ID: 1118846523

View in Genome Browser
Species Human (GRCh38)
Location 14:69551472-69551494
Sequence ATGCTGGGTAACAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118846523_1118846528 -6 Left 1118846523 14:69551472-69551494 CCTCAGGGCCTGTTACCCAGCAT No data
Right 1118846528 14:69551489-69551511 CAGCATGAGCTAAAGTCCTTGGG No data
1118846523_1118846527 -7 Left 1118846523 14:69551472-69551494 CCTCAGGGCCTGTTACCCAGCAT No data
Right 1118846527 14:69551488-69551510 CCAGCATGAGCTAAAGTCCTTGG No data
1118846523_1118846530 16 Left 1118846523 14:69551472-69551494 CCTCAGGGCCTGTTACCCAGCAT No data
Right 1118846530 14:69551511-69551533 GAGCTTCTAAGACCACTTGAAGG No data
1118846523_1118846531 19 Left 1118846523 14:69551472-69551494 CCTCAGGGCCTGTTACCCAGCAT No data
Right 1118846531 14:69551514-69551536 CTTCTAAGACCACTTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118846523 Original CRISPR ATGCTGGGTAACAGGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr