ID: 1118844037

View in Genome Browser
Species Human (GRCh38)
Location 14:69533029-69533051
Sequence CTAAGTCCAGGAGTCCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118844028_1118844037 23 Left 1118844028 14:69532983-69533005 CCATCTTACTGGGTTAAAGGTGT No data
Right 1118844037 14:69533029-69533051 CTAAGTCCAGGAGTCCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118844037 Original CRISPR CTAAGTCCAGGAGTCCTGGG GGG Intergenic