCCAGGGAAGGAGGCTGG - Intronic
1160046572 18:75392181-75392203 CACATCTCAGAGAAAGAGGGAGG + Intergenic
1160107941 18:75995379-75995401 CACAGCACAGGAAACAAGTGAGG + Intergenic
1160235907 18:77087144-77087166 CACCGCAAACGGAAAGAGGGAGG + Intronic
1160489526 18:79325596-79325618 CACATGACAGGGAAGGAGCGGGG + Intronic
1160519374 18:79495207-79495229 CCCACCTCAGGGAAGGACGGAGG - Intronic
1161185335 19:2914876-2914898 AACAGCACAGAGGAGGAGGGTGG - Intronic
1161434846 19:4257076-4257098 CACAGCACTGGGAAGCAGCCAGG + Intronic
1161492782 19:4571546-4571568 CACAGCACAAGGGACGAGGGCGG + Intergenic
1161568308 19:5015837-5015859 CAGAGCACGGGGAGAGAGGGGGG - Intronic
1161616066 19:5270925-5270947 CAAAGCACAGGGCCTGAGGGAGG + Intronic
1161627410 19:5335378-5335400 CACAGCTCAAGTGAGGAGGGTGG + Intronic
1161834457 19:6636381-6636403 GAAAGGAGAGGGAAGGAGGGAGG - Intergenic
1162180160 19:8863256-8863278 CACAGGACAGAGAAGACGGGAGG + Intronic
1162180309 19:8864367-8864389 CACAACTCAGGGAGGGAAGGAGG - Intronic
1162182829 19:8882365-8882387 ACCTGCACAGAGAAGGAGGGAGG + Exonic
1162187436 19:8916898-8916920 ACCTGCACAGAGAAGGAGGGAGG + Exonic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163118318 19:15200930-15200952 CGGAGCCCAGGGAAGGAGGGAGG - Exonic
1163229297 19:15989303-15989325 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
1163257869 19:16168443-16168465 CAGATCACAGGGGTGGAGGGTGG - Intronic
1163678087 19:18665579-18665601 CACAGCTCAGGGAGACAGGGAGG - Intronic
1164527366 19:29022128-29022150 CCCAGCACAGGGAAGGTGCGGGG - Intergenic
1164596627 19:29534378-29534400 CACAGCAGAGTGGAGAAGGGTGG + Intronic
1164676986 19:30107508-30107530 CCCAGCAAGGGGAAGGAAGGGGG + Intergenic
1164914300 19:32038068-32038090 GACAGAACGGGGCAGGAGGGGGG + Intergenic
1165075735 19:33278987-33279009 CCCAGCCCAGGGCAGGAGGCAGG + Intergenic
1165924159 19:39316815-39316837 CACAACACAGGGTGGGCGGGGGG + Intergenic
1166047571 19:40238454-40238476 CACTGCACAGAGAAGGCGCGAGG + Intronic
1166325872 19:42050870-42050892 CTCAGGAGAGGGAGGGAGGGAGG + Intronic
1166679852 19:44759536-44759558 CCCAGCAAAGGGCAGGAAGGCGG - Exonic
1166882786 19:45939615-45939637 CCAAGCACAGGGAGGGAGGAAGG + Exonic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167329008 19:48842757-48842779 CACTGCACAGGAAGGGAGGAAGG - Intronic
1167934765 19:52897182-52897204 CACCGCACAAGGAGGGAGGTGGG + Intronic
1168061877 19:53897813-53897835 CCAAGGACAGGGTAGGAGGGTGG + Intronic
925199224 2:1952824-1952846 CAAAGGTAAGGGAAGGAGGGAGG - Intronic
925202416 2:1979292-1979314 GGCAGCAGAGAGAAGGAGGGCGG + Intronic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
927251499 2:20998610-20998632 CACAGGAAAGGTAAGGAGAGAGG - Intergenic
927518370 2:23685178-23685200 CAGGGCAGAGGGCAGGAGGGAGG - Intronic
928392188 2:30918598-30918620 CAAAGCACAGGAAGGAAGGGTGG + Intronic
928871142 2:35981603-35981625 AGAAGCACAGGGAAGGAAGGTGG + Intergenic
929449642 2:42028109-42028131 CACAGCTCTGGGAAAGAGAGGGG + Intergenic
929581218 2:43082764-43082786 CACAGCTCAGGGGAGGAGGGTGG + Intergenic
929891703 2:45923797-45923819 AGGAGCAGAGGGAAGGAGGGAGG + Intronic
930166567 2:48209316-48209338 CACAGTACAGGGTAGCATGGAGG + Intergenic
930225685 2:48790198-48790220 CACAGCAGATGGAAGAAGGAAGG + Intergenic
930712176 2:54559309-54559331 AATAGCAAAGGGGAGGAGGGAGG + Intronic
930878726 2:56248441-56248463 GACAGCACAGGAAGGGAGGTGGG - Intronic
931529971 2:63202842-63202864 CACAGACAAGGGAAGGAAGGAGG - Intronic
931554190 2:63481735-63481757 CACAGGAAAGGGTGGGAGGGGGG + Intronic
931665344 2:64606482-64606504 TGCAGAACAGGGAAGGAGAGTGG - Intergenic
932332536 2:70905863-70905885 CGCAGCACCGGTAAGGAGAGAGG + Intronic
932444323 2:71765781-71765803 CACAGCACAGTGAAGGAGAGAGG - Intergenic
932469384 2:71944019-71944041 CACAGCACAGGAAAGTGAGGAGG - Intergenic
932475341 2:72002477-72002499 AACACCCCAGGGAAGCAGGGAGG - Intergenic
932580275 2:72988870-72988892 CATAGCTCAGGGCAGGATGGAGG + Intronic
932702441 2:74001120-74001142 CACAGGGCAGGGAGGGAGGCAGG - Intronic
935253056 2:101282555-101282577 AGCAGCAAATGGAAGGAGGGAGG - Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935984692 2:108661413-108661435 CACTGCCCAGGGAAGGAGTCAGG - Intronic
936081342 2:109434653-109434675 TACAGCACAGGCAAGGATGAGGG - Intronic
936137127 2:109905064-109905086 CACTGCCCAGGGAAGGAGTCAGG - Intergenic
936207570 2:110466421-110466443 CACTGCCCAGGGAAGGAGTCAGG + Intronic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
937277505 2:120694769-120694791 CATCGCACATGGAAGGAGGTGGG + Intergenic
937432872 2:121854362-121854384 CACAGCACAGGAAAGGGGTGAGG - Intergenic
937726038 2:125167737-125167759 CAAAGCACAGAGAGGGAGAGCGG + Intergenic
937887226 2:126908185-126908207 CACAGCTCAGAAAGGGAGGGTGG - Intergenic
938245847 2:129777240-129777262 CACAGCCCAGGAATGGAGTGTGG + Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939764374 2:146227749-146227771 CACAGAACTGGGAAGGAGTTAGG + Intergenic
941143030 2:161808563-161808585 ACCAGAGCAGGGAAGGAGGGTGG - Intronic
941918591 2:170828267-170828289 GACAGCAGAGGGAAGGGGAGGGG - Intronic
942233000 2:173877223-173877245 CACACCACAGGGAGGCAGGCAGG - Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942594574 2:177580741-177580763 GACAGGGCAGGGAAGGAGGTTGG - Intergenic
944194065 2:197033615-197033637 AACAGCACAGGGATGGGGGCAGG + Intronic
944547151 2:200810432-200810454 AACAGCAGTGGGAAGGAGGCAGG - Intergenic
944750377 2:202703372-202703394 GGCAACACAGGGAAGGAGGTAGG - Intronic
945665276 2:212733770-212733792 TACAGCACAGCCAAGGAGGAGGG - Intergenic
946918618 2:224553700-224553722 CACAGGGCAGGGAGGGAGAGAGG - Intronic
947013160 2:225588458-225588480 CACAGCACAAAAAAGGAGAGAGG - Intronic
947219278 2:227777656-227777678 CACGGCCCAGGGAGGAAGGGAGG + Intergenic
947713562 2:232329151-232329173 CAGAGGACAGGGCAGGAGTGGGG - Intronic
947812460 2:233013114-233013136 GACAGGACAGGGGACGAGGGAGG - Exonic
948117588 2:235505066-235505088 CCCAGCACAGGGATGGATTGAGG - Intronic
948121976 2:235537384-235537406 GTCAGCTCAGGGAAGCAGGGAGG + Intronic
948232105 2:236356236-236356258 CAGGGCGCAGGGAAGGAGGCTGG - Intronic
948232339 2:236359084-236359106 CAGGGCGCAGGGAAGGAGGCTGG + Intronic
948326610 2:237126817-237126839 CAGAGGACAGGAAAGAAGGGAGG + Intergenic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
948676268 2:239598661-239598683 GAGAACACTGGGAAGGAGGGAGG - Intergenic
948941673 2:241199959-241199981 TCCAGCAGAGGGAAGGAGCGTGG - Intronic
949036416 2:241817538-241817560 GCCAGCAGAGGGAAGGCGGGAGG + Intergenic
1168797820 20:623181-623203 CACAAGACCAGGAAGGAGGGAGG - Intergenic
1168936871 20:1673309-1673331 CCCCTCACAGGGATGGAGGGGGG - Intergenic
1169123681 20:3112119-3112141 TACAGGGAAGGGAAGGAGGGAGG + Intronic
1169305223 20:4483703-4483725 CTCAGGAAAGGGAGGGAGGGAGG - Intergenic
1170873089 20:20226131-20226153 CACAGCCCAGGGAGGGATGAAGG - Intronic
1170891073 20:20375903-20375925 CAAACCACAGGGAAGGAGCAGGG - Intergenic
1171013055 20:21518881-21518903 CCCAGAACAGGGATGGGGGGAGG - Intergenic
1171407043 20:24918386-24918408 CCCGGCACAGGGGAGGGGGGCGG + Intergenic
1171450211 20:25230481-25230503 CACAGCACAGGGTGGTAGGATGG + Intergenic
1172007462 20:31827116-31827138 CACAGCAAAGAGAGAGAGGGGGG + Intronic
1172099178 20:32475275-32475297 CACAGCAAAGGTTAGGAAGGAGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172486539 20:35301688-35301710 CACAGTACAGTGTAGGAGGTGGG + Intergenic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172700204 20:36848611-36848633 AGAAGCACAGGGAAGGTGGGTGG + Intronic
1173089005 20:39952445-39952467 CACAAGAAAAGGAAGGAGGGAGG + Intergenic
1173323171 20:42008021-42008043 CACAGAACAAGCAAGGAGAGGGG - Intergenic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173535441 20:43808395-43808417 AACAGCACAAGGTAGGAGGGAGG - Intergenic
1173537986 20:43830369-43830391 CACTGGGCATGGAAGGAGGGAGG - Intergenic
1173561534 20:44009334-44009356 GACAAGAAAGGGAAGGAGGGTGG + Intronic
1173927237 20:46789858-46789880 CACACTCCAGGGAAGGAGGATGG - Intergenic
1175261035 20:57674264-57674286 GCCAGCACATGGAAGGAGGGGGG - Intronic
1175336621 20:58200276-58200298 CACTGCTCTGGGAAGGAGGGGGG + Intergenic
1175724921 20:61311031-61311053 CACTGCACAGTGGAGGCGGGTGG + Intronic
1176298250 21:5085749-5085771 CCCCGCACAGGGAGGGAGGAAGG + Intergenic
1177562753 21:22778116-22778138 CACAGGATAGGGTAGGAGAGAGG - Intergenic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1179176735 21:39013353-39013375 CAGTGCACAGGGAGTGAGGGAGG + Intergenic
1179301840 21:40118782-40118804 CACAGCACAGTGCAGGAGCGCGG - Intronic
1179514543 21:41897689-41897711 CTCTGCACTGGCAAGGAGGGGGG + Intronic
1179627949 21:42659176-42659198 CACACCAATGGGAAGGAGTGTGG - Intronic
1179639515 21:42738140-42738162 CAGAGCACAGGGACAAAGGGTGG - Intronic
1179858778 21:44176200-44176222 CCCCGCACAGGGAGGGAGGAAGG - Intergenic
1180076899 21:45467672-45467694 TCCACCACAGGGAAGGAGGGAGG - Intronic
1180132199 21:45834023-45834045 CCAAGCACAGGGAAGGCTGGGGG + Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181289330 22:21778746-21778768 CACAGCACAGCCCAGGAGCGTGG - Intronic
1181324256 22:22032624-22032646 GACAGCCCAGGGGAGGAGGCTGG + Intergenic
1182088836 22:27580335-27580357 CAAAGCCCAGAGAAGCAGGGAGG - Intergenic
1183040303 22:35172896-35172918 CACAGCCCAGGGAGGGAGAATGG - Intergenic
1183279291 22:36923482-36923504 CAGAGGACAGAGGAGGAGGGAGG + Intronic
1183329130 22:37210088-37210110 CACAGCACAGGGCAGCAAGGTGG - Intronic
1183352669 22:37342809-37342831 CACAGGAAAGGGAAGCGGGGAGG + Intergenic
1183423515 22:37725582-37725604 CACAGCACATGGAGGCTGGGAGG - Exonic
1183539219 22:38419833-38419855 CTCAGCACAGGGCTGAAGGGTGG + Intergenic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1183642994 22:39103625-39103647 GACACCACAGGGAGGAAGGGAGG - Intronic
1183655140 22:39180101-39180123 AACAGCATCGGGGAGGAGGGAGG + Intergenic
1184007344 22:41720126-41720148 CACAGCAGAGGGTAGGAGCAGGG + Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184105088 22:42362798-42362820 CAGAGCACAGGGAGGGAGAGGGG + Intergenic
1184425569 22:44407253-44407275 CACAGTGCAGGGAGGGAGTGGGG - Intergenic
1184503908 22:44889782-44889804 GCTAGCACAGGGAAGAAGGGCGG + Exonic
1185034067 22:48461669-48461691 CGCAGGACAGGGAAGGATGCGGG + Intergenic
1185062956 22:48616569-48616591 CACAGCACGAGGCAGGAAGGTGG + Intronic
1185081658 22:48712788-48712810 CACAGGAATGGGAAGGAGGGCGG - Intronic
1185094937 22:48800967-48800989 AACAGTGCAGGGAAGGAGCGGGG + Intronic
949260212 3:2097265-2097287 CACATACCAGGCAAGGAGGGAGG + Intergenic
950731024 3:14957886-14957908 CAGAGACCAGGGAAGGAGAGAGG - Intronic
951800467 3:26590111-26590133 CACAGAACAGAGAAAGAGGCAGG - Intergenic
952344164 3:32468545-32468567 CAAAAAATAGGGAAGGAGGGAGG - Intronic
952359359 3:32614294-32614316 CACAGTAAAGGGGATGAGGGTGG + Intergenic
952591799 3:34963984-34964006 CAGAGACCAGGGAAGGAGTGAGG + Intergenic
953178493 3:40574247-40574269 CAAGGCACAGAGAATGAGGGAGG + Intronic
953195400 3:40727511-40727533 CTCAGAAGAGGGAAGGTGGGAGG - Intergenic
953592425 3:44271912-44271934 CAGAGGACAGGGGTGGAGGGTGG - Intronic
953879109 3:46682431-46682453 CACAGAAGTGGGGAGGAGGGTGG - Intronic
953903949 3:46858859-46858881 CACAGCACACAGAAGTACGGAGG - Intronic
954138911 3:48595070-48595092 CCCAGCACAGGGAGAGAGGTGGG - Exonic
954390974 3:50267776-50267798 GTCAGCGGAGGGAAGGAGGGAGG + Intronic
954414623 3:50387155-50387177 CTCAGCACAGGGAAGGGAGCTGG + Intronic
954441643 3:50525438-50525460 CACAGCACAGCAGAGGCGGGGGG + Intergenic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954636730 3:52074948-52074970 CCCAGCACAGGGGCAGAGGGAGG + Intergenic
955068725 3:55554728-55554750 TGCAGCACGGGGAAGGGGGGAGG - Intronic
955205823 3:56895087-56895109 CAAATTACAGGGAGGGAGGGAGG - Intronic
955387088 3:58488705-58488727 CACAGCAAAGGAAGAGAGGGAGG + Intergenic
955399995 3:58584881-58584903 CACTCCACAGGGCGGGAGGGGGG - Intronic
957729231 3:84110979-84111001 GACAGCACAGTGATGGGGGGTGG + Intergenic
957952545 3:87144824-87144846 CACAGCACAGAGAAGCATAGCGG + Intergenic
959594474 3:108114378-108114400 GACAGCAAAGGGAAGGAAGCAGG - Intergenic
960618839 3:119620206-119620228 CATAGCATAGGGAAGGATGACGG - Intronic
961001557 3:123377506-123377528 CACAGCACTCAGAGGGAGGGAGG - Intronic
961055815 3:123787951-123787973 TACAGCAGATGGAAGAAGGGAGG + Intronic
961185423 3:124910805-124910827 GGCAGCAGAGGTAAGGAGGGAGG - Intronic
961509642 3:127392980-127393002 CTCTGCACAGGTGAGGAGGGAGG - Intergenic
962693567 3:137925794-137925816 CACAGAGCTGGGAAGGAGGAAGG + Intergenic
963038675 3:141052773-141052795 CAGGGCTCTGGGAAGGAGGGAGG + Intronic
964249937 3:154701665-154701687 AACAGCACAAAGAAGGTGGGTGG + Intergenic
964321321 3:155500715-155500737 CAGAGTACTGGCAAGGAGGGTGG - Exonic
964661130 3:159121460-159121482 CAAAGCAGAGGGAAAGAAGGGGG + Intronic
964718529 3:159748554-159748576 CTGGGCACAGTGAAGGAGGGTGG - Intronic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
966113540 3:176432832-176432854 CACAGCACAGAGAAAGGGAGGGG - Intergenic
967271543 3:187737467-187737489 GCCAGCCCAGGGGAGGAGGGAGG - Intronic
968393599 4:213030-213052 CACAGCCCGGGGAAGGTGCGGGG - Intergenic
968401863 4:305067-305089 CACAGCCCAGGGAAGGTGCGGGG + Intronic
968410575 4:386534-386556 CACAGCCCAGGGAAGGTGCGCGG - Intergenic
968497761 4:927723-927745 CAGAGCGCAGGTAAGCAGGGAGG - Intronic
968497770 4:927760-927782 CAGAGCGCAGGTAAGCAGGGAGG - Intronic
968591430 4:1461663-1461685 GGAAGCACGGGGAAGGAGGGGGG - Intergenic
968684159 4:1945289-1945311 CACACCACAGGAAAGGAGGGAGG + Intronic
968817243 4:2828439-2828461 GACCCCAGAGGGAAGGAGGGAGG - Intronic
968955058 4:3714164-3714186 CACAGAATAGGGAAGGAGCTGGG - Intergenic
969056348 4:4405181-4405203 CACAGCAAAGCCAAGGATGGTGG - Intronic
969093986 4:4718508-4718530 CACAGAACAGTTCAGGAGGGTGG - Intergenic
969450260 4:7268921-7268943 TAAGGCAGAGGGAAGGAGGGAGG + Intronic
969617329 4:8261519-8261541 TACTGCACAGTGAAGCAGGGAGG - Intergenic
971188101 4:24400603-24400625 TACAACACAGGGAAGGGGAGAGG - Intergenic
971255176 4:25007929-25007951 CACAGCACAGGGAGGGAGAATGG + Intronic
971297746 4:25412952-25412974 CAAAGCACAGTGGAAGAGGGTGG + Intronic
971503183 4:27338519-27338541 CATAGGGCAGGGAGGGAGGGAGG + Intergenic
972337942 4:38124865-38124887 CACATCACAGAGCAGGAGTGTGG - Intronic
972550846 4:40133013-40133035 CACAGCAGAGGGAAAAATGGCGG - Intronic
972554980 4:40172567-40172589 CACCACACAGGCAAGGAGAGAGG + Intergenic
972588617 4:40462408-40462430 TGCAGCAGAGGGAAGGAGAGAGG - Intronic
972865340 4:43225482-43225504 CACTGCACAGAGCAGGATGGAGG + Intergenic
973637533 4:52874083-52874105 CACACCGCAGGGAATTAGGGGGG + Intronic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
974752282 4:66156382-66156404 CACAGGATAGGGAAGTCGGGCGG - Intergenic
975160742 4:71121214-71121236 CACAGCCAAGGGGAGGGGGGAGG - Intergenic
975663493 4:76710233-76710255 CCCAGCACAGGAAAGCAGCGTGG + Exonic
975986266 4:80203299-80203321 CACAGCGAGGTGAAGGAGGGCGG - Exonic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976781295 4:88761544-88761566 CACATCACACAGAAGGAAGGAGG + Intronic
976909268 4:90280376-90280398 AACAGGAGATGGAAGGAGGGAGG - Intronic
976914425 4:90353100-90353122 CACACCTCAGGGAAGGAAGTGGG - Intronic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
978120617 4:105074703-105074725 CAAAGCAGAGAGAGGGAGGGAGG - Intergenic
978770380 4:112450273-112450295 CATGCCACAGGGATGGAGGGAGG - Intergenic
979312654 4:119221847-119221869 CACAGCAGAGCAAAGGAGAGAGG + Intronic
979906559 4:126300731-126300753 GACTGCACAGAGTAGGAGGGAGG + Intergenic
980093652 4:128467661-128467683 CAGAGTACAGGCAAGGAGGGCGG - Intergenic
981545142 4:145885943-145885965 GGCAGCAAAGGGAAGGAGGAGGG - Exonic
982636436 4:157902946-157902968 CACATCTCATGGAAGGAAGGAGG - Intergenic
982729348 4:158939097-158939119 GGCAACACAGGGAAGGAAGGAGG + Intronic
984030370 4:174596846-174596868 CTCAGTACAGTGAAGGAGAGAGG - Intergenic
985158932 4:187024105-187024127 CACAGCAGAGTGGAGAAGGGTGG - Intergenic
985766132 5:1780423-1780445 CACTGCCCAGGGAGGGTGGGAGG + Intergenic
986223809 5:5794398-5794420 AAAACCCCAGGGAAGGAGGGAGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986756486 5:10840983-10841005 GACAGCACAGGGAAGGAATTCGG + Intergenic
987005267 5:13703961-13703983 CACAGCAGAGGGAAGGGAGATGG - Intronic
987059227 5:14226108-14226130 CACAGGAGAGGCAAGGAGGTGGG + Intronic
988252829 5:28782387-28782409 CACAGCAGATGGAAGAAGGTGGG + Intergenic
988587987 5:32524361-32524383 AACAGCTGAAGGAAGGAGGGAGG + Intergenic
989034600 5:37156780-37156802 TACAAGACAGAGAAGGAGGGAGG + Intronic
989812437 5:45695392-45695414 GACAGATCAGGGAAGGATGGAGG - Intronic
990147045 5:52774050-52774072 CACAGAGCAGGGAAGAGGGGTGG - Intergenic
990435215 5:55783610-55783632 CAGACCAAAAGGAAGGAGGGAGG + Intronic
991673915 5:69074412-69074434 GACAGCAGAGGGATGGATGGAGG + Intergenic
991692383 5:69237501-69237523 CAAAGCATAGGGAAGGAGGGAGG - Intronic
992103755 5:73432915-73432937 CACAGGACAGGGAAAGGGTGGGG - Intergenic
992258402 5:74945510-74945532 AACATCACAGAGAAGGAGTGGGG + Intergenic
993072853 5:83187565-83187587 CACAGCAAAGGGAGGGAGAATGG + Intronic
993571957 5:89551813-89551835 AAGAGCACAGGCATGGAGGGAGG + Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
996095611 5:119395654-119395676 CACAGCACTGGTAAGGAGATGGG - Intronic
996402374 5:123076091-123076113 CATAGCTCAGGGCAAGAGGGAGG + Intergenic
996586021 5:125088942-125088964 CACTGCACAGGAGCGGAGGGCGG - Intergenic
996638757 5:125728258-125728280 CAGAGCAAAGGGATGGAGAGTGG + Intergenic
997109492 5:131059216-131059238 GACAGCACAGGGGAGGAGAGGGG + Intergenic
997208860 5:132066197-132066219 AAAAGCACAGGGAAGGAAGGAGG + Intergenic
997251947 5:132395916-132395938 AGGAGAACAGGGAAGGAGGGAGG + Intergenic
997638517 5:135433260-135433282 CACAGTACATGGAAAGAGGTGGG + Intergenic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
997846029 5:137286683-137286705 CAAATCACAGAGCAGGAGGGTGG + Intronic
997942225 5:138168516-138168538 GACAGCAGAGGGGAGGGGGGTGG + Intronic
998012541 5:138707100-138707122 CAAATCACAGGGGAGCAGGGTGG - Intronic
998140488 5:139697140-139697162 CACAGAGCAGGGAAGGGGGAGGG + Intergenic
998161253 5:139814149-139814171 CACTGCAGATGGAAGGTGGGTGG - Exonic
998556022 5:143124579-143124601 GACAGCACCTGGAAAGAGGGGGG - Intronic
998952243 5:147404019-147404041 CTCAGCAGAGGGCATGAGGGCGG + Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999606769 5:153325126-153325148 CACATCTTGGGGAAGGAGGGGGG - Intergenic
999759857 5:154691654-154691676 CAGGGAACAGGGACGGAGGGAGG - Intergenic
999878756 5:155837605-155837627 AACAGAACAGGGAAGGAAGGAGG - Intergenic
1001946900 5:175786750-175786772 AAGAACAGAGGGAAGGAGGGAGG - Intergenic
1002065147 5:176648031-176648053 CACATCCCAGGGTAGGAAGGAGG - Intronic
1002547068 5:179956205-179956227 CACAGCACAGGGCTGCAGAGAGG - Intronic
1002764631 6:228295-228317 CAGAGCACGAGGAGGGAGGGAGG + Intergenic
1003095206 6:3137219-3137241 CCGAGCAGAGGGAGGGAGGGAGG + Intronic
1003315855 6:5011357-5011379 CACAGCAGGAGGAAGGAGGAAGG + Intergenic
1003356656 6:5379536-5379558 CACAGCTGCGGGAAGGAGGAAGG - Intronic
1003529741 6:6927839-6927861 CACCACAAAGGGAGGGAGGGAGG + Intergenic
1003642763 6:7889142-7889164 CATCGGCCAGGGAAGGAGGGAGG + Intronic
1004352391 6:14901764-14901786 CAGAGCACAGGGACACAGGGAGG + Intergenic
1004522708 6:16377444-16377466 CACAGCAATGGGAAGGATGAGGG - Intronic
1004576962 6:16905850-16905872 CACAGAAGAGGGAAGGAAGCTGG - Intergenic
1005140469 6:22626188-22626210 CCTGGCACAGGAAAGGAGGGTGG - Intergenic
1005312357 6:24570727-24570749 GACATCACAGAGAGGGAGGGAGG + Intronic
1005940662 6:30557118-30557140 CGCAGCAAAGGGAAGGTGTGAGG + Exonic
1006101321 6:31687964-31687986 ACCAGCACAGGGAAGGAGGGAGG - Intronic
1006303769 6:33207410-33207432 GAGAGGACAGGGAAGTAGGGGGG + Intergenic
1006458787 6:34146087-34146109 CAAAGCACAGGGACGCAGAGGGG + Intronic
1006627552 6:35408108-35408130 CAGAAGACAGGGTAGGAGGGTGG - Intronic
1006787184 6:36676365-36676387 GGCAGCATAGGGATGGAGGGAGG - Intergenic
1007078974 6:39085399-39085421 CACCTCACAGGGGAGGAGGGAGG - Intronic
1007236293 6:40393122-40393144 CAGAGGAGAGGGGAGGAGGGAGG + Intronic
1007419135 6:41708795-41708817 CACCCTACAGGGAAGGAGAGAGG + Intronic
1007655823 6:43450529-43450551 CACAGCACTGTGATGGAGGTGGG - Exonic
1007665912 6:43512868-43512890 CATAGCCCTGGGAAGGAGGATGG + Exonic
1007775391 6:44222039-44222061 CAGAGACCAGGAAAGGAGGGTGG + Intronic
1007959622 6:45947012-45947034 CTCAGGACAGGGAAGGTAGGTGG + Intronic
1009947302 6:70354709-70354731 CTAAGAACAGGGAAGGAGGTGGG - Intergenic
1010192489 6:73208757-73208779 CCCAGCCCAGGGAAGGAGCCAGG - Intergenic
1010194146 6:73223439-73223461 CCCAGCCCAGGGAAGGAGCCAGG - Intronic
1011259348 6:85455374-85455396 CAAAGTCCAGGAAAGGAGGGTGG + Intronic
1011314527 6:86016791-86016813 CACAGACCAGGGAGGAAGGGGGG + Intergenic
1011691250 6:89871484-89871506 CCCAGCACAGCCAAGGTGGGAGG + Intronic
1011719867 6:90144361-90144383 AAAAACAGAGGGAAGGAGGGAGG + Intronic
1011740095 6:90350867-90350889 CAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1012963197 6:105644469-105644491 CACAGCAGAGTGTAGGAGGATGG + Intergenic
1013347603 6:109277217-109277239 CACAGGACAGGGGTGGAAGGTGG + Intergenic
1013618247 6:111864729-111864751 CAAAGCAAAGGCAAGGAGGCAGG + Intronic
1013961567 6:115907268-115907290 GACAGAACTGGGAAGGAGTGAGG - Intergenic
1014296805 6:119628430-119628452 CACAGCACAGGAAAGGTAGAAGG - Intergenic
1015264978 6:131281762-131281784 CTCAGCAGAGGGAAGCAGGGAGG - Exonic
1016051776 6:139537472-139537494 CACAGCCCAGGGCAGGAGACAGG - Intergenic
1016353784 6:143195644-143195666 CACAACACAGGGAAGCTGGGAGG + Intronic
1016503542 6:144750174-144750196 AGAAGCACAGGGAAGGAGGAGGG - Intronic
1016918406 6:149266429-149266451 CCCAGCAAAGGGAAGGAGTGGGG - Intronic
1017337008 6:153272651-153272673 AAAAGCACAGGGAGGGAGGGAGG - Intergenic
1017595933 6:156028558-156028580 CAAAGCACACGGAAGCAGGCTGG - Intergenic
1017664242 6:156703787-156703809 CACAGCACAGGGAATGCTGCTGG + Intergenic
1017891117 6:158640115-158640137 CACAGCAGGGGGCAGGAAGGTGG - Intronic
1017909665 6:158782167-158782189 TACTGCACAGGGAGGGAGGCAGG - Intronic
1017945810 6:159095550-159095572 CAAAGAACAGGGAAGAAGGACGG + Intergenic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1019055897 6:169223109-169223131 CACAGACCATGGAAGGATGGGGG + Intronic
1019825287 7:3279453-3279475 CAGAGCAGAGGGAAAGAGAGAGG + Intergenic
1020125677 7:5531361-5531383 CGCAGCCCTGGGAAGGAAGGTGG + Intronic
1020473058 7:8561413-8561435 CCCAGAGGAGGGAAGGAGGGAGG - Intronic
1021577101 7:22114802-22114824 CACAGGACAGGGAAGGGGTGAGG + Intergenic
1021944241 7:25710067-25710089 CAAAACACAAGGAAGGATGGAGG - Intergenic
1022289419 7:28986589-28986611 AAGAGAACAGGGAAGGAGGGAGG + Intergenic
1022822969 7:33979458-33979480 CTAAGCACAGAGGAGGAGGGAGG - Intronic
1022892918 7:34719312-34719334 CTCAACAGAGGGAAGGAAGGAGG + Intronic
1022942581 7:35254360-35254382 CACAGCCCCGGGCGGGAGGGCGG + Intergenic
1023146116 7:37152659-37152681 CTCAGCACCGGAAAGAAGGGAGG + Intronic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1023674187 7:42613412-42613434 GAAAGCACAAGGTAGGAGGGAGG - Intergenic
1023830997 7:44039004-44039026 GAGAGCCCAGGGAATGAGGGCGG + Intergenic
1023994845 7:45153007-45153029 TACAGCACAGTGACAGAGGGAGG - Intergenic
1024270126 7:47635724-47635746 GCCAGGACAGGGAAGGAGGGAGG + Intergenic
1024865082 7:53896173-53896195 CAAAGCAGCGGGAAGGAGGTGGG + Intergenic
1024938122 7:54733408-54733430 CACAGGACAGGCAAGGTGGAAGG - Intergenic
1025258903 7:57404206-57404228 CAGCGCAGAGGGAAGGAGCGGGG + Intergenic
1025706076 7:63865388-63865410 CACATGAGAGGGAGGGAGGGAGG + Intergenic
1026251685 7:68676710-68676732 CAAAGAACAGGAAAGGAGGTGGG + Intergenic
1026662462 7:72314095-72314117 CCCAGCACAGGGCTGGAGTGAGG + Intronic
1027253048 7:76411100-76411122 CCCAGGCCAGGGGAGGAGGGAGG - Intronic
1028331828 7:89604552-89604574 GACAGCACAGGGTAAGAGGTAGG - Intergenic
1028638340 7:93016043-93016065 CCCAGCAAAGGGAAGGGGGAGGG - Intergenic
1029494765 7:100890812-100890834 CACTGGACAGGGCAGGAGGAGGG - Exonic
1029591846 7:101512170-101512192 GTCAGCACAGGGGAGGAGGTTGG + Intronic
1029610910 7:101626097-101626119 AACATCTCAGGGAAGAAGGGGGG + Intronic
1029707587 7:102283956-102283978 CAGAGCACAGGGCACCAGGGTGG - Intronic
1030159462 7:106492615-106492637 AAAAACAGAGGGAAGGAGGGAGG + Intergenic
1030174425 7:106636579-106636601 GAAAGAAAAGGGAAGGAGGGAGG + Intergenic
1030693000 7:112553884-112553906 TACAGCAGAGGGCAGGAGGATGG + Intergenic
1031663103 7:124451863-124451885 TACAGTAGAGGGAGGGAGGGAGG + Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032526711 7:132583304-132583326 TACACCACAGGGCAGGAGGGAGG + Intronic
1032580002 7:133095577-133095599 CACAGTACAAGGAAGGAGAGTGG - Intergenic
1032783376 7:135182361-135182383 CGCCGCACAGGGAGGGAGCGTGG - Intergenic
1033274936 7:139964646-139964668 CACAGCAGAGGCTAGGAGAGGGG + Intronic
1033708897 7:143917674-143917696 AACATGACAGGAAAGGAGGGGGG - Intergenic
1034268879 7:149793816-149793838 CAAAGCACAGGAAGGCAGGGCGG - Intergenic
1034354664 7:150443123-150443145 GAGAGCACAGGGAAGCTGGGAGG + Intergenic
1034493557 7:151407316-151407338 CACAGAGCTGGGCAGGAGGGTGG + Intronic
1034512616 7:151548733-151548755 CCCAACACAGGAAAGGATGGAGG - Intergenic
1034552462 7:151830306-151830328 CACAGCACAGTGCAGGTGGCGGG - Intronic
1034756849 7:153630082-153630104 CACTGCACAGGGAATCAGGATGG + Intergenic
1034899208 7:154897142-154897164 CTGAGGCCAGGGAAGGAGGGAGG + Intergenic
1035413836 7:158667516-158667538 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413866 7:158667602-158667624 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413904 7:158667716-158667738 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035460283 7:159034402-159034424 CAGTTCCCAGGGAAGGAGGGAGG - Intronic
1035756975 8:2041951-2041973 CACAGCACAGGGAGGGGCAGGGG - Intergenic
1036445809 8:8821037-8821059 GTCAGCACAGGGAAGTGGGGAGG + Intronic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037885526 8:22594196-22594218 CACAGAAGTGGGAAGGAGAGGGG + Exonic
1037987038 8:23296491-23296513 CACAGCACAGGCCAGAAGGCTGG - Intergenic
1038395252 8:27241665-27241687 AAGAGCTCAGGGTAGGAGGGAGG - Exonic
1038507380 8:28096339-28096361 CACAGACCAGGGGAGCAGGGTGG - Intronic
1038568080 8:28636430-28636452 CACAGGACAAGGAAGGATTGGGG + Intronic
1038691975 8:29772506-29772528 CTCAGCAGAGGGAAGGGAGGAGG + Intergenic
1038715261 8:29985805-29985827 CACAGTGCAGGGTGGGAGGGTGG - Intergenic
1038861985 8:31397639-31397661 CACAGCACACGGCAAGAAGGTGG - Intergenic
1039428339 8:37505491-37505513 CACATCCCACAGAAGGAGGGAGG + Intergenic
1039561235 8:38514047-38514069 CCCAGCCCAGGGAGGGAGGGAGG - Intronic
1039616233 8:38956967-38956989 CACCTTAGAGGGAAGGAGGGAGG + Intronic
1039711648 8:40061549-40061571 CACAGCCCAGCCCAGGAGGGAGG + Intergenic
1039855009 8:41404311-41404333 CACACCACACGGAAGAAGTGGGG + Intergenic
1039971271 8:42323559-42323581 AAGAGCAAAGGGAAGGAGAGAGG + Intronic
1040342272 8:46447028-46447050 GACACCACAGGGAATGATGGGGG - Intergenic
1040470655 8:47733604-47733626 CACCGCACGGGGAGGGAGGGTGG - Intronic
1041662386 8:60412887-60412909 CCCAGCACTGGGCAGGAGGAGGG - Intergenic
1043012604 8:74900071-74900093 CACAGGACAGAGAAGATGGGTGG + Intergenic
1043232615 8:77822035-77822057 TACAGGACAGGGAAGCAGTGTGG + Intergenic
1043969640 8:86514878-86514900 CTCCGCCCAGGGAAGGAGGGCGG - Intronic
1044595927 8:93958319-93958341 AAAACCACAGAGAAGGAGGGAGG - Intergenic
1045060599 8:98407397-98407419 CACTGGACAGGGAGGGAGTGAGG + Intronic
1045443498 8:102238498-102238520 TCCAAAACAGGGAAGGAGGGTGG + Intronic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1046710617 8:117506940-117506962 CACACCACAAGGAAGGGGGCAGG - Intergenic
1047233946 8:123022346-123022368 CAAATAACAGGGAACGAGGGAGG + Intronic
1047318400 8:123755228-123755250 CACAGGACAGAGACTGAGGGGGG - Intergenic
1047725454 8:127680152-127680174 GACTGCTCAGGGAATGAGGGTGG - Intergenic
1048214326 8:132481105-132481127 CCCACCCCGGGGAAGGAGGGAGG - Intergenic
1048977913 8:139683331-139683353 AACAGCAGAGGGGAGGAGGGAGG - Intronic
1048989667 8:139753852-139753874 CACAACACAGGCGAGGAGAGGGG - Intronic
1048995728 8:139792673-139792695 CACTGCACAAGGAAGGAAGCAGG + Intronic
1048997230 8:139801507-139801529 CACAGCCAAGGGAAGGGGGGCGG - Intronic
1049154105 8:141056485-141056507 CACAGGACAGGTAGGCAGGGAGG + Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049378241 8:142299187-142299209 CACAGCAGAGGCAGGGAGGTGGG + Intronic
1049384842 8:142337969-142337991 GACAGGACTGGGAATGAGGGGGG - Intronic
1049424548 8:142532291-142532313 CACAGCCCCGGGAAGCAGGTTGG + Intronic
1049434361 8:142579609-142579631 CCCAGTACTGGGAAGGAGGCAGG - Intergenic
1049544502 8:143223514-143223536 CACAGAACAGGAAAAGAGAGCGG - Intergenic
1049655482 8:143795166-143795188 GCCAGCACAGGGCAGGAGAGGGG + Intronic
1050650072 9:7766703-7766725 GACAGAGCAGGGAAGTAGGGTGG + Intergenic
1050740468 9:8813678-8813700 CACAGCTCATGAAAGGAGAGAGG - Intronic
1051345521 9:16147613-16147635 GACAGCACAGGGGGTGAGGGAGG - Intergenic
1052022189 9:23538147-23538169 GAAAGCAGAGGGAAGGAGTGGGG - Intergenic
1052591221 9:30497941-30497963 CACAGCTCAGGGGAGGCAGGGGG + Intergenic
1054732719 9:68717082-68717104 AAGGGGACAGGGAAGGAGGGAGG + Intronic
1054959122 9:70947630-70947652 CAGAGCTCAGAGAAGGTGGGGGG + Intronic
1055285574 9:74724928-74724950 AACAGCATAGGGAAGGAAGGGGG - Intronic
1055623546 9:78150100-78150122 CACTGCACAGGGCAGGTGTGAGG + Intergenic
1055848750 9:80599292-80599314 CTCAGCACAGTGAAAGAGGGTGG - Intergenic
1056072151 9:82998542-82998564 CACAGCTCAGCCAGGGAGGGAGG + Intronic
1056206060 9:84320527-84320549 TACAGCACAGGAAAGGAAGGAGG - Intronic
1056687522 9:88778653-88778675 CACAGCCCAGGGACAGAGTGAGG - Intergenic
1056776712 9:89518347-89518369 CACAGCACAGGCTTGGAGGAAGG + Intergenic
1056794459 9:89648062-89648084 CACAGCACAGACAAGGGGGAGGG - Intergenic
1057167548 9:92940750-92940772 CACAGCACAGGGAACTGTGGTGG + Intergenic
1057201374 9:93142167-93142189 CACAGGACAGGGAGGGAGTGGGG - Intergenic
1057557567 9:96100042-96100064 CACAGCAGAGGTAATGAGAGAGG + Intergenic
1057605042 9:96492994-96493016 ACCAGCACAAGGAAGGAGGCTGG - Intronic
1058915524 9:109560834-109560856 CAGAGCACAGGCAAGCAGGAGGG - Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059354231 9:113687085-113687107 CAGAGAAGAGGAAAGGAGGGAGG + Intergenic
1059382299 9:113935758-113935780 CACAGCACAGGGCAGGGTGCAGG - Intronic
1060734580 9:126058917-126058939 CACAGCACCGGGAGCGAGGCGGG - Intergenic
1060757835 9:126225848-126225870 CAGAGCCCAGGCAAGGAGAGAGG + Intergenic
1061011747 9:127960076-127960098 AACACCACAGGGAAGGTGTGTGG + Intronic
1061321765 9:129835388-129835410 GACGGCAGAGGGAAGGAGGTGGG + Intronic
1061756285 9:132814719-132814741 CACAGCAGACTGAAGGAGAGGGG + Exonic
1061764725 9:132874573-132874595 CACAGAACTGGGGAGGAGGGAGG - Intronic
1061827375 9:133268226-133268248 CAAACCACAAGCAAGGAGGGAGG + Intronic
1061869486 9:133513200-133513222 CACTGCCCATGGAAAGAGGGCGG - Intergenic
1061957061 9:133969292-133969314 CAACGAACAGGGAAGGAGGGAGG + Intronic
1062030414 9:134359648-134359670 TCCAGCAGAGGGAGGGAGGGAGG - Intronic
1062050660 9:134444813-134444835 GCCACCAGAGGGAAGGAGGGAGG - Intergenic
1062097201 9:134709620-134709642 CACAGCACATGGGAAGAGGCAGG - Intronic
1062298346 9:135847830-135847852 CCCAGAACAGGGAAGGGGAGGGG + Intronic
1062309605 9:135928828-135928850 CCAAGCACAGGGCAGGAGTGTGG + Intergenic
1062468090 9:136690324-136690346 CACAGCTCAGGGAGCGAGTGAGG + Intergenic
1203571992 Un_KI270744v1:140543-140565 CACGGCCCAGGGAAGGTGCGGGG + Intergenic
1185975371 X:4714017-4714039 CACAGGAAAGGGAGGGAGAGTGG - Intergenic
1186201406 X:7158605-7158627 CACAGCAGGGGGAATGAGGGAGG + Intergenic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187327873 X:18308348-18308370 GAAAGGACAGGGAGGGAGGGAGG + Intronic
1187501245 X:19840869-19840891 CACAGCACACAGCTGGAGGGTGG - Intronic
1187529063 X:20080250-20080272 CACCGCACAGGGAAGAAGGCTGG - Intronic
1188636594 X:32439872-32439894 CACAACACAGACAAGCAGGGAGG - Intronic
1188999643 X:36930058-36930080 CATAGCACAGGGATTGAGGTTGG - Intergenic
1189349815 X:40267795-40267817 CGCAGGAAAGGGAAGGAGAGGGG + Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190088209 X:47414720-47414742 CAAAGCACAGTCAAGAAGGGTGG - Intergenic
1190397970 X:50003796-50003818 CACAGCCTAGAGAAGGAAGGGGG + Intronic
1190713886 X:53088245-53088267 CACAGCACAGGGAGAGGGGCTGG - Exonic
1191105962 X:56772577-56772599 CACAGGAGAGGGTGGGAGGGGGG - Intergenic
1191106955 X:56777979-56778001 CACAGGAGAGGGTGGGAGGGGGG - Intergenic
1191716420 X:64196860-64196882 CAGAACACTGGGAAGGAAGGTGG + Intronic
1192050116 X:67717266-67717288 AGCAGCTCAGGGAAGTAGGGAGG + Intronic
1192155768 X:68745455-68745477 CCCAGCTCAGGGAGGTAGGGAGG + Intergenic
1192343388 X:70281904-70281926 CACAGCAAAGGGGTGGAGGTGGG - Intergenic
1194131259 X:90084756-90084778 CACAGCACAGGTAAGCATGATGG - Intergenic
1196400575 X:115312005-115312027 CGGAGCACAGGGAGGGAGCGAGG - Intergenic
1198060629 X:133042420-133042442 CTCAGCCAAGGGAAGGCGGGAGG - Intronic
1198871499 X:141180591-141180613 CACAGCAGAGGGATTCAGGGAGG + Intergenic
1199613304 X:149635428-149635450 CACAGCACACTGGAGGAGTGTGG - Intergenic
1199749103 X:150798100-150798122 CAGAACACAGGAAGGGAGGGAGG + Intronic
1200237096 X:154472921-154472943 CTGGGCACAGGGCAGGAGGGTGG - Exonic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1201576424 Y:15466097-15466119 CACAGCAGGGCGAATGAGGGAGG + Intergenic
1201701216 Y:16884091-16884113 CACAGGACAGGGAGGCAGAGTGG + Intergenic
1201900271 Y:19041383-19041405 CACAGACCAAGGAAGGAGAGAGG - Intergenic