ID: 1118858548

View in Genome Browser
Species Human (GRCh38)
Location 14:69643544-69643566
Sequence GGTTTAATGGGACCATGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118858548_1118858555 26 Left 1118858548 14:69643544-69643566 CCTGATCATGGTCCCATTAAACC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1118858555 14:69643593-69643615 AGAATTGGTGAGCAAACAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208
1118858548_1118858554 11 Left 1118858548 14:69643544-69643566 CCTGATCATGGTCCCATTAAACC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1118858554 14:69643578-69643600 CTGAACTAACTAGTCAGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118858548 Original CRISPR GGTTTAATGGGACCATGATC AGG (reversed) Intronic
911304007 1:96210931-96210953 CTTCTAATGGGACCATGCTCTGG + Intergenic
920649133 1:207823731-207823753 GGTTTGATGGGACCAAATTCTGG - Intergenic
922076845 1:222253622-222253644 GGTTTTATGGGCACAGGATCAGG - Intergenic
922217049 1:223528407-223528429 GGTTTAATGGGGCAATGGACAGG - Intergenic
1064818958 10:19301836-19301858 GGTTCAATGGGTCCATGGGCAGG - Intronic
1070476431 10:76833832-76833854 GGCTTTATGGGACCTTGCTCAGG + Intergenic
1070951981 10:80438573-80438595 GGTTTAACTGGACTAGGATCTGG - Intergenic
1073034701 10:100555464-100555486 AGATTAATGGGATCATGATGTGG - Exonic
1076021216 10:127075564-127075586 GGTTTAACGGAAGCATGATTAGG + Intronic
1078469225 11:11573742-11573764 GGTTTATTGAGACCATGATGAGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1092215421 12:6678530-6678552 GGGTTAATTAGACAATGATCTGG - Intronic
1097367303 12:58731311-58731333 GGCTTAAGGGCCCCATGATCTGG - Intronic
1099717277 12:86311721-86311743 GGTTTGATGGGACATGGATCAGG + Intronic
1101574539 12:105985293-105985315 GGTTTAATGGCATCATCACCTGG - Intergenic
1105674215 13:22652894-22652916 AGATTAATGGCACCATTATCAGG - Intergenic
1109882167 13:68494048-68494070 GCTTTTTTGGGACCATGATGAGG + Intergenic
1115155966 14:30339559-30339581 GGTTTAGATGGACAATGATCTGG - Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1120584015 14:86288175-86288197 GGTTTATTGGGAACTTGGTCAGG + Intergenic
1126056674 15:44736248-44736270 GGTGTGATGGGATCATGAACAGG + Intronic
1127688143 15:61368575-61368597 GGATTCATGGGACCTTGATGAGG + Intergenic
1131056302 15:89377402-89377424 GATTTGAAGGGACCAGGATCTGG + Intergenic
1132070177 15:98769673-98769695 GGTTTAATTAGACCAGGATATGG + Intronic
1132560446 16:590932-590954 GGTGTCATGGGTCCAGGATCTGG + Intronic
1139156904 16:64454506-64454528 GTTGTAATGGGAGCATGATAAGG - Intergenic
1146509081 17:33430272-33430294 GGTTTTATGGGACCAGGAGTTGG + Intronic
1156578027 18:38342052-38342074 GGGTTAATGGTAGCATGCTCTGG + Intergenic
1157189863 18:45571988-45572010 GGTTTAATTGGTCCAGGATGGGG - Intronic
1160020224 18:75174629-75174651 GGTTTAATCTGACAATGCTCAGG + Intergenic
1168603810 19:57741874-57741896 GGTTTAGTGGGAGCATAAGCAGG + Intronic
929635740 2:43519516-43519538 GATTGTATGGGACCATGATGAGG - Intronic
932958612 2:76385960-76385982 GGTTTAATGAAACCATGATTAGG + Intergenic
934563181 2:95323660-95323682 GGCTTAAAGGCACCAGGATCTGG + Intronic
943532823 2:189107459-189107481 GTTTTTATGGGACCATGTTTTGG + Intronic
944463251 2:199974469-199974491 GGTTGAGTGAGACCATGTTCTGG - Intronic
947043434 2:225949868-225949890 GGTTGAATGGATCCATGCTCAGG - Intergenic
1177923705 21:27186977-27186999 GATTTACCGGGAGCATGATCTGG + Intergenic
1181683649 22:24513999-24514021 AGTTTCATGTGCCCATGATCAGG + Intronic
1185318878 22:50191117-50191139 GGTGCAATGGGGCCATGGTCGGG - Intronic
950848419 3:16037906-16037928 GGTTTAAGGGGTACATGTTCAGG + Intergenic
958821421 3:98977960-98977982 GGTTTTTTTAGACCATGATCTGG + Intergenic
959900453 3:111655015-111655037 GGCTGAATGGGAAGATGATCAGG + Intronic
960624512 3:119667804-119667826 GGTTTAATGGAAACATAATAAGG - Intronic
966637010 3:182146644-182146666 GGCTTAAGGGGACAAGGATCTGG - Intergenic
970708512 4:18834095-18834117 GGCCTAATGGGATCATGATGTGG - Intergenic
988062448 5:26189846-26189868 AGTTTAAAGAGACAATGATCTGG - Intergenic
989034194 5:37152413-37152435 GGTTAAATGAGACCATGGTTGGG - Intronic
992596362 5:78351417-78351439 GATTTAATTGGCCCATGATTTGG - Intergenic
998197126 5:140083849-140083871 GTTTTATTGGAACCAGGATCAGG + Intergenic
1007053500 6:38857969-38857991 GGTTTAATGGAACAATTAGCTGG - Intronic
1009810728 6:68661846-68661868 GCCTTAATGGGACCATGATGAGG + Intronic
1010642018 6:78340733-78340755 TATTTAATGGTCCCATGATCGGG + Intergenic
1011590019 6:88963181-88963203 GGATGAATGGGAACATGAACGGG - Intronic
1016372207 6:143386811-143386833 GGTTCAAGGGGTCCATGTTCAGG + Intergenic
1025760916 7:64390576-64390598 GGGTTAATGACACCATGTTCTGG + Intergenic
1036064228 8:5359916-5359938 TGTTTTATGGGACAATAATCTGG + Intergenic
1044192176 8:89332073-89332095 GGTTTATAGGGAACATGATTTGG - Intergenic
1044207087 8:89503163-89503185 GGTTTAATGGACTCATGACCGGG - Intergenic
1045476966 8:102561357-102561379 GGTTTTACTGGACAATGATCAGG + Intergenic
1048161628 8:132026849-132026871 GGTTTCTTGGGCTCATGATCTGG + Intronic
1061008131 9:127939921-127939943 GGTTTAAAGGGGCCATGAGTCGG + Intergenic
1185854107 X:3517817-3517839 GGTATAATGTAACCATGATTTGG + Intergenic
1187741372 X:22359527-22359549 GTTTTAAAGGGACAATGATTGGG - Intergenic
1200886964 Y:8280305-8280327 GGCATAATGGGACCAGGACCGGG - Intergenic