ID: 1118844028

View in Genome Browser
Species Human (GRCh38)
Location 14:69532983-69533005
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118844028_1118844040 28 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844040 14:69533034-69533056 TCCAGGAGTCCTGGGGGGTGGGG No data
1118844028_1118844038 26 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844038 14:69533032-69533054 AGTCCAGGAGTCCTGGGGGGTGG No data
1118844028_1118844035 21 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844035 14:69533027-69533049 CTCTAAGTCCAGGAGTCCTGGGG No data
1118844028_1118844036 22 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844036 14:69533028-69533050 TCTAAGTCCAGGAGTCCTGGGGG No data
1118844028_1118844037 23 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844037 14:69533029-69533051 CTAAGTCCAGGAGTCCTGGGGGG No data
1118844028_1118844034 20 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844034 14:69533026-69533048 ACTCTAAGTCCAGGAGTCCTGGG No data
1118844028_1118844031 -7 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844031 14:69532999-69533021 AAGGTGTTCATGGGAAATATAGG No data
1118844028_1118844033 19 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844033 14:69533025-69533047 TACTCTAAGTCCAGGAGTCCTGG No data
1118844028_1118844032 11 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844032 14:69533017-69533039 ATAGGAAATACTCTAAGTCCAGG No data
1118844028_1118844039 27 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844039 14:69533033-69533055 GTCCAGGAGTCCTGGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118844028 Original CRISPR ACACCTTTAACCCAGTAAGA TGG (reversed) Intergenic