ID: 1118847260

View in Genome Browser
Species Human (GRCh38)
Location 14:69556975-69556997
Sequence GTGTAGAGAAGGATCAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118847255_1118847260 24 Left 1118847255 14:69556928-69556950 CCATGTCAGATGGTCCTAAAGAA No data
Right 1118847260 14:69556975-69556997 GTGTAGAGAAGGATCAGAACAGG No data
1118847254_1118847260 28 Left 1118847254 14:69556924-69556946 CCATCCATGTCAGATGGTCCTAA No data
Right 1118847260 14:69556975-69556997 GTGTAGAGAAGGATCAGAACAGG No data
1118847256_1118847260 10 Left 1118847256 14:69556942-69556964 CCTAAAGAAACACTCACTAACCC No data
Right 1118847260 14:69556975-69556997 GTGTAGAGAAGGATCAGAACAGG No data
1118847257_1118847260 -10 Left 1118847257 14:69556962-69556984 CCCTTGTTCTCATGTGTAGAGAA No data
Right 1118847260 14:69556975-69556997 GTGTAGAGAAGGATCAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118847260 Original CRISPR GTGTAGAGAAGGATCAGAAC AGG Intergenic
No off target data available for this crispr