ID: 1118858554

View in Genome Browser
Species Human (GRCh38)
Location 14:69643578-69643600
Sequence CTGAACTAACTAGTCAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118858552_1118858554 -2 Left 1118858552 14:69643557-69643579 CCATTAAACCTGGGCAAACAACT 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1118858554 14:69643578-69643600 CTGAACTAACTAGTCAGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1118858546_1118858554 20 Left 1118858546 14:69643535-69643557 CCTGTACCTCCTGATCATGGTCC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1118858554 14:69643578-69643600 CTGAACTAACTAGTCAGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1118858548_1118858554 11 Left 1118858548 14:69643544-69643566 CCTGATCATGGTCCCATTAAACC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1118858554 14:69643578-69643600 CTGAACTAACTAGTCAGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1118858553_1118858554 -10 Left 1118858553 14:69643565-69643587 CCTGGGCAAACAACTGAACTAAC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1118858554 14:69643578-69643600 CTGAACTAACTAGTCAGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1118858547_1118858554 14 Left 1118858547 14:69643541-69643563 CCTCCTGATCATGGTCCCATTAA 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1118858554 14:69643578-69643600 CTGAACTAACTAGTCAGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1118858551_1118858554 -1 Left 1118858551 14:69643556-69643578 CCCATTAAACCTGGGCAAACAAC 0: 1
1: 0
2: 2
3: 58
4: 461
Right 1118858554 14:69643578-69643600 CTGAACTAACTAGTCAGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118858554 Original CRISPR CTGAACTAACTAGTCAGAAT TGG Intronic
907110013 1:51918707-51918729 TAGAACTGACTAGTCAGACTAGG + Exonic
908607994 1:65821726-65821748 CTGCACTAAATAGGCAAAATTGG - Intronic
909566749 1:77061122-77061144 CTGCAATAACTAGTCAGGAAAGG + Intronic
910267899 1:85359369-85359391 GTGTGCTAACTGGTCAGAATTGG - Intronic
913359604 1:117965418-117965440 CTCAACTGAGAAGTCAGAATTGG - Exonic
918418882 1:184341473-184341495 TTGATGTAACTAGTGAGAATGGG - Intergenic
919229327 1:194753509-194753531 GTGAAATACCTAGTGAGAATGGG + Intergenic
923343180 1:233024693-233024715 CTAAACCATCCAGTCAGAATTGG - Intronic
923955515 1:239014106-239014128 CTGAACTAATTAGGCAGAAAGGG - Intergenic
924927807 1:248700059-248700081 CTGTACTAAGTAGTCAGCAGTGG - Intergenic
1067112966 10:43413603-43413625 CTGACCTGTCTAGTCAGTATAGG + Intergenic
1067717570 10:48701186-48701208 GTGAACTAACCAGTCACAAAAGG - Intronic
1068282254 10:54889136-54889158 CTGTACTAAATAGTAAAAATAGG - Intronic
1069315371 10:67093247-67093269 CTGAACTAGCTAGTTGGAATAGG - Intronic
1071320161 10:84447102-84447124 CTGAAGTATCTAATTAGAATTGG + Intronic
1071446361 10:85751985-85752007 CTAACCTGACTAGTCAGAGTAGG - Intronic
1073589001 10:104738286-104738308 CTGAACTATCAAGTAAGAAAGGG - Intronic
1074992593 10:118723626-118723648 CAGAAATAACTAGTCATAGTAGG - Intronic
1075750235 10:124762926-124762948 CTGAACTAACCCTACAGAATTGG + Intronic
1078312460 11:10258714-10258736 CTGAGATAACTGGACAGAATAGG + Intronic
1078344158 11:10529239-10529261 CTGAACTCACTGGTCAGTATTGG - Intronic
1079967844 11:27000824-27000846 CTGAACTAGCTAGACAGGAATGG + Intergenic
1079976484 11:27098005-27098027 CTGAACAAACAAGTGAGAAAGGG - Intronic
1080274033 11:30483527-30483549 CAAAACTAACTAGTTGGAATAGG - Intronic
1085906056 11:80764468-80764490 CTGGACTTACTTGTTAGAATTGG + Intergenic
1087250043 11:95888792-95888814 CTGAACTTTCTGGCCAGAATTGG - Intronic
1092696373 12:11176045-11176067 CTGAACAAACTAGACTTAATAGG + Intergenic
1096058181 12:48673112-48673134 CTCAAATAACTAGTCAAAATGGG + Intronic
1096267738 12:50137428-50137450 CTCAGGAAACTAGTCAGAATTGG - Intronic
1100676020 12:96869111-96869133 TTAAACTAATTAGTCAGAAATGG - Intronic
1102500583 12:113349405-113349427 ATGAACTAACCAATCAGAATGGG + Intronic
1103660493 12:122511405-122511427 TTGAATTGACTAGTCAGAAATGG + Intronic
1109925394 13:69130854-69130876 CTTAACCAATTATTCAGAATTGG + Intergenic
1111691389 13:91567608-91567630 ATTAACTAACCAATCAGAATGGG - Intronic
1115431243 14:33321211-33321233 TTGAACTAATTAAGCAGAATGGG - Intronic
1116993392 14:51298624-51298646 CAGACATAACTAGTAAGAATGGG + Intergenic
1118544123 14:66866018-66866040 CTTAATTACCTGGTCAGAATGGG - Intronic
1118858554 14:69643578-69643600 CTGAACTAACTAGTCAGAATTGG + Intronic
1119970360 14:78963329-78963351 GAGAACTAAGAAGTCAGAATGGG - Intronic
1123134900 14:106018455-106018477 CTGAACTAAATAAACAGAAAGGG - Intergenic
1123585448 15:21756330-21756352 CTGAACTAAATAAACAGAAAGGG - Intergenic
1123622089 15:22198918-22198940 CTGAACTAAATAAACAGAAAGGG - Intergenic
1126427248 15:48542025-48542047 TTGAGCTAACCACTCAGAATGGG - Intronic
1130233922 15:82117055-82117077 CAGACCTAACAAGTCAGAAATGG - Intergenic
1135692269 16:24549744-24549766 CTGCACTAACTAGATAGAAGTGG - Intronic
1137984374 16:53095142-53095164 ATGAACTCAATATTCAGAATAGG - Intronic
1140743493 16:77961971-77961993 CTAGACACACTAGTCAGAATGGG - Intronic
1142546021 17:703431-703453 CTGAACTAACTGATGAGAGTGGG - Intronic
1155187883 18:23403353-23403375 CTGACCTAATCAGTGAGAATAGG + Intronic
1155962155 18:32003719-32003741 CTGAACTAACCTGTAAGACTTGG - Intergenic
1159579021 18:70214070-70214092 CAAAATGAACTAGTCAGAATAGG + Intergenic
1164493221 19:28733522-28733544 CTCAAATAACTAGTCATAAAAGG - Intergenic
1168006501 19:53493956-53493978 CTGAACAAAATAGACAGAAAAGG - Exonic
928449911 2:31368864-31368886 CAGTACTAAATACTCAGAATTGG - Intronic
932643560 2:73477837-73477859 CTGAACTTATTAGTCTTAATTGG + Intronic
933595109 2:84275443-84275465 CTAGACTAATTAGGCAGAATGGG + Intergenic
937601723 2:123744773-123744795 GTGAAATAACTAGTCATAAGAGG - Intergenic
942462183 2:176175901-176175923 CTGAACTAGCCAGGAAGAATGGG + Intergenic
947584070 2:231341418-231341440 CTTAACTAACTGGTCAAAACTGG + Intronic
948042270 2:234911904-234911926 ATGAACCACCTAGTCAGAGTTGG + Intergenic
1170028364 20:11916279-11916301 TTGACCTAATTATTCAGAATAGG - Intronic
1172048820 20:32100903-32100925 CTGAACTAACCAGTCACCAATGG - Intronic
1172258665 20:33542112-33542134 CAGAACCAAGTAATCAGAATAGG - Intronic
949975817 3:9458044-9458066 TGGAACAAAATAGTCAGAATAGG + Intronic
952331996 3:32372093-32372115 CTGAAATAACTAGTCACAGTTGG + Intergenic
958122184 3:89305211-89305233 CTGAAATATGTATTCAGAATAGG - Intronic
959453333 3:106529802-106529824 CAGAACTTACTTGACAGAATGGG - Intergenic
965686352 3:171306922-171306944 GGGAACTGACTAGTCAGACTTGG + Intronic
966127561 3:176597469-176597491 CTGAACTAACTGGGCAAGATAGG - Intergenic
968716487 4:2163694-2163716 CTGATCCCACGAGTCAGAATTGG - Intronic
976572110 4:86624502-86624524 CTGAACTAACTATTCAACAAAGG - Intronic
978253738 4:106667302-106667324 CTTAACAAACTAGTCATAAAAGG - Intergenic
978978149 4:114906505-114906527 CTGAACTAGAGAGACAGAATGGG - Intronic
979852947 4:125595661-125595683 CTGAACTATCTTGTCAGACCTGG + Intergenic
983878338 4:172903314-172903336 TTTAACTAACTAGTCAGACTTGG + Intronic
986014266 5:3743964-3743986 CTGAAATAGCCATTCAGAATTGG + Intergenic
987774779 5:22350383-22350405 TTGAACTACGCAGTCAGAATAGG + Intronic
990542239 5:56785340-56785362 TTGTACTAACAAGTTAGAATTGG - Intergenic
991968663 5:72116838-72116860 ATGACCTAACCAGTCAAAATAGG - Intronic
992277845 5:75139683-75139705 GTGAACTGACTTGGCAGAATGGG + Intronic
995318325 5:110801834-110801856 CTTAACTAACTAGACTTAATAGG - Intergenic
1000081508 5:157852187-157852209 CTGAACAAAATATTAAGAATTGG + Intronic
1002586548 5:180252426-180252448 CTGGACTAACGAGTTAGACTGGG + Intronic
1005266385 6:24116458-24116480 CTGAACTAACTCTACAGTATTGG + Intergenic
1011130870 6:84050871-84050893 CTGTACAAACTGGTCAGCATAGG + Intronic
1011890290 6:92150901-92150923 ATGAAACAACTAGTCAGAACAGG - Intergenic
1013164658 6:107578962-107578984 CTGAAATCACTAGGCAGAAGGGG - Intronic
1016116636 6:140293768-140293790 CTGAACAAACTAGTCATAGAAGG + Intergenic
1016279119 6:142393802-142393824 CTGAAATAAAGAGACAGAATGGG - Intronic
1021344314 7:19505842-19505864 CAGAACAAACTAGACTGAATGGG + Intergenic
1022280195 7:28900496-28900518 CTGAGCTAAATCTTCAGAATTGG - Intergenic
1023244455 7:38186230-38186252 CAGAACTAATGAGTCAAAATTGG + Intronic
1023360009 7:39406220-39406242 CTGAGGTAACCAGACAGAATAGG - Intronic
1030433064 7:109477472-109477494 CTGAAATCACTTGTCAGAAAAGG + Intergenic
1030502677 7:110379950-110379972 CTGCACTAACTATAAAGAATAGG + Intergenic
1034496443 7:151426086-151426108 CTCAACTAAATAGTGAGGATCGG + Intergenic
1038033206 8:23662695-23662717 CTGAGCTAACCAGTCAAAACAGG - Intergenic
1061524784 9:131150479-131150501 ATGAACTAACTAGTCATACAGGG - Intronic
1186297582 X:8167223-8167245 GTGAACGAGCTAGTCAGGATGGG + Intergenic
1186325292 X:8470147-8470169 GTGAAATAGCTAGTCAGGATGGG - Intergenic
1186376616 X:9010031-9010053 GTGAAATAGCTAGTCAGGATGGG - Intergenic
1189145262 X:38649264-38649286 CTGAGCTCACAAGTCAGAAGGGG + Intronic
1190142593 X:47861222-47861244 CTGAACTAACTACCCAGTGTTGG - Intronic
1197886671 X:131225145-131225167 TTGAACTAAATAGTGAGACTTGG - Intergenic