ID: 1118844023

View in Genome Browser
Species Human (GRCh38)
Location 14:69532964-69532986
Sequence ATGGAGTGAAGTTCATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118844023_1118844031 12 Left 1118844023 14:69532964-69532986 CCCAGAAATGAACTTCACTCCAT No data
Right 1118844031 14:69532999-69533021 AAGGTGTTCATGGGAAATATAGG No data
1118844023_1118844029 2 Left 1118844023 14:69532964-69532986 CCCAGAAATGAACTTCACTCCAT No data
Right 1118844029 14:69532989-69533011 TACTGGGTTAAAGGTGTTCATGG No data
1118844023_1118844030 3 Left 1118844023 14:69532964-69532986 CCCAGAAATGAACTTCACTCCAT No data
Right 1118844030 14:69532990-69533012 ACTGGGTTAAAGGTGTTCATGGG No data
1118844023_1118844027 -7 Left 1118844023 14:69532964-69532986 CCCAGAAATGAACTTCACTCCAT No data
Right 1118844027 14:69532980-69533002 ACTCCATCTTACTGGGTTAAAGG No data
1118844023_1118844032 30 Left 1118844023 14:69532964-69532986 CCCAGAAATGAACTTCACTCCAT No data
Right 1118844032 14:69533017-69533039 ATAGGAAATACTCTAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118844023 Original CRISPR ATGGAGTGAAGTTCATTTCT GGG (reversed) Intergenic