ID: 1118844032

View in Genome Browser
Species Human (GRCh38)
Location 14:69533017-69533039
Sequence ATAGGAAATACTCTAAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118844024_1118844032 29 Left 1118844024 14:69532965-69532987 CCAGAAATGAACTTCACTCCATC No data
Right 1118844032 14:69533017-69533039 ATAGGAAATACTCTAAGTCCAGG No data
1118844028_1118844032 11 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844032 14:69533017-69533039 ATAGGAAATACTCTAAGTCCAGG No data
1118844023_1118844032 30 Left 1118844023 14:69532964-69532986 CCCAGAAATGAACTTCACTCCAT No data
Right 1118844032 14:69533017-69533039 ATAGGAAATACTCTAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118844032 Original CRISPR ATAGGAAATACTCTAAGTCC AGG Intergenic
No off target data available for this crispr