ID: 1118851429

View in Genome Browser
Species Human (GRCh38)
Location 14:69586867-69586889
Sequence CATCACAGAGAGTTCGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118851422_1118851429 29 Left 1118851422 14:69586815-69586837 CCCAGGGCTGGGTGCTCGGACTC No data
Right 1118851429 14:69586867-69586889 CATCACAGAGAGTTCGTGGATGG No data
1118851423_1118851429 28 Left 1118851423 14:69586816-69586838 CCAGGGCTGGGTGCTCGGACTCA No data
Right 1118851429 14:69586867-69586889 CATCACAGAGAGTTCGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118851429 Original CRISPR CATCACAGAGAGTTCGTGGA TGG Intergenic
No off target data available for this crispr