ID: 1118844021

View in Genome Browser
Species Human (GRCh38)
Location 14:69532941-69532963
Sequence TCAGAAGAGCTGTAAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118844021_1118844029 25 Left 1118844021 14:69532941-69532963 CCCATGGCTTACAGCTCTTCTGA No data
Right 1118844029 14:69532989-69533011 TACTGGGTTAAAGGTGTTCATGG No data
1118844021_1118844030 26 Left 1118844021 14:69532941-69532963 CCCATGGCTTACAGCTCTTCTGA No data
Right 1118844030 14:69532990-69533012 ACTGGGTTAAAGGTGTTCATGGG No data
1118844021_1118844025 8 Left 1118844021 14:69532941-69532963 CCCATGGCTTACAGCTCTTCTGA No data
Right 1118844025 14:69532972-69532994 TGAACTTCACTCCATCTTACTGG No data
1118844021_1118844027 16 Left 1118844021 14:69532941-69532963 CCCATGGCTTACAGCTCTTCTGA No data
Right 1118844027 14:69532980-69533002 ACTCCATCTTACTGGGTTAAAGG No data
1118844021_1118844026 9 Left 1118844021 14:69532941-69532963 CCCATGGCTTACAGCTCTTCTGA No data
Right 1118844026 14:69532973-69532995 GAACTTCACTCCATCTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118844021 Original CRISPR TCAGAAGAGCTGTAAGCCAT GGG (reversed) Intergenic