ID: 1118844024

View in Genome Browser
Species Human (GRCh38)
Location 14:69532965-69532987
Sequence GATGGAGTGAAGTTCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118844024_1118844031 11 Left 1118844024 14:69532965-69532987 CCAGAAATGAACTTCACTCCATC No data
Right 1118844031 14:69532999-69533021 AAGGTGTTCATGGGAAATATAGG No data
1118844024_1118844027 -8 Left 1118844024 14:69532965-69532987 CCAGAAATGAACTTCACTCCATC No data
Right 1118844027 14:69532980-69533002 ACTCCATCTTACTGGGTTAAAGG No data
1118844024_1118844032 29 Left 1118844024 14:69532965-69532987 CCAGAAATGAACTTCACTCCATC No data
Right 1118844032 14:69533017-69533039 ATAGGAAATACTCTAAGTCCAGG No data
1118844024_1118844029 1 Left 1118844024 14:69532965-69532987 CCAGAAATGAACTTCACTCCATC No data
Right 1118844029 14:69532989-69533011 TACTGGGTTAAAGGTGTTCATGG No data
1118844024_1118844030 2 Left 1118844024 14:69532965-69532987 CCAGAAATGAACTTCACTCCATC No data
Right 1118844030 14:69532990-69533012 ACTGGGTTAAAGGTGTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118844024 Original CRISPR GATGGAGTGAAGTTCATTTC TGG (reversed) Intergenic
No off target data available for this crispr