ID: 1118843016

View in Genome Browser
Species Human (GRCh38)
Location 14:69526881-69526903
Sequence CGGTAAAGTGCAGGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118843016_1118843024 22 Left 1118843016 14:69526881-69526903 CCTTCCACCCCTGCACTTTACCG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1118843024 14:69526926-69526948 GTCAGTCTGACCAGACAGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 143
1118843016_1118843027 29 Left 1118843016 14:69526881-69526903 CCTTCCACCCCTGCACTTTACCG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1118843027 14:69526933-69526955 TGACCAGACAGCCAGGCATGGGG 0: 1
1: 0
2: 1
3: 29
4: 226
1118843016_1118843028 30 Left 1118843016 14:69526881-69526903 CCTTCCACCCCTGCACTTTACCG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1118843028 14:69526934-69526956 GACCAGACAGCCAGGCATGGGGG 0: 1
1: 1
2: 20
3: 217
4: 1576
1118843016_1118843025 27 Left 1118843016 14:69526881-69526903 CCTTCCACCCCTGCACTTTACCG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1118843025 14:69526931-69526953 TCTGACCAGACAGCCAGGCATGG 0: 1
1: 0
2: 4
3: 35
4: 279
1118843016_1118843026 28 Left 1118843016 14:69526881-69526903 CCTTCCACCCCTGCACTTTACCG 0: 1
1: 0
2: 0
3: 15
4: 221
Right 1118843026 14:69526932-69526954 CTGACCAGACAGCCAGGCATGGG 0: 1
1: 0
2: 0
3: 29
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118843016 Original CRISPR CGGTAAAGTGCAGGGGTGGA AGG (reversed) Intronic
900228324 1:1543229-1543251 AGGCCAAGTCCAGGGGTGGACGG + Intronic
901556181 1:10033013-10033035 GGGGAAAGAGTAGGGGTGGAGGG + Intronic
901686192 1:10944847-10944869 GGAGAAAGGGCAGGGGTGGATGG + Intergenic
902597570 1:17520000-17520022 GGGTACAGGGCAGGGTTGGAGGG - Intergenic
902785906 1:18732592-18732614 AGGTAAAGTGCAGGGTAGAAAGG + Intronic
903071302 1:20728087-20728109 CTGCAAAGGGCAGGGGGGGAAGG + Intronic
905442891 1:38005859-38005881 GGGTAAGGTGAAGGGGTGGGGGG - Intergenic
906017666 1:42596619-42596641 TGGTGAAGTGTTGGGGTGGATGG - Intronic
907410828 1:54282151-54282173 CGGTGCAGAGCAGGGGTGCATGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
909186468 1:72492620-72492642 CAGTACAGTGCAAGGTTGGAAGG - Intergenic
910360231 1:86408765-86408787 CGGTAAATGTCTGGGGTGGAGGG + Intergenic
916653858 1:166855509-166855531 GGGTAAAGTGCAGGGCAGTAAGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066158483 10:32703624-32703646 CCTTAAAGTGAAGGGGTGAATGG - Intronic
1067816007 10:49477329-49477351 AGATACAGTGCAGAGGTGGAAGG - Intronic
1068787224 10:60989778-60989800 GGGGAGAGAGCAGGGGTGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070784683 10:79156068-79156090 AGGTAAAGAGTAGGGGTGGGAGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1075278254 10:121114875-121114897 CACTAAAGTGCAAGGGTTGATGG - Intergenic
1075683777 10:124350072-124350094 CGGGACAGTGCAGGGCTGGAGGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077027427 11:447213-447235 CTGTAGAGTGCAGGGGTTCAGGG + Intergenic
1077047643 11:553466-553488 CCGTGACCTGCAGGGGTGGAGGG + Intronic
1078064395 11:8068433-8068455 TGGAAAATTGCAGGGGTGCAGGG - Intronic
1081853594 11:46290451-46290473 CGGCAGAGGGCAGGGCTGGAAGG - Intronic
1084359579 11:68660816-68660838 AGAGAAAGTGCAGAGGTGGACGG + Intergenic
1084684054 11:70683409-70683431 CGGCAAGTTCCAGGGGTGGAAGG - Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1086647050 11:89235660-89235682 AGGTGATGTGCAGGAGTGGAAGG + Intronic
1087916075 11:103812352-103812374 CAATAAAGTGCTGGTGTGGATGG - Intergenic
1088121734 11:106378205-106378227 CTGTTAAATGAAGGGGTGGAGGG - Intergenic
1094278506 12:28707700-28707722 AGGTAATTTCCAGGGGTGGAAGG + Intergenic
1095335227 12:41016371-41016393 CGGGAAAGTGAGGGGGTGGGAGG + Intronic
1095940408 12:47723296-47723318 CAGTGGAGTGCAGGGGTGGGAGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1099914645 12:88877167-88877189 TGGTAAATTGCAGAGGAGGATGG + Intergenic
1100789985 12:98119818-98119840 CTCTAAAATGCAGGGGTGGCAGG - Intergenic
1103000497 12:117382090-117382112 AGGTAAAGAGCAGGGGTGGTGGG - Intronic
1103237611 12:119386324-119386346 GGGTAGGTTGCAGGGGTGGAGGG + Intronic
1103916830 12:124380180-124380202 CGGTGAAGGGCTGGGGTGGGCGG - Intronic
1103987017 12:124774174-124774196 CTGTAGAGTGGAGGGGTGGGGGG - Intergenic
1104508546 12:129355416-129355438 GGGTAAGGTGGAGGGGTGGGTGG + Intronic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110553072 13:76828813-76828835 GGGTAGAGGGCAGGTGTGGAGGG + Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1114268684 14:21088320-21088342 GAGTATAGTGCTGGGGTGGATGG + Intronic
1114517272 14:23308124-23308146 GGGACAAGTGCAGGAGTGGATGG + Exonic
1117069301 14:52042279-52042301 CAGTGAAGTGCACGGGTGTATGG + Exonic
1117075743 14:52102222-52102244 GGTTAAAGTGCATGGTTGGACGG + Intergenic
1118843016 14:69526881-69526903 CGGTAAAGTGCAGGGGTGGAAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119441837 14:74633717-74633739 CGGATAAGTGCAGGGGAGAAGGG + Intergenic
1120617470 14:86725534-86725556 GGGTAAAGTGCAAGGGTAGGGGG + Intergenic
1120821462 14:88915332-88915354 CCTTAGGGTGCAGGGGTGGAAGG + Intergenic
1122290175 14:100676589-100676611 CTGTAAAGTCCAGGGGAGGGGGG - Intergenic
1122325752 14:100879931-100879953 CTGGACAGTGCAGGGGTGCAGGG - Intergenic
1122968772 14:105144003-105144025 GGGGGAAGTGGAGGGGTGGAGGG + Intronic
1125445177 15:39746555-39746577 TGGTAAATGGCAGGTGTGGATGG + Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1128382600 15:67124354-67124376 GTGTAAACTGCAGAGGTGGATGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131918834 15:97301268-97301290 CGCTAAAGCGCAGGGGAGCATGG + Intergenic
1134515329 16:14882252-14882274 GGGTAGAGGGGAGGGGTGGATGG + Intronic
1134703002 16:16280897-16280919 GGGTAGAGGGGAGGGGTGGATGG + Intronic
1134964541 16:18431218-18431240 GGGTAGAGGGGAGGGGTGGATGG - Intronic
1134968828 16:18513753-18513775 GGGTAGAGGGGAGGGGTGGATGG - Intronic
1136036483 16:27544433-27544455 TGGAAAAGAGCAGGGGTAGAGGG + Intronic
1137305567 16:47196429-47196451 TGGTAAAGTGCTGAGGTGGGGGG + Intronic
1139264573 16:65626801-65626823 TGGGAAAGTTCAGGGGTGTATGG - Intergenic
1139661805 16:68425863-68425885 CGGCATAGTGCAAGGGAGGAGGG - Intronic
1145249508 17:21289572-21289594 CGGACAAGGGCAGGCGTGGACGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149298915 17:55286291-55286313 AGGTAAAGTACAAGGGTGGGGGG - Intronic
1151799247 17:76368047-76368069 AGGTACAGTGCGGGGGTGGGGGG - Intronic
1152009143 17:77700226-77700248 GGGAGAAGAGCAGGGGTGGACGG + Intergenic
1152218475 17:79048118-79048140 CAGCACAGCGCAGGGGTGGAAGG - Exonic
1152382102 17:79947383-79947405 TTGTCACGTGCAGGGGTGGAAGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154086514 18:11310630-11310652 AGGCAGAGGGCAGGGGTGGATGG + Intergenic
1154270284 18:12912424-12912446 CGGCACAGCGCAGGGGTGGGAGG - Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156656449 18:39294139-39294161 AGGCAAAGTGGAGGGGTGGCTGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157977108 18:52340140-52340162 CGGAGAAGTGGAGGGCTGGAAGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159045634 18:63366850-63366872 GGGAAAAGCGCCGGGGTGGACGG + Intronic
1160047955 18:75405484-75405506 AGGTAAGGTGTAGAGGTGGAGGG + Intergenic
1165071674 19:33259444-33259466 CAATAAACTGCAGGGCTGGAAGG - Intergenic
1166944203 19:46387223-46387245 CGGCAAAGTGCTGGTGAGGACGG + Exonic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
927326164 2:21807815-21807837 GGGTAAGCTGCAGGGATGGAGGG - Intergenic
928638767 2:33275956-33275978 CGGTGATGTGCAGGGTTGGTAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929817592 2:45247317-45247339 CTTTAAAGTGCTGGGGGGGAGGG - Intergenic
930242663 2:48952616-48952638 GGGTAAAGTGATGTGGTGGAAGG + Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
936399346 2:112153879-112153901 CGGAGAAGGGCAGGGGTGGATGG + Intronic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
937989190 2:127653045-127653067 CGGTGCAGTGCAGGGGCCGAGGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939661294 2:144893738-144893760 AGTTAATGTACAGGGGTGGATGG - Intergenic
942046578 2:172102551-172102573 CGGGAAAGAGCAGAGGTGGCGGG + Exonic
943662994 2:190578756-190578778 GTGTGGAGTGCAGGGGTGGAGGG + Intergenic
946178769 2:217937693-217937715 CTGAAAGGTGCAGGGGTGGGGGG - Intronic
947090962 2:226510982-226511004 CGTTAAAGGGAAGGGATGGAAGG + Intergenic
947181647 2:227416594-227416616 GGGTGAAGGGCAGGGGTGAAGGG + Intergenic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1169883036 20:10368095-10368117 TGGTAAAGTAAGGGGGTGGATGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174421610 20:50402646-50402668 TTGTAAAGTGCATGGGTGCATGG - Intergenic
1177320495 21:19513712-19513734 CTATAAATGGCAGGGGTGGATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178364145 21:31974509-31974531 CCGTGAAGTGCAGGGGTGACTGG + Intronic
1180178092 21:46099744-46099766 CTGTAATGGGCAGGGGTGGTGGG + Intronic
1181346743 22:22224766-22224788 CTGCTAAGTGCAGGGCTGGAGGG + Intergenic
1181468933 22:23126345-23126367 AGGTGAACTGCAGGGGAGGACGG - Intronic
1183778806 22:39985370-39985392 GGGCAAGGTGCAGGGGTTGAGGG - Intergenic
1185038820 22:48493920-48493942 AGTGAAAGAGCAGGGGTGGAAGG - Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
954211274 3:49098864-49098886 AGGTAAATTGTGGGGGTGGAGGG - Exonic
954906505 3:54067706-54067728 CTGTGAAGTGGAGGGGTGGCAGG + Intergenic
955402150 3:58600027-58600049 CATTAAATTGCAGGGGTGGGGGG - Intronic
959098843 3:101987352-101987374 AGATAAAGTTGAGGGGTGGATGG + Intergenic
959251651 3:103955939-103955961 TGGTAGTGTGCATGGGTGGAGGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961097160 3:124167191-124167213 CAGTAAAGTGCAGGGATCTAAGG - Intronic
961499777 3:127324006-127324028 CTGGAAAGTGCAGGGCTGAAAGG + Intergenic
961785688 3:129345210-129345232 AGGAAAAGTGCAGAGGAGGAAGG + Intergenic
962104693 3:132378709-132378731 GGGTAAAGGGTGGGGGTGGATGG - Intergenic
964680988 3:159338415-159338437 CGGTAAAGTGCCAGGGTGTCTGG + Intronic
968809602 4:2793877-2793899 CGGGAAAGTGCTGGGCTGCAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969851892 4:9963971-9963993 CTGTGAGGTGGAGGGGTGGATGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973086577 4:46070000-46070022 CAGTAAAGGGCAGGGCGGGATGG + Intronic
973208058 4:47582696-47582718 GGGTGAAGTGCAGGGATGCAAGG - Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978112250 4:104977183-104977205 CTTTAAAGGGCAGGGATGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991066221 5:62427725-62427747 GGGTAAAGGGCAGGGGGGGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992303426 5:75408903-75408925 GGGTAGAGGACAGGGGTGGAGGG - Intronic
993483137 5:88449629-88449651 CTGAAAAGTGTAGGGGTAGAGGG + Intergenic
993872423 5:93268142-93268164 CAGGAACATGCAGGGGTGGAGGG - Intergenic
998584452 5:143412253-143412275 CCTCAAAGTGCAGGGGGGGAGGG + Intronic
999702207 5:154238521-154238543 GGGTAAAGCGCAGGGGGAGAAGG - Intronic
1001161654 5:169322399-169322421 CGGTAAATTGGAGAGGTGGAAGG + Intergenic
1003564155 6:7208400-7208422 GGGTGAACTGCAGGGTTGGAGGG - Intronic
1004492537 6:16129684-16129706 CGGGAAAGTGCTGGGTTGGGGGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006092270 6:31635095-31635117 CAGTAAAGTGCATTGGGGGAGGG - Intronic
1006591354 6:35160375-35160397 CGGCAGAGTGTAGGGGTTGAGGG - Intergenic
1006996237 6:38263990-38264012 AGGTAAAGAGCAGGGGTGGTGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1010364084 6:75029640-75029662 CTCTAAAGGACAGGGGTGGAAGG + Intergenic
1012835220 6:104256055-104256077 AGGTAAAGTGTAGGGGTACAGGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015786479 6:136924077-136924099 CGGGAAGGTCCAGGCGTGGATGG - Exonic
1016932140 6:149422006-149422028 ATTTAAAGTGCAGGGGAGGATGG - Intergenic
1018253543 6:161895846-161895868 GGGTAAGGGGCAGGGTTGGAGGG + Intronic
1018871821 6:167789909-167789931 GGATAGTGTGCAGGGGTGGATGG - Intronic
1018871863 6:167790068-167790090 TGGTTGAGTGCAGGGGTGGATGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022309012 7:29177706-29177728 TGGTAAAGTGGATGGATGGATGG - Intronic
1023845125 7:44116183-44116205 CGGGAACATGCAGGGGTGGAGGG + Exonic
1025017342 7:55449761-55449783 GGGCACAGTGCGGGGGTGGAGGG - Intronic
1026925274 7:74187829-74187851 CTGTAAAGTGTAGGGGAGGATGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029420535 7:100469627-100469649 CGCCAGAGTGCAGGGGTGCAAGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1033290718 7:140080517-140080539 CGGTAGAGAGCAGCGGAGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035600553 8:894672-894694 GGGGAAAGTGGAGCGGTGGATGG + Intergenic
1036710632 8:11076273-11076295 CGATAAAGTTCTGGAGTGGATGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1038095902 8:24309652-24309674 CTTTAAAATGCAGGGATGGATGG + Intronic
1038934204 8:32230401-32230423 CTGAGAAGTGCAGGGGTGGCAGG - Intronic
1039441400 8:37597896-37597918 CACAAAAGTGAAGGGGTGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046517986 8:115288258-115288280 AAGGAAAGTGAAGGGGTGGAAGG - Intergenic
1052223820 9:26059964-26059986 AGGTAAGGGGCAGGGGTGGTAGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056789751 9:89617840-89617862 AGGTAAAGTGCAGAGGGGCAAGG - Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1060206410 9:121685158-121685180 CCGTGAAGGGCAGGGATGGAGGG - Intronic
1060232370 9:121835101-121835123 CTGTAAAGTGAGGGGCTGGACGG + Intronic
1061043354 9:128151890-128151912 GGGTAACCTGCAGGCGTGGACGG - Exonic
1061193746 9:129096338-129096360 CAGGAAAGTGCAGGGTTGTAGGG + Intronic
1061491018 9:130944438-130944460 TGGAAGAGTGGAGGGGTGGAGGG + Intergenic
1062049200 9:134438467-134438489 CGCTGAAAGGCAGGGGTGGAGGG - Intronic
1185755460 X:2649924-2649946 GGGTAAAATGGAGGGATGGATGG + Intergenic
1185837775 X:3361074-3361096 CGGAAGAGTGCAGCGGCGGACGG - Intergenic
1186812893 X:13207628-13207650 CTGGAAAGTGGGGGGGTGGATGG - Intergenic
1188987681 X:36781952-36781974 CAGAAAAATGCATGGGTGGATGG - Intergenic
1189556652 X:42152283-42152305 AGGTAAAGTGCAGGTGAGCAAGG + Intergenic
1189601604 X:42632651-42632673 GGGTAAAGTGAAGGACTGGAGGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191699418 X:64023488-64023510 CTGAAAAGTTCAGGGGTAGATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199926829 X:152475933-152475955 GGGAAAAGTGCAGGGGGGCAAGG + Intergenic