ID: 1118844033 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:69533025-69533047 |
| Sequence | TACTCTAAGTCCAGGAGTCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1118844028_1118844033 | 19 | Left | 1118844028 | 14:69532983-69533005 | CCATCTTACTGGGTTAAAGGTGT | No data | ||
| Right | 1118844033 | 14:69533025-69533047 | TACTCTAAGTCCAGGAGTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1118844033 | Original CRISPR | TACTCTAAGTCCAGGAGTCC TGG | Intergenic | ||