ID: 1118844029

View in Genome Browser
Species Human (GRCh38)
Location 14:69532989-69533011
Sequence TACTGGGTTAAAGGTGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118844022_1118844029 24 Left 1118844022 14:69532942-69532964 CCATGGCTTACAGCTCTTCTGAC No data
Right 1118844029 14:69532989-69533011 TACTGGGTTAAAGGTGTTCATGG No data
1118844024_1118844029 1 Left 1118844024 14:69532965-69532987 CCAGAAATGAACTTCACTCCATC No data
Right 1118844029 14:69532989-69533011 TACTGGGTTAAAGGTGTTCATGG No data
1118844023_1118844029 2 Left 1118844023 14:69532964-69532986 CCCAGAAATGAACTTCACTCCAT No data
Right 1118844029 14:69532989-69533011 TACTGGGTTAAAGGTGTTCATGG No data
1118844020_1118844029 28 Left 1118844020 14:69532938-69532960 CCACCCATGGCTTACAGCTCTTC No data
Right 1118844029 14:69532989-69533011 TACTGGGTTAAAGGTGTTCATGG No data
1118844021_1118844029 25 Left 1118844021 14:69532941-69532963 CCCATGGCTTACAGCTCTTCTGA No data
Right 1118844029 14:69532989-69533011 TACTGGGTTAAAGGTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118844029 Original CRISPR TACTGGGTTAAAGGTGTTCA TGG Intergenic
No off target data available for this crispr