ID: 1118851086

View in Genome Browser
Species Human (GRCh38)
Location 14:69584052-69584074
Sequence CACTGCTGCTGCCTTAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118851086_1118851088 -6 Left 1118851086 14:69584052-69584074 CCTGAACTAAGGCAGCAGCAGTG No data
Right 1118851088 14:69584069-69584091 GCAGTGAGGATAGAGAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118851086 Original CRISPR CACTGCTGCTGCCTTAGTTC AGG (reversed) Intergenic
No off target data available for this crispr