ID: 1118860437

View in Genome Browser
Species Human (GRCh38)
Location 14:69658815-69658837
Sequence CAGGGAGAGCAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1318
Summary {0: 1, 1: 0, 2: 17, 3: 128, 4: 1172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118860432_1118860437 -8 Left 1118860432 14:69658800-69658822 CCTGGCAGGCGGTTTCAGGGAGA 0: 1
1: 0
2: 0
3: 13
4: 208
Right 1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG 0: 1
1: 0
2: 17
3: 128
4: 1172
1118860430_1118860437 -5 Left 1118860430 14:69658797-69658819 CCTCCTGGCAGGCGGTTTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 121
Right 1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG 0: 1
1: 0
2: 17
3: 128
4: 1172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118860437 Original CRISPR CAGGGAGAGCAGAGGGTGGA GGG Intronic
900123756 1:1060427-1060449 CAGGGAGCGCCGAGGGGGGCCGG + Intergenic
900285709 1:1899360-1899382 CAGGGGGAGCAGAGGCTGCTGGG + Intergenic
900386522 1:2413294-2413316 CAGGCAGGGTGGAGGGTGGAGGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900474318 1:2869139-2869161 CAGGGAGAGAACAGGCTGCAGGG + Intergenic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
900700779 1:4047477-4047499 CAGGGAGAGGAAGGGGAGGAAGG + Intergenic
900832813 1:4977328-4977350 CAGGGAGTGCTGAAGGTGCAAGG - Intergenic
900873558 1:5324626-5324648 CCCCGAGAGCAGGGGGTGGAGGG - Intergenic
901218386 1:7567507-7567529 CAGGGAAAGCAGTGGATGGATGG + Intronic
901403863 1:9032949-9032971 CAGGAATAGCAAAGGGAGGAAGG + Intergenic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901775949 1:11560540-11560562 CAGGTGGGGCAGAGGGTGGGGGG + Intergenic
901883055 1:12205162-12205184 GAGGGAGGCCAGGGGGTGGAGGG + Intronic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903161674 1:21493456-21493478 CAGGGAGTGGAGTTGGTGGAGGG - Intergenic
903201106 1:21739806-21739828 CAGGGAGTGGAGGTGGTGGATGG - Intronic
903221897 1:21873896-21873918 CAGGGGGTGGAGAGGGTGGGGGG - Intronic
903321869 1:22548174-22548196 CAGGGAGAGAGGGGTGTGGAAGG - Intergenic
903375927 1:22865982-22866004 TAGAGAGAGAACAGGGTGGAGGG - Intronic
903670527 1:25032928-25032950 CAGGGAGACCAGAATGTGAATGG - Intergenic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
904906257 1:33899390-33899412 CAGAAAGAGCAGAGGTTGGGAGG + Intronic
905033360 1:34902250-34902272 CAGGGACAGCATAGGGTTCAGGG + Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905312696 1:37061226-37061248 CAGAGAGAGCCCAGGGTGGCAGG - Intergenic
905709153 1:40086209-40086231 CAGGGAGTGTAGAGGTAGGAGGG + Intronic
905749687 1:40451175-40451197 TAGGGAGACGAGTGGGTGGAGGG + Intronic
905975479 1:42170991-42171013 GAGGGGGAGCAGATGGTGAACGG - Intergenic
906135974 1:43501244-43501266 AAGGGAGAGGGGAGGGGGGAGGG - Intergenic
906240570 1:44239796-44239818 GAGGGAGAGGAGGGAGTGGAGGG + Intronic
906261032 1:44390252-44390274 CAGGGAGAGAAGAGAGGGGTTGG + Intergenic
906541811 1:46592627-46592649 CAGGGAGAGCAGGGAGAGCAAGG + Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907289049 1:53401156-53401178 GAGGGAGAGAAGAGGGAGCAGGG + Intergenic
907303660 1:53502579-53502601 GAGGGAGAGAAGAGAGGGGAGGG + Intergenic
907303694 1:53502701-53502723 CAGAGAGAGGAGAGTGGGGAGGG + Intergenic
907303791 1:53502983-53503005 CAGGGAGAGAGGAGGGGGGAAGG + Intergenic
907323557 1:53620668-53620690 CAAGGAGGGCTGGGGGTGGAAGG + Intronic
907466910 1:54644294-54644316 GAGGGAGAGCAGGGGAGGGAGGG - Intronic
907500355 1:54875239-54875261 CAGGGAGAGCTGTGGGTACAGGG + Intronic
907523583 1:55040503-55040525 CATGGGCAGCGGAGGGTGGAGGG + Intronic
907970670 1:59377777-59377799 CTGGGAGGGCACAGGGTGGTGGG + Intronic
908550597 1:65205078-65205100 CAGGGAGGGGAGAGGAGGGAGGG - Intronic
908759390 1:67498070-67498092 GAGGGAGAGGTGAGGATGGAAGG + Intergenic
908783557 1:67713479-67713501 CAGGGAGAGCAGGGTGGGGATGG + Intronic
908959956 1:69684901-69684923 CAGGGAGAGCAGAGCAGGGATGG - Intronic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
909473808 1:76059516-76059538 CAGTGAAAGCAGCGGGTGGGAGG + Intergenic
909837872 1:80280205-80280227 CAGGGATAACAGAGTTTGGAAGG + Intergenic
910645226 1:89507210-89507232 GAGGGAGAGTGGAGAGTGGAGGG - Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911332536 1:96541869-96541891 TGGTGAGAGCACAGGGTGGAGGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
914753367 1:150550075-150550097 CAGGGAGACCTGGGGGTGAAGGG + Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
915314998 1:155023499-155023521 CAGGAAGCACAGAGGGTGGGTGG - Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915730046 1:158046884-158046906 AAAGGAGAGCAGAGCATGGAGGG + Intronic
915897853 1:159825346-159825368 AGGGGAGAGCAGAGCGTGCAGGG - Intergenic
915953868 1:160207442-160207464 CAGGCAGAGCAGAGGAGGGCCGG - Intronic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
917329601 1:173868225-173868247 GAGGAAGAGCAGAGAGGGGAGGG + Intronic
917798932 1:178552917-178552939 CAGGGAGAGAACAGGGAGCAAGG + Intergenic
918126092 1:181585276-181585298 CATGGAGAGGAGAGAGTAGAGGG + Intronic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
919495910 1:198267791-198267813 CAGGCAGAGGTGAGGGTGGTAGG - Intronic
919747132 1:201015857-201015879 CTGGGAGAGGAGAGGCTGGAGGG + Intronic
919810913 1:201408333-201408355 TGGGGAGAGCAGAGGCCGGAGGG + Exonic
919814878 1:201431081-201431103 CAGGCTGGGCACAGGGTGGAGGG - Intergenic
919918934 1:202156815-202156837 TAGGGAGAGCAGGGGAGGGAGGG + Intronic
919919606 1:202160333-202160355 CAAGGAGAGCAGAGGCTGAAGGG - Intronic
920011834 1:202873690-202873712 CAGGGACAGCACAGCCTGGATGG - Intergenic
920419331 1:205820465-205820487 CAGGGAGAGGAGGGGAGGGAAGG - Intergenic
921582966 1:216916247-216916269 CAGGGAGAGCTGAGGGTCCCTGG - Intronic
922022122 1:221716007-221716029 CAGGGAGAGAAGAGGGAGAGGGG - Intronic
922252709 1:223864427-223864449 CAGGGACAGCAGAGCCTGGATGG + Intergenic
922427679 1:225514742-225514764 TAGGGAGAGGAGGGGGAGGAGGG + Exonic
922471131 1:225877993-225878015 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
922504805 1:226120363-226120385 CAGGGTGAGCTGAGGCTGGTGGG + Intergenic
922588514 1:226754093-226754115 GGTGGAGAACAGAGGGTGGAGGG + Intergenic
922779225 1:228238117-228238139 AAAGGAGAGCAGCAGGTGGATGG - Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922905740 1:229172337-229172359 CAGGTAGGGCAGAGAGGGGAGGG + Intergenic
923662734 1:235972465-235972487 GCGGGAGAGGAGAGGGTGAAGGG - Intergenic
924440542 1:244082106-244082128 CAAGGACCCCAGAGGGTGGAGGG + Intergenic
924459639 1:244247620-244247642 GAGGGAGAGCAGAGACTGGGGGG + Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063367704 10:5501029-5501051 CAGGCAGAGCAGTGAGAGGAGGG + Intergenic
1063690211 10:8280079-8280101 AAGGAAGAAGAGAGGGTGGAAGG + Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065728772 10:28691716-28691738 GAGGGAGTGGAGAGGGGGGATGG - Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067024971 10:42836899-42836921 CAGGCACAGCAGGGGGTAGAGGG - Intergenic
1067224904 10:44369283-44369305 CAGAGGGAGCAGAGAGTGAATGG + Intergenic
1067338767 10:45384305-45384327 CAGGGACAGCACAGGTTGGAGGG + Intronic
1067438128 10:46292990-46293012 GACGGAGAGGAGAGGGAGGAGGG + Intronic
1067574933 10:47403127-47403149 GAGGGAGAGGAGGGGGAGGAGGG + Intergenic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068545037 10:58335308-58335330 CGGGGAGAGCAAGGGATGGAAGG + Intronic
1068662497 10:59637113-59637135 CAGGGAGCGGAGAGACTGGATGG - Intergenic
1068709771 10:60121332-60121354 GAGGGAGTGCAGGGGGTGGAGGG + Intronic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1069050336 10:63785881-63785903 CAGGCAGAGCAGAGAATGGATGG - Intergenic
1069265704 10:66454806-66454828 GAGGGAGAGGAGGGGGAGGAGGG + Intronic
1069385921 10:67883641-67883663 CAGGGAGAGAGGAAAGTGGAAGG + Intergenic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1069742740 10:70695868-70695890 CAGGGAGAGCTGATGATGGGAGG + Intronic
1069751408 10:70747580-70747602 TGGAGACAGCAGAGGGTGGAAGG - Intronic
1069806888 10:71131868-71131890 GAGGGAGAGCAGAGGCTGCATGG - Intergenic
1069825493 10:71252880-71252902 CCAGGAGAGTAGACGGTGGATGG + Intronic
1070148703 10:73792468-73792490 CGTGGAGAGGACAGGGTGGAGGG - Exonic
1070352963 10:75611087-75611109 CAGGGGGAGCACAGGGTGAGAGG + Intronic
1071497463 10:86178915-86178937 CAGGCATTGCAGAGGCTGGAGGG + Intronic
1071503963 10:86221938-86221960 TAGGGAGGGCAGGGGGTGGGAGG + Intronic
1071508308 10:86246080-86246102 CTGGGAGAGCAGAGCTGGGAAGG - Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1072246393 10:93547649-93547671 CAGGTAGATAAGTGGGTGGATGG + Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072685145 10:97532140-97532162 CCGGGAGAGCAGCCAGTGGAGGG + Intronic
1072686803 10:97542430-97542452 GTGGGAGAGCAGAGGGAGGGAGG - Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073009759 10:100349944-100349966 CAGGGGGTGCTGAGGCTGGAAGG - Intronic
1073055518 10:100698302-100698324 CAGGGTGATCGGAGGATGGAGGG - Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073466796 10:103698958-103698980 CAGTGAGGGTAGTGGGTGGACGG + Intronic
1073802270 10:107055066-107055088 CTGGAAGAGCACAGAGTGGAAGG + Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074020732 10:109579944-109579966 TAGAGAGAGCAGAGTGTGCAGGG - Intergenic
1074881946 10:117666479-117666501 CAGGGACAGCAGAGGGTGTGTGG + Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075085660 10:119412842-119412864 TGGGGAAAGCAGAGGGTGGTGGG - Intronic
1075108741 10:119560524-119560546 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
1075224936 10:120620517-120620539 GAAGGGGAGCAGAGGATGGAAGG - Intergenic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1076135138 10:128040484-128040506 CAGGGCGAGTGGAGGGTGGATGG + Intronic
1076187523 10:128460893-128460915 CAGGCAGAGCAGAGGTTGGGAGG - Intergenic
1076304864 10:129458837-129458859 GAGGGAGAGAGGAGGGAGGAGGG - Intergenic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076401518 10:130188598-130188620 CAGGGACAGCACTGGGTGCAGGG + Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076560364 10:131359125-131359147 CAGGAAGAGCAGTGTGGGGAGGG - Intergenic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1076751741 10:132546776-132546798 CAGGGAGAACAGTGGCTGGGCGG - Intronic
1076806688 10:132862421-132862443 CAGGGAGAGGACAGGGTGGGTGG + Intronic
1076888837 10:133274383-133274405 CAGGCAGGGTAGAGGGTGGAGGG + Intronic
1076988162 11:254153-254175 CAGGGAGAGCAGATGAGGGTAGG - Intergenic
1076992537 11:282945-282967 CACACAGAGCAGAGGGAGGAGGG + Intronic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077020149 11:413760-413782 CAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020177 11:413844-413866 CAGGCAGAGGAGAGGGTTCAGGG - Intronic
1077020198 11:413900-413922 CAGGCAGAAGAGAGGGTGCAGGG - Intronic
1077020256 11:414107-414129 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020284 11:414191-414213 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020312 11:414275-414297 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077065152 11:637766-637788 CAGACAGCGCAGCGGGTGGAAGG - Intronic
1077143555 11:1035241-1035263 TGGGCAGTGCAGAGGGTGGAGGG - Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077305253 11:1866026-1866048 GTGGGAGAGCAGAGTTTGGAGGG + Intronic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1077378717 11:2217876-2217898 CAGGTGGAGCCGAGGGTGTAAGG - Intergenic
1077383439 11:2258064-2258086 CAGGGAGATGGGTGGGTGGAGGG - Intergenic
1077394173 11:2313069-2313091 CAGGGGGTGAAGAAGGTGGAAGG - Intronic
1077407006 11:2387142-2387164 CAGGGAGGGCTGGGGGTGGATGG + Intronic
1077433217 11:2526267-2526289 CAGGGGGAGATGAGGATGGATGG + Intronic
1077487992 11:2847912-2847934 CAGGAAGAGCTCAGGGTCGACGG - Exonic
1077532494 11:3103768-3103790 AAGGGACTGCAGAGGCTGGAAGG - Intronic
1077613970 11:3661902-3661924 GTGGGAGAGCAGATGGTTGAGGG + Intronic
1077869918 11:6253072-6253094 GAGGGGGAGCAGAGGATGGAGGG - Intergenic
1077994558 11:7442180-7442202 CACTGAGAGCAGAGCGTTGATGG - Intronic
1078222354 11:9362455-9362477 CAGGGAGAGCTGAGGCTCCAAGG - Intergenic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1078546337 11:12249672-12249694 CAGTGAGAGCAGAATGTGCAGGG - Intronic
1078729023 11:13959238-13959260 CAGTGAGACCAGATTGTGGATGG + Intergenic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079281739 11:19093496-19093518 CAAAGAGAACAGGGGGTGGAGGG - Intergenic
1079524213 11:21364812-21364834 CAGGGAGATGAGAAGGTGAAGGG + Intronic
1080394001 11:31873428-31873450 GAGGGAGAGAAGAGGGTGGTTGG + Intronic
1081673001 11:44951867-44951889 TAAGGAGAGCACAGGGTGGTGGG - Intergenic
1081695672 11:45107520-45107542 GAAGCAGAACAGAGGGTGGATGG + Intronic
1082116974 11:48338951-48338973 CAGAGAGAACAGAGGATCGAAGG - Intergenic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082965449 11:58962362-58962384 CAGGAAGAGAAGATGATGGAGGG + Intronic
1083300275 11:61736411-61736433 CACAGAGAGGAGAGGATGGATGG + Intronic
1083625438 11:64069686-64069708 CAGGCAGAGCAGGCGGTGGTGGG + Intronic
1083651593 11:64207697-64207719 GAGGGAGGGAAGAGGGTGGGAGG - Intronic
1083663712 11:64263792-64263814 CAGGGTGAGCTGGGGGTGGGCGG + Exonic
1083822688 11:65181879-65181901 GAGGGAGGGCGGAGGGCGGAGGG + Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084184349 11:67463925-67463947 GAAGGAGGGCAGTGGGTGGAGGG + Exonic
1084312404 11:68324710-68324732 CTGGCAGAGCAGAGGCTGGTGGG + Intronic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084383993 11:68830630-68830652 CAGGGAGAGCTGAGCTTGGAAGG - Intronic
1084519956 11:69657051-69657073 CAGGGAGAGCTGACTGCGGAAGG - Intronic
1084794026 11:71492132-71492154 GAGGGAGAGCAGATGGCGGGCGG + Intronic
1084971379 11:72774094-72774116 CAGGGGCAGGAGATGGTGGAGGG + Intronic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1085299275 11:75449041-75449063 CAGGGAGAGGAGATGGTGAGAGG + Exonic
1085313814 11:75531451-75531473 CAGTGAGAGGAGAGTGTGCAGGG + Intergenic
1085329227 11:75633829-75633851 AAGGGCGAGCAGAGTGGGGAGGG + Intronic
1085473178 11:76771220-76771242 GACAGAAAGCAGAGGGTGGAAGG - Intergenic
1085738400 11:79058996-79059018 CAAGGAGAGCAGAGGATAAATGG + Intronic
1085739524 11:79067033-79067055 CAGCCAGAGCAGAGGCTGAAAGG - Intronic
1086402577 11:86472837-86472859 CAGGAAGGGCCGAGGATGGAGGG + Intronic
1086444289 11:86857919-86857941 CAGGGAGAGCCCAGTGAGGACGG + Intronic
1087081398 11:94174276-94174298 TAGACAGAGCAGAGGCTGGAAGG - Intronic
1088051175 11:105517354-105517376 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088929762 11:114339844-114339866 TATGGGGAGCAGAGGGTGTATGG + Intergenic
1089291358 11:117439506-117439528 CAAAGAGAGCTGGGGGTGGAAGG + Intronic
1089303299 11:117511652-117511674 CAGAGAGGAGAGAGGGTGGAGGG - Intronic
1089303809 11:117514447-117514469 CAGGGAAAGGACAGGCTGGAGGG - Intronic
1089310562 11:117555655-117555677 CAGGGAGAGCAGGGGTTTGGCGG + Intronic
1089396253 11:118137863-118137885 CACGGAGAGCTCAGGGAGGAAGG - Intronic
1089558696 11:119332011-119332033 CTGGGAGGGAACAGGGTGGAGGG + Intergenic
1089632433 11:119792056-119792078 CAGGGAGGGCAGAGTGGGGCTGG + Intergenic
1089668092 11:120032984-120033006 AAGAGATGGCAGAGGGTGGAAGG - Intergenic
1089873491 11:121697346-121697368 CTGGCAGAGCAGAGGGGAGAGGG - Intergenic
1089901004 11:121984633-121984655 GAGGGAGAGAAGAGGGTAGTGGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090118997 11:124004963-124004985 TAGGGAGAGAAGAGGCTGTATGG - Intergenic
1090240690 11:125179491-125179513 CAGGGGGAGCATAGAGTTGAAGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090575322 11:128095826-128095848 CATGGAGAGCACAAGGTGGCTGG - Intergenic
1090616338 11:128518942-128518964 AAGGTAGAGCAGAGTGTTGAAGG + Intronic
1090833975 11:130440376-130440398 CAGGGACTGGAGAGGGTGCAGGG + Intergenic
1090968287 11:131617209-131617231 CAGAGAGTGCTGAGAGTGGAGGG + Intronic
1091180864 11:133603350-133603372 GAGGAGGAGCAGGGGGTGGAGGG + Intergenic
1091237830 11:134033519-134033541 CTGGGAGGGAAGAGGGTAGAGGG + Intergenic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091399249 12:172543-172565 GTGGGAGAGCAGAGGCTGGCAGG - Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091673217 12:2467579-2467601 CAGAGACAGCAGGGGGTGGCGGG + Intronic
1091774383 12:3174956-3174978 CAGGCAGGGCAGGGGGTGTAAGG - Intronic
1091797155 12:3304013-3304035 CAGGGAGAGCAAAGAGGGGTTGG - Intergenic
1092025113 12:5233283-5233305 CAGGCAGAGCACCGAGTGGAGGG + Intergenic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092203756 12:6603354-6603376 GAGGGAGAGAGGAGGGAGGAGGG - Intronic
1092239484 12:6828371-6828393 GAGGGAGAGGAAAGGGGGGAAGG - Intronic
1092260774 12:6952276-6952298 CAGGGAGGGGAGGGGATGGAGGG - Intronic
1092431783 12:8415653-8415675 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092434734 12:8438273-8438295 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1094818304 12:34206689-34206711 CAGAAAGAGCACAAGGTGGAAGG - Intergenic
1095051063 12:37554656-37554678 TGGGGAGAGGAGTGGGTGGAGGG + Intergenic
1095700758 12:45188648-45188670 CAGAGAGAACAGAGGGTCAAGGG + Intergenic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1096209053 12:49748357-49748379 CAGGGACAGCAGGGGCTGGTAGG - Intronic
1096252557 12:50042317-50042339 GATGGAGAGGAGACGGTGGAGGG + Intergenic
1096259686 12:50082878-50082900 CAGGGAGGGCCGAGGGTGCCCGG - Exonic
1096547816 12:52353095-52353117 CAGGGAGAGGAGAGAGTGTACGG - Intergenic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1096911271 12:54986757-54986779 ATGGGAGGGTAGAGGGTGGAAGG - Intergenic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097053924 12:56239044-56239066 TTGGGAGGGCAGAGGGTGGCGGG - Exonic
1097261030 12:57720365-57720387 CAGTGAGAGGAGAGGATGGTTGG - Intronic
1097262663 12:57728201-57728223 TAGGGAAAGCAGAGGGTGGGGGG + Intronic
1097793668 12:63841284-63841306 AAGAGAAAGCAGAGGCTGGAAGG - Intergenic
1098370072 12:69749350-69749372 CAGACAGGGCAGAGGGTGGGAGG - Intronic
1098491507 12:71086452-71086474 AAAGGATAGCGGAGGGTGGAAGG - Intronic
1098551734 12:71770075-71770097 CAGAGAGAGGACAGGGTGGGTGG + Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100393388 12:94163608-94163630 GAGGGAGGGGAGAGGGTAGAAGG + Intronic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1101408716 12:104452196-104452218 CAGGGAGAGAAGGGGGTGTTGGG - Intergenic
1101997980 12:109538702-109538724 CAGGGTGAGGAGATGCTGGATGG + Intergenic
1102175422 12:110870581-110870603 CAGATGGAGCAGAGGATGGAGGG - Intronic
1102491696 12:113293244-113293266 AAGGAAGAGCAGAGGCTGCAGGG - Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103025204 12:117568175-117568197 GAGGGAGAGGAGAGGAGGGAGGG - Intronic
1103184531 12:118945088-118945110 GAGGGAGAGCTGAGGGTTGGGGG - Intergenic
1103883347 12:124183214-124183236 CAGGGAGAGAACAAGCTGGAAGG - Intronic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104064706 12:125297185-125297207 CAGTGAGACAACAGGGTGGATGG + Intronic
1104571440 12:129929615-129929637 GAGGCAGAGCAGAGCATGGAGGG - Intergenic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104721707 12:131048112-131048134 CAGGGAGAGCAGATGCTTGTCGG + Intronic
1104925478 12:132311816-132311838 CAGGGAGTGTGGAGGGTGGAGGG + Intronic
1105032003 12:132890508-132890530 CATGGAGAGAAGGGGGTGGGGGG - Intronic
1105614335 13:21998712-21998734 CAGGGAGCTCAGAGGGTGGAGGG + Intergenic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107389721 13:39951461-39951483 GAGGGAGGGCAGGGGGTGGATGG + Intergenic
1107726904 13:43308141-43308163 AAGGGAGGGCAAAGTGTGGAGGG - Intronic
1108530155 13:51320944-51320966 CAGGGACAGCACATGGGGGAAGG - Intergenic
1108800115 13:54084531-54084553 CAGGGAGTGTAGAGGGAGAAGGG - Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109554630 13:63955820-63955842 AAGGGAGAGCAAAGGGAGTATGG - Intergenic
1109958134 13:69595354-69595376 GAGGGAGAGCAGGGTGAGGAGGG + Intergenic
1110184661 13:72658471-72658493 TAGGGAGAGTGGTGGGTGGAAGG - Intergenic
1110324549 13:74199015-74199037 CAGTGAGAGCCGAGGTGGGATGG + Intergenic
1110345645 13:74444545-74444567 CAAGGAGAGCTGAAGGTGGCAGG + Intergenic
1111979485 13:95002021-95002043 TTGGGAGAGCAAGGGGTGGATGG + Intergenic
1112271296 13:97972947-97972969 CAAGGAGATCAAATGGTGGAAGG - Intronic
1112368529 13:98775052-98775074 CACAGAGGGCAGTGGGTGGAGGG + Intergenic
1112386563 13:98945613-98945635 AAGAGAAAGCAGAGGATGGATGG - Intronic
1112927671 13:104696208-104696230 GAGGAAGAGCAAAGAGTGGAAGG + Intergenic
1112970276 13:105253218-105253240 CTGGGAGAGCAGAGGAGTGAGGG + Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113429732 13:110239717-110239739 CAGGAAGTGCAGAAGGTAGAAGG + Intronic
1113599397 13:111558008-111558030 CAGGCAGAGCTGAGGGTGTGGGG + Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618075 13:111695109-111695131 CAGAGAGCGGAGAGAGTGGAGGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623608 13:111780370-111780392 CAGAGAGCGGAGAGAGTGGAGGG - Intergenic
1113895052 13:113759128-113759150 AAGGGAGAGTAGAGCGAGGAAGG + Intergenic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114532248 14:23403309-23403331 CAGGGACAGCAGTGGGTGGGGGG + Intronic
1114693697 14:24607751-24607773 CACAGAGAGCAGAGTGAGGATGG + Intronic
1114696641 14:24632463-24632485 CACAGAGAGCAGAGTGAGGATGG + Intronic
1115718171 14:36128835-36128857 GCAGGAGATCAGAGGGTGGAAGG + Intergenic
1115771310 14:36666162-36666184 CTGGGAGAGCAAAGGGGCGAAGG + Intronic
1117165646 14:53029937-53029959 GAGGCCTAGCAGAGGGTGGAGGG - Intergenic
1117230115 14:53708245-53708267 CAAGGAGAGCCGCAGGTGGAGGG + Intergenic
1117366958 14:55038621-55038643 CAGACACAGCAGAGGGTAGAGGG - Intronic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1118561272 14:67086295-67086317 AAGGAAGAGCAGTGGGTAGAGGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119162110 14:72461250-72461272 CAGGCAGTGGAGAGGGTGGGAGG + Intronic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119918672 14:78426181-78426203 AAATGAGAGCAGAGGCTGGAGGG + Intronic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1120674784 14:87408352-87408374 GAGGGAGAGAAGAGGTGGGAGGG + Intergenic
1120957255 14:90093631-90093653 CATGGAGAGCAGATGGTGGTTGG + Intronic
1121210160 14:92202469-92202491 CAGAGAGAGCTGATGGTGGCTGG + Intergenic
1121541900 14:94733964-94733986 CAGGGAGAGCAGAGTCTGCCAGG - Intergenic
1121766782 14:96494708-96494730 CAGGTAGAGGGGAGGGAGGAGGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122215572 14:100201545-100201567 CAGGGAGAGGAGAGGGAGATAGG + Intergenic
1122251544 14:100443466-100443488 CACGGAAAGCAGAGAATGGAGGG - Intronic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122647907 14:103207316-103207338 CAGGGAGGGGAGAGGAGGGAGGG - Intergenic
1122685406 14:103502479-103502501 GAGGGACAGCCCAGGGTGGATGG + Intronic
1122707516 14:103629982-103630004 CCGGGAGAGGCGGGGGTGGAAGG - Intronic
1122854037 14:104551652-104551674 AAGGGAGGGCAGAGGATGGGTGG - Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124641719 15:31400140-31400162 GAGGGAGAGCAGAGTGGGGGTGG - Intronic
1124804439 15:32867336-32867358 CAGGGAGAGCAGGGTGAGGCTGG - Intronic
1125342201 15:38686047-38686069 CAGGGAGGGAGGAGGATGGAAGG - Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1126105528 15:45144625-45144647 CAGGAAGGCCAGAGGATGGAGGG - Intronic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1127044160 15:55008540-55008562 AGGGGAGAGCAGAGGAGGGAAGG - Intergenic
1127167166 15:56256933-56256955 ATGGGAGAGCAGAGGGTGGGAGG - Intronic
1127613792 15:60663061-60663083 CAGGGAGATCAGAGTGGGGGTGG - Intronic
1127872349 15:63083831-63083853 GAGGGAGAGAGGAGGGAGGAAGG + Intergenic
1128218923 15:65953973-65953995 CAGGGAGAGCTGGGGTGGGAGGG + Intronic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129297719 15:74609031-74609053 CAGGGAGAGCAGATGGTGTTGGG - Intronic
1129450786 15:75650055-75650077 CTGGGAGAGCACAGGGTGGCTGG - Exonic
1129602434 15:77008067-77008089 CAAGCAGAGCTGGGGGTGGAGGG + Intronic
1129668015 15:77590312-77590334 CAGGGAGAGAAGAGTGAGCAGGG + Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129832338 15:78679173-78679195 CCGGCAGAGCACAGGGTGGGTGG + Intronic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130545732 15:84856833-84856855 CAGGGAGAGAAGGGGATGCAGGG + Exonic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131120901 15:89822956-89822978 CAGGAAGAGCAGTTGGTGGCGGG + Intergenic
1131283658 15:91040245-91040267 CTGGCAGAGCACAGGGTGGGTGG - Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131512230 15:93055757-93055779 CAGGGTGAGCAGGGGCTCGACGG + Intronic
1131558363 15:93418488-93418510 CTGGGAGAGTAGAGGCTGGCAGG + Intergenic
1131828670 15:96340899-96340921 CAGGGAGAGCTAATGGTGAAAGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132055356 15:98647814-98647836 CAGGGGGAGCGGAGGGGGAAGGG - Intergenic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1132236879 15:100228819-100228841 CAGGGAGAGCTGGGGTTGGGGGG - Intronic
1132311380 15:100860530-100860552 CATGAAGAGCTGGGGGTGGAGGG - Intergenic
1132568063 16:632174-632196 CAGGGAGGACAGTGGATGGAAGG - Intronic
1132574622 16:658738-658760 CAGGGAGAGCAGAAGGTGAGGGG + Intronic
1132657872 16:1048816-1048838 CGGGCAGTGCCGAGGGTGGACGG + Intergenic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132729737 16:1355546-1355568 CAGGAGGAGCAGAGGTTGGTAGG + Intronic
1132956453 16:2596853-2596875 CAGGCAGAGCAGAGGGGCCAGGG + Intronic
1133207237 16:4240990-4241012 CAGGGAGAGCAGGCAGTGGGTGG - Intronic
1133417539 16:5618144-5618166 TAGGGAGAGCTGTTGGTGGACGG - Intergenic
1133534454 16:6687714-6687736 CGGGGAGGACAGAGGATGGAAGG + Intronic
1133589541 16:7229517-7229539 AAAGGAGAGGAGAGGGAGGAAGG + Intronic
1133741596 16:8655878-8655900 CAGGAAGAGGAGAGGGCTGAGGG + Intergenic
1133770328 16:8863902-8863924 CTGGGAGAGCAGTGGCTGGCTGG - Intronic
1133771114 16:8867726-8867748 CAGGGAGTGCAGAGGGCGGTGGG + Intronic
1134031750 16:10997682-10997704 CAGGTAGAGCAGAAAGTGAAAGG + Intronic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134332618 16:13264996-13265018 CAGGAAGAGGAGAGGAGGGAAGG - Intergenic
1134495010 16:14726059-14726081 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1134500394 16:14765179-14765201 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1134526934 16:14951791-14951813 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1134580176 16:15363814-15363836 AGGGTAGAGCTGAGGGTGGAAGG + Exonic
1134714521 16:16350325-16350347 AGGGTAGAGCTGAGGGTGGAAGG - Intergenic
1134722396 16:16393689-16393711 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1134832640 16:17336115-17336137 GATGGAGGGCAGAGCGTGGAAGG + Intronic
1134945031 16:18318180-18318202 AGGGTAGAGCTGAGGGTGGAAGG + Exonic
1134952295 16:18358333-18358355 AGGGTAGAGCTGAGGGTGGAAGG + Intergenic
1135311066 16:21404867-21404889 AGGGTAGAGCTGAGGGTGGAAGG + Exonic
1135364017 16:21837318-21837340 AGGGTAGAGCTGAGGGTGGAAGG + Exonic
1135447824 16:22534030-22534052 AGGGTAGAGCTGAGGGTGGAAGG - Exonic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136135912 16:28256875-28256897 CAGGGAGAGGGGAGAGGGGAGGG - Intergenic
1136342672 16:29655163-29655185 CAAGGAGGCCAAAGGGTGGAGGG - Intergenic
1136553260 16:30992969-30992991 CAGACAGGGCAGAGGGTGGCAGG + Intronic
1136920519 16:34267532-34267554 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
1137017863 16:35394362-35394384 TTGGGACAGCGGAGGGTGGAGGG - Intergenic
1137610214 16:49812902-49812924 CAGGGAGGACAGTGGGTGGCTGG + Intronic
1137620998 16:49876616-49876638 GAGTGAGATCAGAGGGTCGAGGG + Intergenic
1138235645 16:55380179-55380201 CAGGGAGAGCAGAGGGGGAAGGG - Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138537055 16:57665956-57665978 GAGGGAGTGGAGGGGGTGGAGGG - Intergenic
1138544029 16:57705734-57705756 AGGAGAGATCAGAGGGTGGATGG - Intronic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139855499 16:69976534-69976556 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1139885217 16:70203652-70203674 GTGGAAGAGGAGAGGGTGGAAGG + Intergenic
1140035931 16:71371283-71371305 CAGGTAGGGCAGGGGGTGGGAGG + Intronic
1140208069 16:72949593-72949615 GGGGGAAAGCGGAGGGTGGAGGG + Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1141019958 16:80485679-80485701 CTGGGAGAGCAGTGGCTGGAGGG + Intergenic
1141193626 16:81842880-81842902 CAGGGAGGGCTGAGGGAGGGTGG + Intronic
1141244528 16:82293564-82293586 CAGGGGGATCATAGGGTTGAAGG + Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141677143 16:85523892-85523914 CAGGCTGAGCAGAGGTGGGAGGG + Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141873167 16:86803564-86803586 CAGGGAGAGCAGAGTTTGTCAGG + Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1141948497 16:87325734-87325756 CAGGGAGAGCAGGGGATCGTGGG - Intronic
1141993379 16:87622666-87622688 CAGGAGGAGCTGAGGGTGCATGG + Intronic
1142008214 16:87700486-87700508 GGAGGAGGGCAGAGGGTGGAGGG + Intronic
1142008223 16:87700511-87700533 GAGGGAGGAAAGAGGGTGGAGGG + Intronic
1142251454 16:88993793-88993815 GAGGGAGAGAAGAAGGGGGAGGG - Intergenic
1142431487 16:90030722-90030744 CTGGGAGAGCTGAGGTGGGAGGG - Intronic
1142441071 16:90097916-90097938 CAGGGAGAGAAGAGGTTCTAGGG + Intergenic
1142698314 17:1645409-1645431 CAGCCAGGGCAGATGGTGGAAGG - Intronic
1142711341 17:1725454-1725476 CAGGGACAGCTGAGGGGGCAGGG - Exonic
1142804278 17:2363317-2363339 GCTGGAGAGCAGAGGGTGGCTGG + Intronic
1142836881 17:2593914-2593936 GAGGGAGAGGGGAGGGAGGAAGG - Exonic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143371536 17:6443842-6443864 TAGGGAGGGCGGAGCGTGGATGG + Intergenic
1143416863 17:6756718-6756740 CAGGAAGAGCAGGGGGAGAAGGG + Intronic
1143483423 17:7239532-7239554 GAGGGAGAGAAGAGGAGGGAGGG - Intronic
1143610204 17:8013712-8013734 GAGGGAGAGTATAGTGTGGAAGG - Intronic
1143807610 17:9442243-9442265 TAGGGAGAGAAGTGGATGGATGG - Intronic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1144025176 17:11271086-11271108 CAGGGAGAGAAGAGGCGGGAAGG + Intronic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1145369509 17:22297509-22297531 CTGGGAGGGCACAGGATGGAAGG - Intergenic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1145980796 17:29010268-29010290 CAGGAAGAGCTCAGGGTAGATGG + Intronic
1146125917 17:30231787-30231809 CAGGGAGGGAAGAGCCTGGAGGG - Intronic
1146401627 17:32504370-32504392 CATGGAGCGCCCAGGGTGGAAGG + Intronic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146654829 17:34628971-34628993 GAAGGAGAGCAGAGGATGAAGGG - Intronic
1146750495 17:35374007-35374029 CCGGGAGAGAAGAGGGTGCGAGG - Intergenic
1146953146 17:36920517-36920539 GAGAGAGGGCAGAGGCTGGAAGG - Intergenic
1147033607 17:37662532-37662554 AACTGAGAGAAGAGGGTGGAGGG + Intergenic
1147161303 17:38570967-38570989 GAGGGAGGACAGAGGATGGAGGG - Intronic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147780076 17:42934832-42934854 CAGGGACCGCAGGGGCTGGAGGG - Intergenic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149565509 17:57638181-57638203 CCTGGAGAGGAGAGGGTGGGGGG - Intronic
1149991550 17:61386371-61386393 CAGGCAGAGCTGTGGGTGCAGGG + Intronic
1150067856 17:62126349-62126371 CAGGAAGAGCAGGAGGTAGAAGG - Intergenic
1150217293 17:63477681-63477703 CCGGGCGAGTGGAGGGTGGATGG - Intergenic
1150428931 17:65100603-65100625 GAGGGAGAGGAGGAGGTGGAGGG - Intergenic
1150571531 17:66391148-66391170 CTTGGAGAGCAGCGGGTGGGAGG + Intronic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151414525 17:73952764-73952786 CAAGGAGGGTGGAGGGTGGAGGG - Intergenic
1151517790 17:74607583-74607605 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1151517792 17:74607597-74607619 CATGGAGGGCAGAGTGTGGAAGG + Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151517814 17:74607681-74607703 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1151671029 17:75571796-75571818 CAGGGAGAGCAGAGGGTGCTCGG + Intronic
1151758502 17:76088016-76088038 CAGGGAGAGGGGAGGAAGGAGGG - Intronic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1151880805 17:76893368-76893390 CAGGGAGAGGGGAGGCTGGAGGG - Intronic
1151903566 17:77033579-77033601 CAGATAGAGCAGTGGGTGGTGGG + Intergenic
1151975299 17:77480849-77480871 CAGGCAGAGCAGGGCCTGGATGG + Intronic
1152095485 17:78269482-78269504 GCTGGAGAGGAGAGGGTGGACGG + Intergenic
1152196768 17:78923251-78923273 CCAGGATGGCAGAGGGTGGAGGG - Intronic
1152426547 17:80221275-80221297 CTGGGAGAGTTGAGGATGGAGGG + Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152455674 17:80414868-80414890 CGGGGACAGCAGAGGCGGGACGG + Intergenic
1152574319 17:81133476-81133498 CAGGGAGGGAGGAGGGTGGGAGG - Intronic
1152623967 17:81379974-81379996 GGGGGGGAGCAGGGGGTGGAGGG - Intergenic
1152697157 17:81803206-81803228 CAGGGATGGCTGGGGGTGGAAGG + Intergenic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1153026489 18:677484-677506 CAGGGAGAGGAAGGGGTGAAAGG + Intronic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1153242721 18:3045214-3045236 CAAGGCCAGCTGAGGGTGGAAGG + Intergenic
1153321088 18:3774918-3774940 CAGGGAGTGCAGGAGGTGGTGGG - Intronic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1153662088 18:7333919-7333941 AAGGTAGAGGAGAGGGCGGAGGG + Intergenic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153752535 18:8247976-8247998 CAGGGATAGCAGAGAGAGGGCGG - Intronic
1153987790 18:10368591-10368613 GAGGGAGAGCAGAGAGAGGGAGG + Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155903970 18:31426959-31426981 AGGGGAGAGAAGAGTGTGGAGGG - Intergenic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1156461952 18:37326210-37326232 AAGGGAGAGCAGAGGGGTCAGGG + Intronic
1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG + Intergenic
1157091814 18:44645090-44645112 CAGGGAGAGCTGAGACTTGATGG + Intergenic
1157229676 18:45903282-45903304 CAGGGAGAGGAAATGTTGGAGGG + Intronic
1157248324 18:46072352-46072374 CAGGGAGCGCAGAGCGCCGACGG - Intergenic
1157268303 18:46248367-46248389 GAGGGTGAGCAGTGGGTGGCTGG + Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157447405 18:47755770-47755792 CAGGAAGAGCAGAGGATGTCAGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157505365 18:48222399-48222421 CAAGGAGAGGAGAGTGTGGGAGG + Intronic
1157579038 18:48762884-48762906 CATGCAGAGGAGAGGGTGGGTGG - Intronic
1157619333 18:49007061-49007083 CTGAGAGAGGAGTGGGTGGAAGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158412695 18:57221930-57221952 CCAGGAGATCAGAGGGTGGGAGG - Intergenic
1158576848 18:58645435-58645457 AAGGGAGAATGGAGGGTGGAAGG + Intergenic
1159088701 18:63822499-63822521 AAGGGATAGCCGAGGCTGGAAGG + Intergenic
1159214456 18:65372357-65372379 GAGGGAGAGGAGAGGGTGCCAGG + Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1160629856 18:80239210-80239232 CAGGGAGAAGAGGGGGTCGAAGG + Intronic
1160685120 19:431019-431041 CTGGGAGAGCAGAGCGGGGAAGG - Intronic
1160751815 19:737951-737973 CAGGGAGAACAGACCGTGGACGG + Intronic
1160777104 19:861442-861464 CAGGGGGAGCGGGGGGTGGGGGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160974033 19:1783726-1783748 CAGGGAGAACAGAGGTGGCAGGG + Intronic
1161007071 19:1942044-1942066 GGGGGAGAGCAGGGGGTGGTGGG + Intronic
1161046099 19:2135873-2135895 CTGGGAGGGAGGAGGGTGGAGGG - Intronic
1161198879 19:3003222-3003244 GAGGGAGAGAGGAGGGAGGAGGG + Intronic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161423149 19:4186742-4186764 CGGGGAGAGCGGAGATTGGACGG - Intronic
1161453298 19:4358345-4358367 GAGGGAGGGCAGAAGTTGGAGGG - Intronic
1161530538 19:4786505-4786527 GAGGGAGAGAGGAGGTTGGAGGG + Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161851455 19:6739908-6739930 GAGAGAGAGCGGAGGGTGGAGGG - Intronic
1161998601 19:7729839-7729861 CAGGGCTACCAGTGGGTGGACGG - Exonic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162082237 19:8225104-8225126 CAGGGAGAGCAGATGGTGTGAGG + Intronic
1162259228 19:9518869-9518891 CAGGGACAGCAGAGCCTGGATGG - Intergenic
1162301179 19:9846051-9846073 CAGGGAGAGGAGGGGTGGGAGGG + Intronic
1162362158 19:10226947-10226969 GAGGGATGGAAGAGGGTGGAGGG - Intronic
1162394543 19:10409241-10409263 CCGGGAGTGCTCAGGGTGGAGGG - Intronic
1162460893 19:10813310-10813332 CATGGAGAGCAGAGGCCGGTTGG - Intronic
1162524187 19:11197801-11197823 CAGGGACAGCAGGCGGTGGGGGG - Intergenic
1162736093 19:12747947-12747969 CAGCCAGGGCAGAGGGTAGAAGG - Intronic
1162877688 19:13632865-13632887 CAGGAACAGAAGAGGGTAGAAGG + Intergenic
1162971237 19:14182650-14182672 GAGGGAGGGCCGGGGGTGGAAGG + Intronic
1163548584 19:17952839-17952861 CCGGGAGAGGGGAGGGGGGAAGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163600911 19:18248436-18248458 CGGGGAGGGCAGAGGAAGGAGGG + Intronic
1163635501 19:18435361-18435383 CAGGGACAGCACGGGGTGGAAGG + Exonic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163720506 19:18896176-18896198 GCGGGAGAGCGGAGGGCGGAGGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164843587 19:31413080-31413102 CATGGAGAGCAGTAGGTGGGTGG - Intergenic
1164845512 19:31429323-31429345 AAGGGAGTGAAGAGGGTGGCAGG + Intergenic
1164912365 19:32023313-32023335 AAGAAAGAGCAGAGGGGGGAGGG + Intergenic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165347164 19:35255747-35255769 CAGGGACAGCAGAGAGTGCCAGG - Intronic
1165354489 19:35295358-35295380 AAGGGAGAGGAGAGGGTTAAAGG - Intronic
1165392841 19:35548263-35548285 CAAGGAAGGCTGAGGGTGGAGGG - Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166122493 19:40693934-40693956 CAGGGGGAGCAGAGAGGGAATGG - Intronic
1166193894 19:41193874-41193896 GAGGCAGAGAAGAGGCTGGAGGG + Intronic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166942061 19:46373221-46373243 CAGGGAGGGGAGGTGGTGGAAGG + Intronic
1167295572 19:48646926-48646948 GAGGGAGAGGAGGGGGAGGAGGG + Intergenic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167627631 19:50603203-50603225 GAGGGAGAGGAGAGGGAGAAGGG - Intergenic
1167649109 19:50719846-50719868 GAGGGAGGGGAGAGGGCGGAGGG - Intergenic
1167651776 19:50734890-50734912 GAGGGAGAGAAGAGGGCAGAGGG - Intergenic
1167851285 19:52204347-52204369 CTGGGAGATCAGATGGTGTAGGG + Intronic
1167960626 19:53102244-53102266 CAGGGAGAGCAGAGGAGGCGCGG - Intronic
1168098916 19:54130653-54130675 CAGGGAGGGGAGGAGGTGGAAGG + Intronic
1168199722 19:54805810-54805832 CAGGAAGAGTTGGGGGTGGAGGG + Intronic
1168344457 19:55643618-55643640 AAGGGAGAGAAGAGGGTCTAGGG - Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168695604 19:58402301-58402323 CAGAAGGAGCAGAGGGTGGTGGG + Intronic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925017597 2:543661-543683 CAGGGAGGGGGGAGGGTGGGAGG + Intergenic
925056360 2:860550-860572 CATGGAGGGGAGAGGGTGGAGGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925185370 2:1843083-1843105 CAGGGAGAGCCCAGCGAGGATGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925363351 2:3294891-3294913 CAGGGAGAGAATGGGCTGGATGG - Intronic
925363535 2:3295813-3295835 CAGGGAGAGGATGGGCTGGATGG - Intronic
925363606 2:3296154-3296176 CAGGGAGAGGAGGGGCTGGATGG - Intronic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926183252 2:10664924-10664946 CAGGAATAGGACAGGGTGGAAGG + Intronic
926251749 2:11158906-11158928 CAGGGAAAGCAGGGAGTAGACGG + Intronic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
927135951 2:20096682-20096704 AATGGAGGGCAGAGGGTGGGTGG - Intergenic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927481830 2:23459977-23459999 CAGGTAGAGGAGAAGCTGGAAGG + Intronic
927606622 2:24491700-24491722 AAAGGAGAGCAGGGGGCGGAGGG - Intergenic
927879043 2:26677607-26677629 AAGGGAGAGCAGATGCTGGGTGG - Intergenic
927894851 2:26775147-26775169 CAGGAAAAGAAGAGGGTTGAAGG - Exonic
927965176 2:27263645-27263667 CAGGGATAACAGTGGGTTGAAGG - Intronic
928206417 2:29287803-29287825 CAGGGAAGGAAAAGGGTGGAAGG + Intronic
928286006 2:29990532-29990554 GAGGGAGATGAGAGGGAGGAAGG + Intergenic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928370334 2:30735906-30735928 CAGGGAGGGGAGAGGCAGGAGGG + Intronic
928524817 2:32129440-32129462 TAGGGTCAGCAGAGGGTGAATGG - Intronic
928769043 2:34683863-34683885 CAGAGACAGGATAGGGTGGAAGG + Intergenic
929171159 2:38934553-38934575 GAGGGAGAGAAGCGGGAGGAAGG - Intronic
929174018 2:38959509-38959531 AAGGGAGAGAAGAGAGTTGAAGG + Intronic
929777258 2:44937208-44937230 CAGGGAGGGGAGCGGGTGGCAGG - Intergenic
929798998 2:45083473-45083495 CAGCAAGAGCAGTGGGTGAAGGG - Intergenic
930204293 2:48572844-48572866 CAGGGAGAGCAGGGTTTCGATGG - Intronic
930358267 2:50347001-50347023 CGGGGAGAGGAGAGGGCGCAGGG + Intronic
930886518 2:56332691-56332713 CAGGGAGAGAAGAGGGAGAGAGG - Intronic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931196078 2:60053492-60053514 CACGGAGAGCAAAGGCTGCATGG - Intergenic
931390104 2:61834351-61834373 GAGGGAGAGTGGAGGGAGGAGGG + Intronic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931657738 2:64524887-64524909 CAGGGAGAGCCGGCGGTGGCCGG - Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932424482 2:71620436-71620458 GAGGAAGAGCAGAGGGTGCCTGG + Intronic
932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG + Intergenic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933566383 2:83955439-83955461 AAGGGAGGGCAGAGAGTGTAGGG + Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
933847881 2:86339834-86339856 CAGGGGGAGCAGCGGAGGGATGG + Intergenic
933866581 2:86523675-86523697 GAGGCAGAGGAGAGAGTGGAAGG - Intronic
933979634 2:87539417-87539439 TAGGGACTGAAGAGGGTGGAGGG + Intergenic
934559977 2:95308188-95308210 GGGGGAGAGCTGGGGGTGGACGG - Intronic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
934664184 2:96158462-96158484 CAGGGAGAGCAGAGGCCCCATGG + Intergenic
934886565 2:98030529-98030551 AGGTGAGAGCAGAGGATGGAGGG - Intergenic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935187604 2:100748143-100748165 CAGGGGGAGGAGAGGGTGCTGGG + Intergenic
935263068 2:101371409-101371431 CAGGGAGAGCAGAGGCCAAAGGG + Intronic
935433666 2:103004762-103004784 GACAGAGAGCAGGGGGTGGATGG + Intergenic
936266960 2:111018212-111018234 CAGGGAGAGGGGACGGAGGAGGG + Intronic
936286096 2:111182514-111182536 GAGGGAGAGAGCAGGGTGGAAGG - Intergenic
936314186 2:111411374-111411396 TAGGGACTGAAGAGGGTGGAGGG - Intergenic
936479625 2:112873960-112873982 AAGGTAGAGGAGAGTGTGGAGGG - Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936855123 2:116948367-116948389 GAGGGAGAGGAGGGGATGGAGGG + Intergenic
937111243 2:119368157-119368179 AAGGGAGAGGAGAGGATTGAGGG - Intronic
937150511 2:119682828-119682850 CAAGGAGAGCAGAGGGGTGGAGG + Intronic
937265438 2:120612202-120612224 CCTGGAGAGGAGAGGGTGCACGG - Intergenic
937302295 2:120850671-120850693 CAGTCAGAGCAGAGGCTTGAGGG + Intronic
937787561 2:125920570-125920592 CAGGCAGACCAGAAGTTGGAGGG + Intergenic
937911760 2:127079005-127079027 GAGGGAGGGCAGGGCGTGGAAGG - Intronic
937984521 2:127632551-127632573 CTGCCAGAGAAGAGGGTGGAGGG + Intronic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
938235258 2:129700712-129700734 CAGGAAGAGCGGGGGCTGGAAGG - Intergenic
938282576 2:130074946-130074968 CAGGGACAGCACAGCCTGGATGG + Exonic
938708657 2:133956302-133956324 CGGGGAGAGCAGAGGTAGGGTGG - Intergenic
938811257 2:134855052-134855074 AAGGGAGAGGAGAGGGGTGATGG - Intronic
938849660 2:135247850-135247872 AAGGGAGTGTGGAGGGTGGAAGG + Intronic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
939086715 2:137728261-137728283 CAGAGAGAGTAGTGGGTGGAGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941540267 2:166773478-166773500 GAGGGAGAGCAGAGGCGGGCTGG - Intergenic
941565695 2:167103176-167103198 AAGGGAGGGGAGAGGGTTGAGGG + Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
941809240 2:169739003-169739025 GAGGGAGAGGAGATGGGGGAGGG - Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
942809683 2:179983250-179983272 AAGGGAGAGTGGAGGGTGGGAGG - Intronic
943174295 2:184449962-184449984 CAGGTAGAGCAGATGGTGACTGG - Intergenic
944405367 2:199377922-199377944 CCATGAGAGCAGAGAGTGGAAGG + Intronic
944523820 2:200598127-200598149 GAGGGAGAGAGGAGGGAGGAAGG + Intronic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
944925426 2:204459093-204459115 ATGGGAGAGGAGAGGGTGGGAGG - Intergenic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
945506439 2:210647113-210647135 CAAGGAGAGGGGAAGGTGGAAGG + Intronic
945624689 2:212188255-212188277 GAGGGAGAGAAGAGGGAGGGAGG - Intronic
945694637 2:213087635-213087657 CAGGGAGTGGGGAGGGTAGAGGG - Intronic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
945923227 2:215777722-215777744 CAGGGAGAACACAGTGTGAAGGG - Intergenic
946074593 2:217063555-217063577 TTGGGAGAGCAGATGGTGGGAGG + Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946193886 2:218022014-218022036 CCGGGAGGGCAGAGGGTGAAGGG + Intergenic
946336201 2:219038334-219038356 CAGGCAGAGCAGGGTGTGGCAGG - Intronic
946354429 2:219176343-219176365 CAGGGGCAGCGGAGGGTGAAGGG + Intronic
946404763 2:219486477-219486499 CAGTGAGAGAAAAGGATGGAGGG + Intronic
946410066 2:219511345-219511367 CAGGGAGAGCAGTGGGTTTCTGG - Intergenic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
946860697 2:223997861-223997883 CAAGGAGAGGAGACAGTGGAGGG + Intronic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947262736 2:228242253-228242275 GAGGGAGTGCACAGGCTGGAGGG - Intergenic
947475944 2:230447835-230447857 CAGGGAGGGGAGAGGAGGGATGG - Intronic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
948028457 2:234797538-234797560 CAGGGAGAGAGGTGTGTGGATGG + Intergenic
948045486 2:234940556-234940578 CTGGGAGGGCAGAGAGTGGAGGG - Intergenic
948108818 2:235437742-235437764 GATAGAGAGCAGATGGTGGAAGG - Intergenic
948351901 2:237347681-237347703 CAGGGATAGCACAGGGTGGAAGG - Intronic
948371773 2:237494201-237494223 GACAGAGGGCAGAGGGTGGAGGG + Intronic
948433291 2:237934438-237934460 CAGGGAGGGCTGGGGCTGGATGG - Intergenic
949072292 2:242033029-242033051 GAGAGAGGGCAGAGGGTAGACGG + Intergenic
1169159067 20:3360982-3361004 CAATGACAGCAGAGGGTGGCAGG + Intronic
1169267254 20:4174275-4174297 GAGGGAGAGCAGAGGGTCCAGGG + Intronic
1169937736 20:10902910-10902932 AAGAAAGAGCTGAGGGTGGAGGG + Intergenic
1170624619 20:18021773-18021795 GAAGGAGAGAAGAAGGTGGAAGG + Intronic
1171124258 20:22587592-22587614 CAGGGAGAGCAGAGGAGGCCTGG - Intergenic
1171170286 20:23010105-23010127 CAGGGAGAGTAAAGGGAGAAAGG - Intergenic
1171212137 20:23325256-23325278 CAGGGATTGCAGTGGATGGAGGG - Intergenic
1171263607 20:23752830-23752852 CCAGGAGAGGAGAGGGTGGAAGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1171545589 20:25998108-25998130 GTGGGAGAGGAGTGGGTGGAGGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172285088 20:33734559-33734581 GAGGGGGAGCAGTGGGTTGAGGG + Intronic
1172487135 20:35305084-35305106 CAGGGAGGGCAGAGTGCTGAAGG - Intronic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG + Intergenic
1173009614 20:39170052-39170074 CATGCAGACTAGAGGGTGGAAGG - Intergenic
1173183292 20:40820630-40820652 CAGGGAGTGCAGTGACTGGAAGG - Intergenic
1173500682 20:43550553-43550575 CTGGGAGCGCAGAGAGGGGAGGG + Intronic
1173988448 20:47280895-47280917 CAGGAAGAGCAGAGGTCGGGAGG - Intronic
1174339287 20:49886072-49886094 CAGGGAGGGCAGAGGATGGCCGG - Intronic
1174340311 20:49891219-49891241 CAGGGAATGCGGGGGGTGGAGGG - Exonic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174449095 20:50608981-50609003 CAGGGAGAGTGGAAGGCGGAGGG - Intronic
1174489015 20:50879206-50879228 CAGGGAGAGCACACGTTGGATGG + Intronic
1174588222 20:51625107-51625129 CAGGGAGATCACAGGGGGAAAGG - Intronic
1174612204 20:51807153-51807175 GAGGGAGAGTGGGGGGTGGAGGG + Intergenic
1174750727 20:53108949-53108971 CTTGGAGGGTAGAGGGTGGAGGG - Intronic
1174968004 20:55241221-55241243 CAGAGATAGTAGAGGTTGGAAGG - Intergenic
1175385497 20:58592419-58592441 CTGGAAGTGCACAGGGTGGAAGG - Intergenic
1175405303 20:58722244-58722266 CTGAGAGGGCAGAGGGTGCAGGG - Intergenic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175716726 20:61259883-61259905 AAGTAAGAGCAAAGGGTGGAAGG - Intronic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1176016139 20:62934139-62934161 CCGGGACAGGAGAGGGTGCAGGG - Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176104969 20:63381629-63381651 CAGGCAGAGGGGAGCGTGGAGGG + Intergenic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1177844993 21:26279005-26279027 CAGTGAGGGCAGATGCTGGAGGG - Intergenic
1178127471 21:29530597-29530619 ATGGGAGAGGAGAGGGTTGAAGG + Intronic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178730816 21:35101037-35101059 CAGAGAGGGAAGAGGGTTGAGGG - Intronic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178935651 21:36859441-36859463 TGGGGAGAGCTGAGGGTGCAAGG - Intronic
1179130943 21:38636668-38636690 GTGGGAGAGGAGAGGTTGGATGG - Intronic
1179274568 21:39880244-39880266 CATGGAGGTCAGTGGGTGGAGGG + Intronic
1179290464 21:40013765-40013787 CAGGGAGAGCACAGGGTTTGAGG + Intronic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179430614 21:41318608-41318630 CCAGGAGAGATGAGGGTGGATGG - Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179924099 21:44522881-44522903 CAGGGAGGGCAGATGTTGGGTGG - Intronic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180841018 22:18958894-18958916 CATGGCGGGCAGAGTGTGGAGGG - Intergenic
1181106910 22:20581119-20581141 CTGGGAGACCAGGGGGTGGGGGG - Intronic
1181174331 22:21027318-21027340 GAGAGAGAGCAGAGGGCGGCAGG + Exonic
1181177821 22:21047714-21047736 CAGGGAGAGCTGGGGGTGGGGGG + Intronic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181737801 22:24895315-24895337 AAGGGAGAGGAGTGGGTGGGAGG - Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181809141 22:25392810-25392832 CTGGCAGAGCAGAGGCTGGTGGG - Intronic
1181999124 22:26905713-26905735 CAGAGAGAGAAGAGAGGGGAGGG + Intergenic
1181999763 22:26910904-26910926 GAGAGAGAGGAGAGGGTGGGAGG - Intergenic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1183348968 22:37324204-37324226 CGAGGAGAGCTGAGGGTGGTGGG - Intergenic
1183419772 22:37704727-37704749 CAGGAAGAGGAGAGGAAGGAAGG + Intronic
1183467099 22:37985296-37985318 CAGGGTGAGCCCAGTGTGGAAGG - Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183688573 22:39375759-39375781 CAGTGAGAGGGGAGGATGGAGGG - Intronic
1183701303 22:39452729-39452751 CTGGGAGGGTAGAGGGTGGAGGG + Intergenic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184425496 22:44406855-44406877 CAGGCAGAGGAATGGGTGGAGGG - Intergenic
1184490948 22:44808541-44808563 CTGGTAGGGCGGAGGGTGGAGGG + Intronic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184835711 22:47019829-47019851 AAGAGAGAGGAGAGGATGGAGGG - Intronic
1184835722 22:47019880-47019902 AAGGGAGAGGAGAGGATGGAGGG - Intronic
1184835743 22:47019955-47019977 AAGGGAGAGGGGAGGATGGAGGG - Intronic
1184835752 22:47019980-47020002 AAGGGAGAGGGGAGGATGGAGGG - Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185100218 22:48836352-48836374 GTGGGAGAGCAGAGGCTGCAGGG + Intronic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949987429 3:9552254-9552276 CAGGTAGGGGAGGGGGTGGACGG - Exonic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950442214 3:13016626-13016648 CAGAGAGAGCAGCTGGTGTAAGG - Intronic
950483647 3:13260171-13260193 GAGGAAGGGAAGAGGGTGGAGGG + Intergenic
950522847 3:13506760-13506782 CTGGCAGGGCAGTGGGTGGATGG + Intergenic
951026975 3:17840851-17840873 CAGGTGGAGCAGAGGGTGTGAGG + Intronic
951109592 3:18786198-18786220 AAGGGAGTGCAGGGGGTGGAGGG - Intergenic
951264901 3:20553199-20553221 CAGGGAGGGCAGAGGGGCGTGGG + Intergenic
951485418 3:23203694-23203716 CAGGGAGAGAAGAGGCAGAAGGG - Intronic
952342517 3:32457917-32457939 GAGGCAGAGCAGAGGGTGTGGGG + Intronic
952523286 3:34184030-34184052 CTGGGAGAGGAGGTGGTGGAAGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952879324 3:37973522-37973544 CAGCGAGGAAAGAGGGTGGAAGG - Intronic
952965179 3:38616721-38616743 CAGAAAGAGCAAAGGGTGGTGGG + Intronic
953187215 3:40649288-40649310 TAGTGAGAGCAGAGGCTGCAAGG - Intergenic
953420901 3:42752470-42752492 CCGGGAGAGCTGAAGTTGGAAGG - Intronic
954148785 3:48647302-48647324 GAGGGAGGGTGGAGGGTGGAGGG + Intronic
954367118 3:50152081-50152103 CAAGGAGAGCACAGGGTGGGGGG + Intergenic
954579797 3:51697056-51697078 CAGGGAGAACAGAGGATCAAGGG - Intronic
954609426 3:51936536-51936558 CAGGGAGCGTGGAGAGTGGACGG - Exonic
954648201 3:52144171-52144193 CAGGGAGAGATGGGAGTGGAAGG - Intronic
954775229 3:53011228-53011250 AAGGTAGAGGAAAGGGTGGAAGG + Intronic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955034132 3:55249842-55249864 GTTGGAGAGCAGAGGGTGGGAGG - Intergenic
955552041 3:60095611-60095633 GAGGGAAAGCTGAGGGTGAAGGG + Intronic
955804931 3:62723938-62723960 GAGGAAGAGCACTGGGTGGAGGG + Intronic
955843370 3:63135739-63135761 CAGGGACAAAAGAGGGTAGAGGG + Intergenic
955852729 3:63238444-63238466 CGCGGAGAGTAGAGGGTGGAGGG - Intronic
956212364 3:66814940-66814962 CAGGGAGAGAAAAGGGCTGAAGG - Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
957040076 3:75329721-75329743 GAGGGAGAGCAGGGGAAGGAGGG - Intergenic
957173078 3:76765064-76765086 TAGAGACTGCAGAGGGTGGAAGG - Intronic
957211375 3:77262825-77262847 CTGAGACAGCAGAGGTTGGATGG + Intronic
957486923 3:80873382-80873404 TAGGCAGACTAGAGGGTGGAGGG + Intergenic
957891480 3:86364493-86364515 CAGGAAGAGCAGAGGGGTCAAGG + Intergenic
958421809 3:93939013-93939035 AAGGGGGAATAGAGGGTGGAAGG - Intronic
959760954 3:109964286-109964308 GAGGGAGGGCAGAGGGCGGGGGG + Intergenic
960051254 3:113241414-113241436 CCGGGAGAGCAGAGGGGGAGAGG - Intronic
960225136 3:115159271-115159293 CAGGGAGAGGGGTGGGAGGATGG - Intergenic
960585448 3:119316943-119316965 CAGGGAGAGCAAAGACAGGAGGG - Intronic
960719246 3:120609579-120609601 GAGGGAGGGAGGAGGGTGGAGGG - Intergenic
960941097 3:122935314-122935336 CTGGGGGAGCAGGGGGTGGGAGG + Intronic
960987696 3:123291432-123291454 CACGGAGAGGAGGAGGTGGAGGG - Intronic
961044862 3:123701263-123701285 GAGGGAGAGCAGGGGAAGGAGGG - Intronic
961144762 3:124584694-124584716 CGGGGAGAGCACAGCGGGGAGGG + Intronic
961158426 3:124700719-124700741 TGGGGAGAGCAGTGGGTGGGGGG + Intronic
961402034 3:126654604-126654626 CGGGGAGAGGAGAGGACGGACGG + Intronic
961875776 3:130022429-130022451 CAGGGACAGCAAAGCGAGGACGG + Intergenic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962520871 3:136196351-136196373 AAGGGAGAGGAAAGGGGGGAGGG - Intronic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
962854163 3:139329280-139329302 CAGGAAGGAGAGAGGGTGGAGGG + Intronic
962857637 3:139363276-139363298 GAGGGTGAGCAGTGGGTGGGTGG + Intronic
963238770 3:142982272-142982294 GAGGGAGAGGAGAGGAGGGAGGG + Intronic
963274939 3:143320541-143320563 CAGGCACAGCACATGGTGGAGGG + Intronic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963751149 3:149181179-149181201 CAGGGAGAGCAGGGGCCAGATGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965868631 3:173238261-173238283 CAGGGAGATTAGAGAGTGGAGGG - Intergenic
966692375 3:182755002-182755024 TAGTGAGAGAAGAGGGTTGAGGG + Intergenic
966863275 3:184242243-184242265 CAGGGAGCTCAGAGGATGGAGGG - Exonic
966876282 3:184323704-184323726 GAGGGACAGGAGAGGGTGGTGGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967250587 3:187533979-187534001 TGGGGAGCGCTGAGGGTGGAGGG + Intergenic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
968264763 3:197354468-197354490 CAGAGAGAGCAGAGTGTTAAAGG + Intergenic
968271094 3:197404300-197404322 TGGGGAGAGCAGGGAGTGGAGGG + Intergenic
968361334 3:198148889-198148911 CAGGGAGAGAAGAGGTTCTAGGG + Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968444521 4:643842-643864 CAGGGAAAGCAGTGCTTGGAGGG - Intronic
968616281 4:1579170-1579192 CAGGGAGGGCAGGGGGGGCAGGG - Intergenic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
968663700 4:1809655-1809677 GGAGGAGAGCAGAGGGAGGACGG - Intergenic
968665855 4:1822049-1822071 CAGTGAGAGGAGATGGTGCAAGG - Intronic
968755324 4:2412906-2412928 CAGGCAGGGCAGACGGGGGAGGG - Intronic
968759728 4:2436547-2436569 CAGGCAGAGCAGAGAGTGCCAGG - Intronic
968856199 4:3125674-3125696 CAGGAAGGGCAAGGGGTGGAAGG - Intronic
968889324 4:3359256-3359278 GAGGGAGAGGAGGAGGTGGAGGG - Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968957440 4:3726456-3726478 GAGGGAGAGGAGAGAGAGGAAGG + Intergenic
969091852 4:4700204-4700226 CAGGTAGAGGAGATGGTGGCTGG + Intergenic
969350301 4:6594437-6594459 CTGGGAGGGCAGCTGGTGGAGGG + Intronic
969450202 4:7268671-7268693 AAGGGAGTGCCCAGGGTGGAGGG + Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969828718 4:9778736-9778758 CAGATAGAGCAGAGGGAGAAAGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970431206 4:15990617-15990639 CACTCAGAGCAGAGGGTGGAAGG + Intronic
970518088 4:16853968-16853990 CAGGGATAGCAGGGGGTGAGCGG + Intronic
970522352 4:16898676-16898698 GAGGGAGAGGAGAGGAGGGAGGG + Exonic
971308789 4:25506351-25506373 CAGGGACGGCATGGGGTGGAAGG - Intergenic
972413233 4:38813893-38813915 CAGACAGAGCTGAGGGTGGCTGG - Intronic
973325313 4:48854672-48854694 AAGGCAGAGCAGTGGATGGATGG - Intronic
973608204 4:52608648-52608670 GAGGGAGAGTGGGGGGTGGAGGG - Intronic
974154099 4:58047977-58047999 ATGGGAGAGCAGAGTGTGGGAGG - Intergenic
974508573 4:62807849-62807871 GTGGGAGAGCAGAGGGGGTAGGG + Intergenic
974666334 4:64967517-64967539 CAGTAATAGCAGAGGGTGAAAGG - Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975237252 4:72013732-72013754 CAGGAAGACTAGAGGGTAGAAGG + Intergenic
975446038 4:74466695-74466717 CAGGAAGAACCGAGAGTGGAAGG - Intergenic
975558345 4:75686541-75686563 CAGCAAGAGCAAAGGGTGGGTGG + Intronic
976217503 4:82729015-82729037 CAGGCAGAGGAGAGGGAGAAAGG + Intronic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
977177069 4:93830232-93830254 AAGGGGGAGCAGAAGGTGGGCGG - Exonic
977430794 4:96928470-96928492 CAGGGAGAGAAGACTGTGGCAGG - Intergenic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978826088 4:113025732-113025754 TAAGGAGATCTGAGGGTGGAGGG + Intronic
978921871 4:114193431-114193453 GACAGAGAGCAGAGGTTGGATGG + Intergenic
979676245 4:123413269-123413291 CAGGGACAGTAGAGGCTGAAAGG + Intergenic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981767054 4:148263027-148263049 CAGGGAGTGGAGATGGTGGCAGG - Intronic
982026805 4:151259404-151259426 CATGGAGGGGTGAGGGTGGAGGG + Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982549755 4:156783199-156783221 GGGGGAGAGTAGATGGTGGAAGG + Intronic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
984070343 4:175103405-175103427 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984070364 4:175103458-175103480 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984165549 4:176299494-176299516 CAGGGAGAGAAGGGGTCGGAGGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985614567 5:911668-911690 CAGCGAGAGCAAAGGCTGGGGGG + Intronic
985669839 5:1201600-1201622 CAGGCAGGGCAGAAGCTGGAGGG - Exonic
985678403 5:1243918-1243940 AACGGAGAGCCGAGGGTCGAGGG + Intronic
985937195 5:3106425-3106447 GAGGGAGAGCAGAGGGAGAGGGG - Intergenic
986078931 5:4368923-4368945 CTGGGAGAGCATAGTGTGAAGGG - Intergenic
986207424 5:5638156-5638178 CAGGGAGAGAAGTGGTAGGATGG - Intergenic
986272117 5:6242467-6242489 GAGGCATATCAGAGGGTGGAGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986558977 5:9041634-9041656 CAGGGAGAGGTGAGGGTGAATGG + Exonic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986734047 5:10655163-10655185 CAGGGAGAGAAGCGGGCAGAGGG - Intergenic
987186636 5:15427304-15427326 TAAGGAGAGGTGAGGGTGGAAGG - Intergenic
987224957 5:15830788-15830810 AAGGGAGAGAAGATGGTGGAGGG + Intronic
987859370 5:23464727-23464749 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
988280092 5:29134262-29134284 CAGGGAGGGCAAGGGGGGGATGG + Intergenic
988578136 5:32445609-32445631 CAGGAAGAGCAGCAAGTGGAAGG + Intergenic
989201743 5:38770626-38770648 CAGGGAGAGCAGAGAAGGGTGGG + Intergenic
989297238 5:39843792-39843814 CAGGGAGAACAGATGTTTGAAGG + Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990154374 5:52858044-52858066 CAGGAAGTACAGAGGATGGAAGG - Intronic
990303451 5:54472334-54472356 GCAAGAGAGCAGAGGGTGGAAGG + Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
990566484 5:57034754-57034776 CAGGTAGAGCAGAGACTGGTGGG - Intergenic
991515246 5:67427973-67427995 AAGGGAGAGAAGAGAGAGGAAGG - Intergenic
992157652 5:73970941-73970963 CAGGGAGTGGGGAGGGAGGAAGG + Intergenic
992226714 5:74625852-74625874 AAGGGAGAGCAGACGTTGGAGGG - Intergenic
992543279 5:77785290-77785312 CAGGGACAGCATAGTCTGGATGG - Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993385040 5:87252545-87252567 CAGGGAGCGGGGAGGGCGGAAGG + Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
995274203 5:110259629-110259651 CAGGGAGAGCAGATTTAGGATGG + Intergenic
995331270 5:110949658-110949680 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
996376959 5:122821328-122821350 GAGGGAGAGAAGGGGATGGAAGG - Intronic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997512375 5:134462414-134462436 CAAGGAGGGCAGATGGTGGGAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998069001 5:139181999-139182021 AAGGCAGAGAAGGGGGTGGAAGG + Intronic
998177476 5:139910888-139910910 TGGAGAGAGCAGAAGGTGGAAGG + Intronic
998359641 5:141573839-141573861 CAGGCAAAGAAGAGGGTGAAGGG + Exonic
998359653 5:141573875-141573897 CAGGCAAAGGAGGGGGTGGAGGG + Exonic
998384802 5:141750626-141750648 CAGGGGGAGCAAAGCTTGGAAGG + Intergenic
998447566 5:142210646-142210668 GAGGGAGGGGAGAGGGAGGAAGG - Intergenic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999323793 5:150630699-150630721 GAGGGAGAGGAGAGGGTGGATGG - Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999597496 5:153221315-153221337 CAGGCAGAGTTGAGGTTGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000294476 5:159901303-159901325 CTGGAAGAGCAAAGGGTGAAGGG - Intergenic
1000349544 5:160342578-160342600 CAGGGAGAGCAGAGTCTTCAGGG - Intronic
1000772029 5:165366295-165366317 GAGGGAGGGCGGAGGGAGGAAGG + Intergenic
1000841053 5:166219072-166219094 CAGGGAGAGAGAAAGGTGGAAGG + Intergenic
1001244829 5:170098251-170098273 TGGGGGGTGCAGAGGGTGGATGG + Intergenic
1001732407 5:173970098-173970120 CAGGGAGAGCAGAGCCTGGGGGG + Intergenic
1001842348 5:174889129-174889151 CTCGGAGAGCGGAGGGTGGGAGG - Intergenic
1001972443 5:175967658-175967680 GAAGGTGAGGAGAGGGTGGATGG - Intronic
1002135512 5:177105396-177105418 CAGTGAGAGCAGGGGGTGGGGGG - Intergenic
1002244996 5:177876122-177876144 GAAGGTGAGGAGAGGGTGGATGG + Intergenic
1002494627 5:179603413-179603435 CAGGCAGGGCGGAGGGTGGGAGG - Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002980214 6:2128630-2128652 CAGGTAGAGGAGTGGGAGGAAGG - Intronic
1003052250 6:2790620-2790642 CTGGGAGAGCAGGAGGTGGCCGG + Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003153135 6:3569916-3569938 CAGGGAGGGGAGAGGGAGGGAGG - Intergenic
1003153191 6:3570090-3570112 GAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1004632296 6:17433523-17433545 AGGGCAGAGGAGAGGGTGGAAGG + Intronic
1005056061 6:21729773-21729795 CATGGAGAGCAAAGAGAGGAAGG - Intergenic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1005467152 6:26126327-26126349 TAGGGAAAGGAGGGGGTGGAGGG - Intronic
1005893928 6:30162454-30162476 CAGGAAGAGCAGAGATTGGATGG + Intergenic
1005917346 6:30364796-30364818 CAGGGAGACCAGGAGGTGGCAGG + Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1006133477 6:31882407-31882429 AAGGGCGAGGAGGGGGTGGAGGG + Intronic
1006303921 6:33207969-33207991 GAGCCAAAGCAGAGGGTGGAGGG + Intergenic
1006351444 6:33524196-33524218 CAGGGAGGGGAGAGGGCTGAAGG + Intergenic
1006370087 6:33638876-33638898 AAAGCAGAGCTGAGGGTGGAAGG + Intronic
1006796770 6:36737156-36737178 CAGGGAGTGGAGCGGGTGGGGGG - Intergenic
1006844779 6:37054691-37054713 CAGGGAGCTGAGAGGGTGCAGGG - Intergenic
1006943051 6:37765636-37765658 CGGGGAGAGAGGAGGGTGGCGGG + Intergenic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007178775 6:39913629-39913651 CAGGGAGAGAAGAGGTGGAAGGG + Intronic
1007601269 6:43083186-43083208 TAGGGAGAGCAGGAGGTTGAGGG - Intronic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007746594 6:44047004-44047026 CAGGTAGAGAACAGGTTGGAGGG - Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008920934 6:56843696-56843718 GAGGGAGGGAGGAGGGTGGAGGG + Intronic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1011151201 6:84275332-84275354 TAGGGAGAACTGAGAGTGGAGGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1012166200 6:95955519-95955541 TAGGGATAGGGGAGGGTGGATGG + Intergenic
1012442156 6:99270641-99270663 CCGGAAGGGCAGAGGGTTGAGGG - Intergenic
1013169726 6:107625658-107625680 CAGGGAGTGAGGAGGCTGGAAGG + Intronic
1013356532 6:109350257-109350279 CAGGGAGAGGAGGGGTTTGAGGG + Intergenic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1014938939 6:127415749-127415771 CAGTGAGGGCAGAGGGTGTTGGG + Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015544562 6:134348140-134348162 GAGGGAGAGCAGAGGCGGGCTGG + Intergenic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1015711677 6:136148430-136148452 AAGGGAGAGAGGAGGGTGGGAGG + Intronic
1015723727 6:136276400-136276422 AAGGGAGGGCAGAGGGAGAATGG - Exonic
1016307897 6:142702665-142702687 TAGGGAGAGCAGCTGGGGGAGGG - Intergenic
1016486187 6:144542371-144542393 CAGGGAGAGCCCAGGGTGAAGGG + Intronic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016807035 6:148222078-148222100 CAGGGAGACCATAGGTTAGAAGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1018072584 6:160178642-160178664 CAGGGAGAGAGGGGGATGGAGGG - Intronic
1018088580 6:160326052-160326074 CAGGGAGAGGAGAGGTGGCAAGG - Intergenic
1018680263 6:166258623-166258645 CAGAGAGAGCACAGGATGAAAGG - Intergenic
1018893450 6:167997627-167997649 CAGTGAGAGACGTGGGTGGAAGG - Intronic
1019064672 6:169287216-169287238 GAGGGACAGCAGAGGGGAGAGGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019254357 7:39832-39854 CAGGGAGAGAAGAGGTTCTAGGG - Intergenic
1019327598 7:445967-445989 AAGGGAGAGAGGAGGGAGGATGG + Intergenic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020263204 7:6543071-6543093 CTCTGAGAGCAGAGGATGGAAGG - Intronic
1021561375 7:21971979-21972001 CAAAGAGAGCAGAGGTTGGAGGG - Intergenic
1021638550 7:22715183-22715205 CAGGGAGAGAGGAGGGAGGCAGG + Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1021930978 7:25581134-25581156 TGGGAAGAGCAGATGGTGGAGGG - Intergenic
1022038013 7:26552253-26552275 GAGGGAGTGCAGAGGAGGGATGG + Intergenic
1023539548 7:41250877-41250899 CAGGGACAGCACAGGGTGGGAGG + Intergenic
1023587294 7:41743956-41743978 CAGGGAGAGAAAAGGGTGAAAGG - Intergenic
1023818986 7:43969906-43969928 CTGGTAGGGCTGAGGGTGGAGGG - Intergenic
1024052989 7:45641167-45641189 CAAGGAGAGCAAAGGCTGGGAGG - Intronic
1024077126 7:45827202-45827224 CAGGGAGGGAAGGGGATGGAAGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024164957 7:46721697-46721719 GAGAGAGAGGTGAGGGTGGAAGG - Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024575941 7:50764186-50764208 CAGGGACAGGACAGGGTGGATGG - Intronic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025296994 7:57783167-57783189 TGGGGAGAGGAGTGGGTGGAGGG + Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1026364331 7:69632542-69632564 GAGGGAGAGGAGAGGCAGGATGG - Intronic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1027319434 7:77002826-77002848 CAGGGAGAGCAGCTGGGGGTCGG - Intergenic
1027540668 7:79460191-79460213 CATGGAGAGGAAAGGGAGGAAGG + Intergenic
1027931552 7:84541917-84541939 CAGGTAGTGCAGGGGGTTGAGGG + Intergenic
1028405474 7:90469347-90469369 CATGGAGTGCAGTGGGTGGTAGG + Intronic
1028850751 7:95534597-95534619 CATCGAGGGCAGAGAGTGGAGGG - Intronic
1029015638 7:97312993-97313015 CAGGCAGATTAGAGGCTGGAAGG + Intergenic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029464541 7:100716930-100716952 CAAGGTGAGCAGAGGATGCAGGG + Intergenic
1029506885 7:100968186-100968208 CAGGAAGAGAAGGGGGAGGAGGG - Exonic
1029557552 7:101280809-101280831 CAGGGAGGAAAGGGGGTGGAAGG + Intergenic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1030162015 7:106518614-106518636 GAAGGAGAGGAGAGGGAGGAAGG - Intergenic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1030367132 7:108658018-108658040 AAGGGAGGGCAGTGGGTTGACGG + Intergenic
1030735550 7:113043558-113043580 CAAGGAGAGCACAAGGGGGAAGG + Intergenic
1031975441 7:128090654-128090676 AAGGGAGAGCAGTGGGCGAATGG - Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032220121 7:129988150-129988172 CAGGGAGAGGCGAGGAAGGATGG + Intergenic
1032410738 7:131692023-131692045 AAAGGAGAGCAGGGGGAGGAGGG - Intergenic
1032534948 7:132655407-132655429 CAGAGAAAGAAGGGGGTGGAGGG - Intronic
1032581140 7:133104708-133104730 TAGGGAGAGAAGAGGGTTTATGG - Intergenic
1033033730 7:137850966-137850988 GAGGCAGAGCAGAGAGTGAAGGG + Intergenic
1033273624 7:139955245-139955267 CAGTGACGGCAGAGGGTGGGAGG - Intronic
1033292573 7:140100052-140100074 CAGGGCTACCTGAGGGTGGATGG - Intronic
1033300150 7:140177654-140177676 CAAGGAGACCAGAGCGTCGATGG + Intergenic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1033970990 7:147039360-147039382 CCTGGAGAGTGGAGGGTGGAAGG - Intronic
1034015939 7:147586512-147586534 CAGAGAGAGAAGAGGAAGGAAGG + Intronic
1034391068 7:150788112-150788134 GAGGGAGAGGAGAGGCTGGTGGG + Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034615018 7:152408704-152408726 CAGGGGGAGCACGGAGTGGATGG - Intronic
1035073282 7:156160115-156160137 CAGGCAGGGCAGAGGTTTGACGG + Intergenic
1035100222 7:156389977-156389999 GAGGGAGAGAAGGGGGAGGAAGG - Intergenic
1035237614 7:157509017-157509039 CAGGGAGAGCGAAGGGGAGAGGG + Intergenic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1035795636 8:2354149-2354171 CTGGGACAGCAGAGGCTAGATGG + Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036208644 8:6824311-6824333 GAGGGAGAGAAGGGGGTGAAGGG + Intronic
1036213833 8:6863366-6863388 CAGGGAGTGGAGAGGCTGGAGGG + Intergenic
1036486319 8:9182654-9182676 CAGGGAGAGCAGAGGTGTCAGGG - Intergenic
1037059141 8:14485263-14485285 CAGCGGGGGCAGGGGGTGGAGGG - Intronic
1037276818 8:17189290-17189312 CAGGGAAAGCCGAGGGTAGTGGG - Intronic
1037742731 8:21620421-21620443 AATGGAGATCAGAGGGTGGGAGG - Intergenic
1038283977 8:26190471-26190493 CGGGTAGAGCAGCGGGAGGAGGG - Intergenic
1038328575 8:26590456-26590478 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328585 8:26590516-26590538 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328595 8:26590576-26590598 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328605 8:26590636-26590658 CAGTGACACCTGAGGGTGGATGG - Intronic
1038499164 8:28029186-28029208 AAGCGAGTGCAGAAGGTGGAAGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039374938 8:37023861-37023883 CAGGGAGAGCAGAGATAGCAAGG - Intergenic
1039397714 8:37241196-37241218 AACAGAGAGCAGAGGCTGGAAGG - Intergenic
1039794444 8:40900299-40900321 CCAGCAGAGCAGAGTGTGGAGGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1039900026 8:41745111-41745133 CAGAGAGAGGAAAGGATGGAGGG + Intronic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040537585 8:48323336-48323358 GAGACAGGGCAGAGGGTGGAGGG + Intergenic
1040575500 8:48647920-48647942 CAGGGAAAGGAGATGATGGATGG + Intergenic
1040859197 8:51981928-51981950 CCGGGAGGGCAGAGGTTGCAGGG - Intergenic
1041714426 8:60921441-60921463 CCGGGAGGGCAGGGGGAGGAGGG - Intergenic
1041746835 8:61216387-61216409 CAGACAGACTAGAGGGTGGATGG - Intronic
1042184882 8:66126972-66126994 CAGGGAGTGAAGAGAGTGGGTGG - Exonic
1042976938 8:74479840-74479862 CAGCAAGAGCAGAGGCTGTAGGG + Intronic
1043372888 8:79613161-79613183 CATAGAGAACAGAGGGTGGGCGG - Intronic
1044545685 8:93456537-93456559 CGGGGAGAGTAGGGGGTGGTTGG + Intergenic
1045108979 8:98921440-98921462 CATGGAGTGCTGAGGGAGGAAGG + Intronic
1045127123 8:99104556-99104578 AAGGGAGAGGGGAGGGGGGACGG - Intronic
1045429293 8:102098262-102098284 GAAGGACTGCAGAGGGTGGAGGG + Intronic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1048924764 8:139261623-139261645 CAAAGAGACCAGAGGCTGGAAGG - Intergenic
1048928387 8:139291214-139291236 CAGGGAGAGCAGAGCTTAGTAGG - Intergenic
1049071407 8:140358600-140358622 AGGGGAAAGCAGTGGGTGGAGGG + Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049370313 8:142261199-142261221 AAGGGAGGGGAGAGGGAGGAGGG + Intronic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049528504 8:143141881-143141903 CAGGGAGAGGCCAGGGTGAAGGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050561076 9:6834858-6834880 CAGGGACAGCACGGGCTGGATGG - Intronic
1051352048 9:16206104-16206126 AAGGGAGAGCAGAGGTGGGTGGG + Intronic
1051658196 9:19402708-19402730 CAGGCAGAGCACTGGGGGGAGGG - Intergenic
1051799589 9:20917597-20917619 CAGTTAGAGAAGATGGTGGAAGG - Intronic
1051853425 9:21535605-21535627 GAGGGAGAAAGGAGGGTGGAGGG + Intergenic
1052355172 9:27496728-27496750 CAGGGAGAGTTTAGAGTGGATGG - Intronic
1052820873 9:33137192-33137214 CAGACAGAGCTGAGGGTGAAGGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053388127 9:37711485-37711507 CGGGGAAGGCAAAGGGTGGAGGG + Intronic
1055110836 9:72557671-72557693 CAGGGACAGCAGTGGGAGTAGGG + Intronic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055416516 9:76090214-76090236 CAGGGAGAAGGGAGGGTGCATGG - Intronic
1055427772 9:76213836-76213858 CAAGGAAAGCAAAGGGTTGAAGG - Intronic
1055575935 9:77660330-77660352 AAGGGAAGGAAGAGGGTGGAGGG - Intergenic
1056010250 9:82321700-82321722 CTGGGAGGGCAGGGGGTGGGAGG - Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057217869 9:93239328-93239350 CAGGGAGCTCAGAGCGTGGGGGG + Intronic
1057305278 9:93908733-93908755 CAGGGAGAGCACCCGGTGCAGGG - Intergenic
1057353790 9:94319593-94319615 CAGGTAGAGCAGCGGAGGGAGGG - Exonic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058354752 9:104071156-104071178 GAGGGAGAGAGGAGGATGGAAGG + Intergenic
1058759749 9:108119467-108119489 TATGGAGAGCACAGGGTAGAAGG + Intergenic
1058811017 9:108639601-108639623 AAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059559306 9:115316938-115316960 CAGTGAGAGCTAAGGGTGGCTGG - Intronic
1059807800 9:117822826-117822848 TAGAGAGTGAAGAGGGTGGAGGG - Intergenic
1060168751 9:121443194-121443216 CAGGCAGAGGAGTAGGTGGAAGG - Intergenic
1060397526 9:123326596-123326618 CAGGGAGAGGAGAGGTGGGGAGG - Intergenic
1060497553 9:124129568-124129590 CAGGAAGAGCATTGAGTGGATGG + Intergenic
1060893473 9:127202863-127202885 CTGGGAGAGCAGAGTGTGCTGGG - Intronic
1060899913 9:127248210-127248232 CATGGAGAAGAGAGGTTGGAAGG + Intronic
1060920128 9:127414553-127414575 AAGGGGGAATAGAGGGTGGAAGG - Intergenic
1060968932 9:127727054-127727076 CAGCTGGAGCAGATGGTGGAGGG + Exonic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061246094 9:129401869-129401891 CAGGGAGAGCAGAGCTGTGAAGG - Intergenic
1061250198 9:129421950-129421972 CAGGGAGAGCAGTGGGGACAAGG - Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061490555 9:130941665-130941687 AAGGGAAATCCGAGGGTGGAGGG - Intergenic
1061887429 9:133598939-133598961 CAGGGAGAGCCCAGGGCAGATGG + Intergenic
1061938715 9:133872636-133872658 CGGGGAGAGAAGAGGCTGGAAGG + Intronic
1062088218 9:134659627-134659649 CAGGGAGGACAGAGGGTTGTTGG - Intronic
1062139110 9:134945673-134945695 AGCGGAGGGCAGAGGGTGGAGGG + Intergenic
1062189898 9:135242576-135242598 CAGAGACAGCAGAGGTTGCAAGG - Intergenic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062369760 9:136231887-136231909 GAGGGGGTGGAGAGGGTGGAGGG - Intronic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1062443955 9:136585604-136585626 AGGGGAGGGCAGAGGGTGGCTGG + Intergenic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062615925 9:137395639-137395661 CAGGGAGGGCAGGGGGTGGGAGG + Intronic
1062629711 9:137458335-137458357 CAGGGAGGGCAGGGGATGTAAGG + Intronic
1062722346 9:138050971-138050993 CAGGAAGAGCACAGGGGGCAGGG + Intronic
1062731358 9:138111888-138111910 CAAGGAGAGCAGAGCGGGGAAGG - Intronic
1062746045 9:138212709-138212731 CAGGGAGAGAAGAGGTTCTAGGG + Intergenic
1185430849 X:10974-10996 CAGGCAGAGCTGGGGCTGGATGG - Intergenic
1185440115 X:223371-223393 CAGGCAGAGCTGGGGCTGGATGG - Intergenic
1185459548 X:328353-328375 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459565 X:328381-328403 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459576 X:328401-328423 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459587 X:328421-328443 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459638 X:328525-328547 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459655 X:328553-328575 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459666 X:328573-328595 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459677 X:328593-328615 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459708 X:328655-328677 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459725 X:328683-328705 CGGGGAGAGGGGAGGGGGGATGG - Intergenic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185459922 X:329063-329085 CGGGGAGAGAGGAGGGGGGACGG - Intergenic
1185459931 X:329083-329105 CGGGGAGAGAGGAGGGGGGACGG - Intergenic
1185525049 X:771868-771890 GAGAGAGAGCAGTGGCTGGATGG - Intergenic
1185581511 X:1213610-1213632 GAGGGAGAGGGGAGGGAGGAGGG - Intergenic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1186139929 X:6561273-6561295 CCTGGAGAGCTGAGGGTGCAAGG - Intergenic
1186206505 X:7206009-7206031 TAGGGGGTGCAGTGGGTGGATGG - Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187478773 X:19635762-19635784 CAGGGACAGGAGGGGGTGGTTGG - Intronic
1188050172 X:25474843-25474865 CTAGGAGACCAGAGGGTGCAGGG + Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189272701 X:39762337-39762359 AAGGGAGAGTAGAGAGTGGTTGG - Intergenic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1192733652 X:73827112-73827134 CAAGTAGGGCAGAAGGTGGAAGG - Intergenic
1193708098 X:84847196-84847218 CAGGGTGGGCTGTGGGTGGAGGG + Intergenic
1193925766 X:87482090-87482112 AACGGAGAGGAGAGGTTGGAGGG + Intergenic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195280897 X:103331228-103331250 GGGGGAGATGAGAGGGTGGAGGG + Intronic
1195557220 X:106240876-106240898 AAGGGAGAGTAGGGGGAGGAGGG + Intergenic
1195751860 X:108167896-108167918 AAGGGAAGGAAGAGGGTGGAGGG - Intronic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1196052462 X:111319937-111319959 AAGGGAGAGTAATGGGTGGAGGG - Intronic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1197230556 X:123999432-123999454 CAGGGAGAGAAGGGGGAGGGAGG - Intronic
1197445861 X:126552063-126552085 CAGGGAGGGCAGCTGGTAGATGG + Exonic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1197771511 X:130092349-130092371 CAGGGAGTGCAGAGAGGGAAGGG + Intronic
1198567153 X:137916383-137916405 CAGGCAGGGCAGTGGGGGGATGG + Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1201506959 Y:14712485-14712507 GAGGGAAAGCATAGGTTGGAAGG - Intronic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1201984458 Y:19950475-19950497 AACTGAGGGCAGAGGGTGGAAGG - Intergenic